ID: 960533682

View in Genome Browser
Species Human (GRCh38)
Location 3:118793459-118793481
Sequence GCCCCTATTATACATTTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960533680_960533682 -6 Left 960533680 3:118793442-118793464 CCTCCAGTCTAGGTCAGGCCCCT No data
Right 960533682 3:118793459-118793481 GCCCCTATTATACATTTGCATGG No data
960533679_960533682 -5 Left 960533679 3:118793441-118793463 CCCTCCAGTCTAGGTCAGGCCCC No data
Right 960533682 3:118793459-118793481 GCCCCTATTATACATTTGCATGG No data
960533678_960533682 -4 Left 960533678 3:118793440-118793462 CCCCTCCAGTCTAGGTCAGGCCC No data
Right 960533682 3:118793459-118793481 GCCCCTATTATACATTTGCATGG No data
960533681_960533682 -9 Left 960533681 3:118793445-118793467 CCAGTCTAGGTCAGGCCCCTATT No data
Right 960533682 3:118793459-118793481 GCCCCTATTATACATTTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960533682 Original CRISPR GCCCCTATTATACATTTGCA TGG Intergenic