ID: 960537169

View in Genome Browser
Species Human (GRCh38)
Location 3:118827046-118827068
Sequence GGTCACCATGGATCAGGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960537169_960537173 -10 Left 960537169 3:118827046-118827068 CCCAGGCCTGATCCATGGTGACC No data
Right 960537173 3:118827059-118827081 CATGGTGACCTGCACTCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960537169 Original CRISPR GGTCACCATGGATCAGGCCT GGG (reversed) Intergenic
No off target data available for this crispr