ID: 960535657

View in Genome Browser
Species Human (GRCh38)
Location 3:118812137-118812159
Sequence CTTTGCAAAGGGTAGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960535648_960535657 7 Left 960535648 3:118812107-118812129 CCATTCATCTCATCCTGACCACA No data
Right 960535657 3:118812137-118812159 CTTTGCAAAGGGTAGGTGGATGG No data
960535649_960535657 -6 Left 960535649 3:118812120-118812142 CCTGACCACACACCATCCTTTGC No data
Right 960535657 3:118812137-118812159 CTTTGCAAAGGGTAGGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960535657 Original CRISPR CTTTGCAAAGGGTAGGTGGA TGG Intergenic
No off target data available for this crispr