ID: 960534010

View in Genome Browser
Species Human (GRCh38)
Location 3:118796493-118796515
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960534010_960534013 22 Left 960534010 3:118796493-118796515 CCTAGATCATAGTTCTAAATCTT No data
Right 960534013 3:118796538-118796560 TCATTTTGTTTTTATGCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960534010 Original CRISPR AAGATTTAGAACTATGATCT AGG (reversed) Intergenic
No off target data available for this crispr