ID: 960533681 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:118793445-118793467 |
| Sequence | AATAGGGGCCTGACCTAGAC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 960533681_960533688 | 25 | Left | 960533681 | 3:118793445-118793467 | CCAGTCTAGGTCAGGCCCCTATT | No data | ||
| Right | 960533688 | 3:118793493-118793515 | TTTCCTTTATTCCTCCTCTCAGG | No data | ||||
| 960533681_960533682 | -9 | Left | 960533681 | 3:118793445-118793467 | CCAGTCTAGGTCAGGCCCCTATT | No data | ||
| Right | 960533682 | 3:118793459-118793481 | GCCCCTATTATACATTTGCATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 960533681 | Original CRISPR | AATAGGGGCCTGACCTAGAC TGG (reversed) | Intergenic | ||