ID: 960538148

View in Genome Browser
Species Human (GRCh38)
Location 3:118835487-118835509
Sequence CTTTTGCTATGGAGGGAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960538148_960538155 4 Left 960538148 3:118835487-118835509 CCTCCTTCCCTCCATAGCAAAAG No data
Right 960538155 3:118835514-118835536 AAGAGAGAATAAGAGAGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960538148 Original CRISPR CTTTTGCTATGGAGGGAAGG AGG (reversed) Intergenic
No off target data available for this crispr