ID: 960537166

View in Genome Browser
Species Human (GRCh38)
Location 3:118827022-118827044
Sequence AGCCCATATCCTAAGCATTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960537166_960537168 -4 Left 960537166 3:118827022-118827044 CCTTAATGCTTAGGATATGGGCT No data
Right 960537168 3:118827041-118827063 GGCTTCCCAGGCCTGATCCATGG No data
960537166_960537173 14 Left 960537166 3:118827022-118827044 CCTTAATGCTTAGGATATGGGCT No data
Right 960537173 3:118827059-118827081 CATGGTGACCTGCACTCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960537166 Original CRISPR AGCCCATATCCTAAGCATTA AGG (reversed) Intergenic
No off target data available for this crispr