ID: 960533681

View in Genome Browser
Species Human (GRCh38)
Location 3:118793445-118793467
Sequence AATAGGGGCCTGACCTAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960533681_960533688 25 Left 960533681 3:118793445-118793467 CCAGTCTAGGTCAGGCCCCTATT No data
Right 960533688 3:118793493-118793515 TTTCCTTTATTCCTCCTCTCAGG No data
960533681_960533682 -9 Left 960533681 3:118793445-118793467 CCAGTCTAGGTCAGGCCCCTATT No data
Right 960533682 3:118793459-118793481 GCCCCTATTATACATTTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960533681 Original CRISPR AATAGGGGCCTGACCTAGAC TGG (reversed) Intergenic