ID: 960533679

View in Genome Browser
Species Human (GRCh38)
Location 3:118793441-118793463
Sequence GGGGCCTGACCTAGACTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960533679_960533688 29 Left 960533679 3:118793441-118793463 CCCTCCAGTCTAGGTCAGGCCCC No data
Right 960533688 3:118793493-118793515 TTTCCTTTATTCCTCCTCTCAGG No data
960533679_960533682 -5 Left 960533679 3:118793441-118793463 CCCTCCAGTCTAGGTCAGGCCCC No data
Right 960533682 3:118793459-118793481 GCCCCTATTATACATTTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960533679 Original CRISPR GGGGCCTGACCTAGACTGGA GGG (reversed) Intergenic