ID: 960533688

View in Genome Browser
Species Human (GRCh38)
Location 3:118793493-118793515
Sequence TTTCCTTTATTCCTCCTCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960533680_960533688 28 Left 960533680 3:118793442-118793464 CCTCCAGTCTAGGTCAGGCCCCT No data
Right 960533688 3:118793493-118793515 TTTCCTTTATTCCTCCTCTCAGG No data
960533678_960533688 30 Left 960533678 3:118793440-118793462 CCCCTCCAGTCTAGGTCAGGCCC No data
Right 960533688 3:118793493-118793515 TTTCCTTTATTCCTCCTCTCAGG No data
960533681_960533688 25 Left 960533681 3:118793445-118793467 CCAGTCTAGGTCAGGCCCCTATT No data
Right 960533688 3:118793493-118793515 TTTCCTTTATTCCTCCTCTCAGG No data
960533683_960533688 10 Left 960533683 3:118793460-118793482 CCCCTATTATACATTTGCATGGC No data
Right 960533688 3:118793493-118793515 TTTCCTTTATTCCTCCTCTCAGG No data
960533684_960533688 9 Left 960533684 3:118793461-118793483 CCCTATTATACATTTGCATGGCT No data
Right 960533688 3:118793493-118793515 TTTCCTTTATTCCTCCTCTCAGG No data
960533679_960533688 29 Left 960533679 3:118793441-118793463 CCCTCCAGTCTAGGTCAGGCCCC No data
Right 960533688 3:118793493-118793515 TTTCCTTTATTCCTCCTCTCAGG No data
960533685_960533688 8 Left 960533685 3:118793462-118793484 CCTATTATACATTTGCATGGCTC No data
Right 960533688 3:118793493-118793515 TTTCCTTTATTCCTCCTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960533688 Original CRISPR TTTCCTTTATTCCTCCTCTC AGG Intergenic