ID: 960550597

View in Genome Browser
Species Human (GRCh38)
Location 3:118972073-118972095
Sequence CTTTCTGTTCTTAGGAACTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 295
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 266}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960550597_960550602 7 Left 960550597 3:118972073-118972095 CCCAAGTTCCTAAGAACAGAAAG 0: 1
1: 0
2: 1
3: 27
4: 266
Right 960550602 3:118972103-118972125 TCAAGTGTATCCTTTCTTTAGGG 0: 1
1: 0
2: 0
3: 20
4: 236
960550597_960550601 6 Left 960550597 3:118972073-118972095 CCCAAGTTCCTAAGAACAGAAAG 0: 1
1: 0
2: 1
3: 27
4: 266
Right 960550601 3:118972102-118972124 CTCAAGTGTATCCTTTCTTTAGG 0: 1
1: 0
2: 3
3: 13
4: 230
960550597_960550603 8 Left 960550597 3:118972073-118972095 CCCAAGTTCCTAAGAACAGAAAG 0: 1
1: 0
2: 1
3: 27
4: 266
Right 960550603 3:118972104-118972126 CAAGTGTATCCTTTCTTTAGGGG 0: 1
1: 0
2: 1
3: 8
4: 139
960550597_960550604 9 Left 960550597 3:118972073-118972095 CCCAAGTTCCTAAGAACAGAAAG 0: 1
1: 0
2: 1
3: 27
4: 266
Right 960550604 3:118972105-118972127 AAGTGTATCCTTTCTTTAGGGGG 0: 1
1: 0
2: 1
3: 15
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960550597 Original CRISPR CTTTCTGTTCTTAGGAACTT GGG (reversed) Intronic
901248296 1:7751252-7751274 TTTTTTGTTCATAGTAACTTCGG - Exonic
901917884 1:12513902-12513924 CTTTCTGTTATTAGGGTCTTGGG - Intergenic
902135854 1:14304523-14304545 CATTCCGTTCTGAGGAAGTTTGG + Intergenic
902623701 1:17664785-17664807 CTTTCTGTTCTTGGTAGCCTTGG - Intronic
902681811 1:18049048-18049070 CTTTGCAGTCTTAGGAACTTGGG - Intergenic
904625981 1:31802672-31802694 CTTTCTACTTGTAGGAACTTGGG + Intronic
904794428 1:33048593-33048615 GTTTCTGTTCTGTTGAACTTGGG + Intronic
906451671 1:45954628-45954650 CTTTATCTTCTTAGGATCCTGGG + Intronic
906803262 1:48755829-48755851 CTTTCTGAGCCTAGGAACTTAGG - Intronic
906865453 1:49413535-49413557 CTTTTTATTCTTTGCAACTTGGG - Intronic
907941211 1:59089433-59089455 CTTTCTGTTCTTAGTAAAGCAGG - Intergenic
908324629 1:63011623-63011645 ATTTCTTTTATTAGGAATTTAGG - Intergenic
909214531 1:72869544-72869566 CTTTCAGTTCCTGGGACCTTGGG + Intergenic
910647430 1:89528791-89528813 CTTTCTGCTACTTGGAACTTGGG - Intronic
911328833 1:96501815-96501837 ACTTCTGTTTTTAGGAAGTTTGG - Intergenic
911711910 1:101083327-101083349 CTTTCTGTTTTTTGTAAGTTTGG + Intergenic
912268713 1:108187722-108187744 CTTTCTGTTCTCTGGAAAATTGG - Intronic
913390621 1:118307475-118307497 GTTTTTGTTCGTAGGAACATTGG + Intergenic
914948176 1:152085551-152085573 CTTTCTCTTCTTTGCTACTTGGG + Exonic
916240826 1:162637835-162637857 ATTCTTGTCCTTAGGAACTTAGG + Intronic
917732424 1:177889124-177889146 CTTTCTTTTCTTTGGGAGTTAGG - Intergenic
918046234 1:180942648-180942670 CTCACTGTTCTTATGAAGTTAGG + Intronic
918747933 1:188230025-188230047 ATTTCTGTTCTTGTGAGCTTTGG + Intergenic
919147924 1:193658375-193658397 CTTTCTCTTCTAAGGACCTAGGG - Intergenic
919361426 1:196600403-196600425 CTTTGTGCTCTTAGGAGCTGTGG - Intronic
920003066 1:202812401-202812423 GTTTCTGTTCTTGGGAAGCTGGG + Intergenic
922612139 1:226938615-226938637 AATTCTGTTCTTGGGAACTCAGG + Intronic
924406764 1:243755864-243755886 CTTTCTTTTCTTAAGTATTTAGG + Intronic
1063225835 10:4013877-4013899 CTCTCTGTTCACAGGAGCTTGGG + Intergenic
1063972273 10:11389401-11389423 CTTCCTGTTCTCAGGAAGCTTGG + Intergenic
1066107335 10:32167457-32167479 CTTGCTGTGCTTTGGAACCTTGG + Intergenic
1068344323 10:55752894-55752916 CTGTCTTTTCGTAGTAACTTTGG + Intergenic
1069395153 10:67979676-67979698 CTTTCTGTTTTCAGGATCCTTGG - Intronic
1070939849 10:80334925-80334947 CTTTCTATTCTTAAGGACATAGG - Intergenic
1074036602 10:109745436-109745458 CTTTATGTTCTATGGAACTGGGG - Intergenic
1077732978 11:4754154-4754176 CTTTCAGTTTTTATGAACTTTGG - Intronic
1078112141 11:8404270-8404292 CTTTCTTTTCTTTGTAACTGAGG + Intronic
1080925236 11:36749355-36749377 ATTTCAGTTCTTACCAACTTTGG + Intergenic
1083594023 11:63910541-63910563 GTTTCTGTTCTTGAGAAATTGGG + Exonic
1085828872 11:79878080-79878102 CTTTCTGTCCTTCTGACCTTGGG + Intergenic
1086827216 11:91513966-91513988 TTTTCTGTTCCTGGGAACATCGG - Intergenic
1087052921 11:93904463-93904485 CTTTCTGTTTTTAAGAGCCTGGG + Intergenic
1087435012 11:98104484-98104506 GTTTCTGTTCTTAGGAAAAGAGG - Intergenic
1088447036 11:109942470-109942492 ATTTCTGTGCCTAAGAACTTTGG + Intergenic
1088726747 11:112645382-112645404 CTTTCTGTCCATAGGAGCTTAGG + Intergenic
1088969516 11:114760613-114760635 CTTGCTGTTCACAGGCACTTTGG - Intergenic
1089096717 11:115925673-115925695 TTTTCTGTTCTGGGGAATTTGGG - Intergenic
1089207823 11:116779128-116779150 CATTCTGTTCTTGGGAAGGTGGG - Intronic
1090429789 11:126636090-126636112 CTTACTATTTTTAGGACCTTGGG + Intronic
1092647905 12:10599168-10599190 CTTCTTTTTCTTAGGAAATTAGG - Intergenic
1093208196 12:16276381-16276403 GTTTCTGATCTGAGCAACTTGGG - Intronic
1093548664 12:20379455-20379477 CTTTCTAGTCTCAGGAACTAAGG + Intronic
1093647420 12:21603049-21603071 GGTTCTGTTCCCAGGAACTTTGG + Intronic
1094860452 12:34460342-34460364 CTTTCTTTTTTTAGGCAGTTTGG - Intergenic
1094883607 12:34834640-34834662 CTTTCTTTTCTTAAGCAGTTTGG - Intergenic
1095029513 12:37251355-37251377 CTTTCTTTTCTTAAGCAGTTTGG - Intergenic
1098804040 12:74999784-74999806 CTTTCTGTTGTCTGGAACTCCGG - Intergenic
1099647888 12:85382632-85382654 CCTTGTGTTGTTAGGTACTTAGG - Intergenic
1099849213 12:88070873-88070895 AGTTCAGTTCTTAGAAACTTTGG - Intronic
1100149370 12:91716756-91716778 CTCTCTTTTCATAGTAACTTTGG - Intergenic
1100398714 12:94208412-94208434 CTTTCAATTCTTAAGAATTTAGG - Intronic
1101069264 12:101056755-101056777 CCTTCTATTATTAGGAACTGAGG + Intronic
1102695834 12:114798669-114798691 CTTTCTGTTATTATGAACTCTGG - Intergenic
1105318742 13:19295606-19295628 GTTTCTGTTCCTAGTAACTCTGG + Intergenic
1105425393 13:20290342-20290364 CTTGCTGTTCTAAGTAACTGTGG - Intergenic
1106449565 13:29867913-29867935 CTTTCTGTTTTTAAGAGTTTAGG + Intergenic
1106771881 13:32969300-32969322 CTTACTGTGCTTAGAAGCTTTGG + Intergenic
1107025195 13:35794683-35794705 ATTTCTTTTCTTCGTAACTTGGG + Intronic
1107275524 13:38674233-38674255 CTTTCTGTTCCCACGATCTTAGG + Intergenic
1108409953 13:50135397-50135419 CTTTATGCTCTCAGGAAGTTGGG + Intronic
1109084555 13:57952686-57952708 GTTTCTGTTCTTAAGGACTGTGG - Intergenic
1109364004 13:61331673-61331695 TTCTCTGTTCTTAAGAACTCTGG + Intergenic
1109625627 13:64970023-64970045 TCTTTTGTTCTTAGGAATTTAGG - Intergenic
1110309450 13:74031154-74031176 CTTTTTGCTCTTTGGAAATTTGG + Intronic
1110751986 13:79125117-79125139 CTTTCTGTGCTGACCAACTTTGG + Intergenic
1112926908 13:104687518-104687540 CTTTCTCTTCTTTGGAAATTTGG + Intergenic
1112957191 13:105074122-105074144 TTTATTGTTTTTAGGAACTTAGG - Intergenic
1115366314 14:32561540-32561562 CTTTGTGTTCCTTGGAACTTTGG + Intronic
1117575249 14:57091288-57091310 CTTCCCGTTCTTGGGGACTTAGG + Intergenic
1117812308 14:59560710-59560732 CTGTATTTTCTTAGGAAGTTTGG + Intronic
1118476444 14:66121658-66121680 CTTTGTGTTGTTAAGAACTTTGG + Intergenic
1120159970 14:81135421-81135443 TATTCTGATTTTAGGAACTTAGG - Intronic
1121519053 14:94573224-94573246 CTTTCTGTACTTTGCAACTAGGG + Intronic
1125045348 15:35238567-35238589 CTTTCTCTTCTTGGAAATTTGGG + Intronic
1126168620 15:45675300-45675322 CTCTCTGATCTTAGGCATTTGGG + Intronic
1127863866 15:63015751-63015773 TTTTCTGATCTTTTGAACTTGGG - Intergenic
1128302284 15:66573880-66573902 ATTTCAGTTCTTGAGAACTTTGG - Intergenic
1130135449 15:81177960-81177982 CTGTATGTTCCTAGGGACTTTGG - Intronic
1133948683 16:10371318-10371340 ATTTCTGTTGTTACAAACTTAGG + Intronic
1133998640 16:10766033-10766055 CTGTCTGTTCCTAGGAAGGTGGG - Intronic
1135105325 16:19644607-19644629 CTTTCACTTCTTTGGAACTTGGG - Intronic
1135409479 16:22222507-22222529 CTTTCTTTTCTTTAAAACTTTGG + Intronic
1138981499 16:62274263-62274285 CTTCCTGCTCTTAGAAAGTTTGG - Intergenic
1142221209 16:88856174-88856196 CTTTCAGTTCTTCAGACCTTAGG + Intronic
1143558223 17:7675911-7675933 ATTTCTTTTGTTTGGAACTTTGG - Intronic
1145396054 17:22495978-22496000 TTTTCCTTTCTTAGGAACCTTGG + Intergenic
1148627598 17:49081648-49081670 CTTTCTGTCCATAGAAAGTTGGG + Intergenic
1149455507 17:56784829-56784851 CTTTTTGTTCTTAAGATATTGGG - Intergenic
1150544727 17:66143690-66143712 CTTTCTGTTTGTATGAATTTGGG - Intronic
1153183485 18:2461396-2461418 CTTTCTGACCCTAGTAACTTTGG - Intergenic
1153453949 18:5260094-5260116 CTCTCTGTTCTGAGCCACTTGGG - Intergenic
1156536383 18:37868601-37868623 CTTTCTGTGCGCAGGAACTCAGG - Intergenic
1157008844 18:43621688-43621710 CTTACTGTTTTTGGAAACTTAGG - Intergenic
1157036234 18:43978401-43978423 CTTGCTGCTCTTTGGAACCTGGG - Intergenic
1157818044 18:50744925-50744947 CTGTCTGTTTTTAGGAAAATGGG + Intergenic
1158211693 18:55057708-55057730 CTTTCTGTTCTTAGGATTGCAGG - Intergenic
1158502436 18:58015229-58015251 CTTTCTGTTCTTGTGAGCTGGGG + Intergenic
1158619788 18:59023015-59023037 ATTTTTATTCTTAGGAACTCTGG - Intergenic
1159426104 18:68288951-68288973 CTTTCTCATCTTAGGTATTTTGG - Intergenic
1161121163 19:2527608-2527630 CTTTAGGATTTTAGGAACTTCGG - Intronic
1163031419 19:14546636-14546658 CTTTCTATGCTTAGAACCTTTGG + Intronic
1164471671 19:28541496-28541518 CTTTGTGTTCTTGGAAGCTTTGG - Intergenic
925345984 2:3172239-3172261 CTCTGGGTTCTTAGGAAGTTGGG - Intergenic
925632403 2:5908215-5908237 CTTTCTGTGGTTAAGAACTGTGG + Intergenic
926222723 2:10946758-10946780 CTTTCTTACCTCAGGAACTTTGG + Intergenic
926517884 2:13872045-13872067 CTTTCTGATCATAAGTACTTTGG + Intergenic
926719209 2:15946389-15946411 CTTTCTGTTGTTTGGAAACTTGG - Exonic
929334871 2:40730045-40730067 CTTTCTTTTCTGAGAAACCTTGG + Intergenic
930311558 2:49747523-49747545 TATTCTTTTCTCAGGAACTTTGG + Intergenic
930801818 2:55450727-55450749 CTTTCTATACTTGGGATCTTTGG - Intergenic
930802314 2:55455829-55455851 CTTTCTATACTTGGGATCTTTGG - Intergenic
932090053 2:68798384-68798406 CTGTCTGTTGTTAGGAGCTGAGG - Intronic
932608427 2:73179897-73179919 CTTTCTGTTGTTAAAAAGTTTGG - Intergenic
933293952 2:80469164-80469186 CTTTCTTTTCTTAGGGTCTGAGG + Intronic
935366280 2:102294297-102294319 ATTTTTCTTCTTAAGAACTTTGG + Intergenic
937154753 2:119711029-119711051 CTTCCTGTGCTTGGGGACTTGGG - Intergenic
937522161 2:122724990-122725012 CATTCTGTTTTTACCAACTTTGG - Intergenic
939098668 2:137868028-137868050 CTTACTGCTCTTAGCATCTTGGG - Intergenic
940904907 2:159160494-159160516 CTTTCTCTTCTTGGGGACTCCGG + Intronic
941232974 2:162934232-162934254 CTCTCTGTCCAGAGGAACTTTGG + Intergenic
943207138 2:184914534-184914556 ATTTCTGTTATTAGGAAATTTGG - Intronic
943302242 2:186217998-186218020 GTGTCATTTCTTAGGAACTTAGG + Intergenic
944461560 2:199955490-199955512 CTTCCAGGTCTTCGGAACTTCGG + Exonic
944977846 2:205077394-205077416 TTTTCTGTTTTTAAGAACTTGGG + Intronic
945211993 2:207393163-207393185 CTTTGTCTTCTAAAGAACTTTGG + Intergenic
947430301 2:230021994-230022016 TTTTCTTTTCTTAAGAACATAGG + Intergenic
947519539 2:230833838-230833860 CTTTCTGTTCTCATAAACTTGGG - Intergenic
1169646355 20:7814138-7814160 CTTTCTGTTGATAGGCACTTAGG + Intergenic
1170551079 20:17476906-17476928 CTTTCTGTTCCCAGGATCTGGGG - Intronic
1170898002 20:20433864-20433886 CTTTCTGTTCTGATAAATTTCGG - Intronic
1170936416 20:20813958-20813980 CTTTCTCTTCCTGGGGACTTAGG - Intergenic
1171096578 20:22337769-22337791 CTTTCAGTTCTCAGGCACTAGGG + Intergenic
1171522696 20:25787655-25787677 CTGTCTGGTCAGAGGAACTTGGG + Intronic
1171530441 20:25849624-25849646 CTGTCTGGTCAGAGGAACTTGGG + Intronic
1171554131 20:26068228-26068250 CTGTCTGGTCAGAGGAACTTGGG - Intergenic
1173786675 20:45798640-45798662 CTTGCTGTTCTTAGTACCTGGGG + Intronic
1174441786 20:50561403-50561425 GTTTTTGTTCTTAGGAAGCTTGG - Exonic
1174491892 20:50905129-50905151 ACTTCTGTTTTAAGGAACTTGGG - Intronic
1174514829 20:51083677-51083699 CTTGCTGTTCTTCGGCACATTGG - Intergenic
1177321592 21:19528607-19528629 CTTTCTGTTCTTATTATCTGAGG - Intergenic
1177830898 21:26137601-26137623 CTTTCTGTTCTTAGCGTCTGTGG - Intronic
1177844504 21:26272724-26272746 CTTTATGTTCTCTGTAACTTAGG - Intergenic
1178960798 21:37063127-37063149 CTATCTTTTCTTAAGATCTTAGG - Exonic
949447524 3:4150824-4150846 TCTTCTGTTCTTAGGAGCTCAGG + Intronic
949562632 3:5216528-5216550 CTTTCTGTTGTTAGATAATTGGG + Exonic
950633719 3:14300704-14300726 CTTTCTATTCCTGGGACCTTGGG - Intergenic
952220955 3:31324006-31324028 CATCCTGTTCTTAGTTACTTTGG - Intergenic
952680087 3:36081791-36081813 TTTTGTGTTCTGAGGAAGTTTGG - Intergenic
955165057 3:56502778-56502800 ATATGTGTTCTTAGGTACTTAGG + Intergenic
955550132 3:60075100-60075122 GTTTCTGGTCATAGGAACTTTGG - Intronic
955554093 3:60117550-60117572 TTTTATGTTCTTAAGAATTTAGG + Intronic
955905171 3:63799942-63799964 CATTTTGTTCTTAGGAATCTTGG - Intergenic
957756053 3:84489190-84489212 CTTTATGTACTTGGGAACTCTGG + Intergenic
957861355 3:85955553-85955575 TTTTCTGTGCTTAGAAACTATGG - Intronic
959233839 3:103692455-103692477 CTTTGTTTTCTTAGGAAAATTGG + Intergenic
960550597 3:118972073-118972095 CTTTCTGTTCTTAGGAACTTGGG - Intronic
961207555 3:125097572-125097594 GTGTGTGTTCTGAGGAACTTGGG + Intronic
961930480 3:130528136-130528158 CCTTCTGTCCTTATTAACTTAGG - Intergenic
962267352 3:133953407-133953429 CTTTCTGCCCTTAAGAAGTTTGG - Intronic
962727228 3:138242526-138242548 CGATCTATTCTAAGGAACTTAGG - Intronic
963037887 3:141048245-141048267 CTTTCAGTTCTGAGAAATTTTGG - Intergenic
963963014 3:151331374-151331396 CTTTCTTTTCTTATGACCTTAGG + Intronic
965421800 3:168468882-168468904 CTCTGTGTTGTTTGGAACTTAGG + Intergenic
967731371 3:192909990-192910012 CTTTCTTTGCTTAGGCTCTTAGG - Intronic
969611583 4:8230266-8230288 ATTTCTGATTTTAGAAACTTGGG + Intronic
969899655 4:10337221-10337243 CTGACTGTTCTTAGCAGCTTAGG - Intergenic
970126711 4:12821768-12821790 CATTCTATTATTAGGAACATAGG - Intergenic
970314492 4:14816365-14816387 CTAGCTGTTCCTAAGAACTTGGG - Intergenic
971395048 4:26219561-26219583 CTTTTTATTCATAGGGACTTCGG - Intronic
972031817 4:34469673-34469695 CTTTCTTTTCTAAAGAACCTTGG + Intergenic
972851387 4:43055214-43055236 ATTTCTGTTCTTTCCAACTTTGG + Intergenic
973649866 4:52987946-52987968 CTTTCTCTTCATATGCACTTTGG - Intronic
973672290 4:53233186-53233208 CCTTTTATTCTTAGGAACCTAGG + Intronic
973807389 4:54539459-54539481 CTTTCTCTTCTTAGCAAGCTGGG - Intergenic
975143547 4:70941706-70941728 CTTTCTTTTCAGAGAAACTTTGG + Intronic
975324560 4:73044670-73044692 CTCTCCTTTCTTAGGATCTTTGG + Intergenic
976145088 4:82034454-82034476 CTTGGAGTGCTTAGGAACTTTGG - Intronic
976624432 4:87164804-87164826 CTTTCTATTCTCAGTAAATTAGG - Intronic
976935349 4:90624112-90624134 TTTTCTGTTCTTTGGAAATTTGG + Intronic
979456268 4:120928948-120928970 CTTTCTTCTTGTAGGAACTTTGG - Intergenic
981820580 4:148882072-148882094 CTTTCAGTTCTCAGGAACCTGGG - Intergenic
982829188 4:160039722-160039744 CTTTCTTTTCTAAGAAACTAAGG - Intergenic
984387477 4:179080949-179080971 CTTTCTGTTTTGTAGAACTTGGG - Intergenic
984814899 4:183826804-183826826 CTTTCTCTTCTGAGGGTCTTTGG - Intergenic
985135518 4:186782212-186782234 GTTTCTCTTCTTAGGAACTAAGG + Intergenic
985199598 4:187471144-187471166 CTTTCTGCTCACAGGAACCTGGG - Intergenic
985898672 5:2767396-2767418 CTCTCTTTTCTTAGGAAAGTGGG + Intergenic
987016387 5:13824281-13824303 CTGTCAGTTCTTCGGACCTTGGG - Exonic
988602383 5:32651869-32651891 CCTTATGTTATTAAGAACTTTGG - Intergenic
990039205 5:51358466-51358488 CTTTCTGTTGTTTGGAAACTTGG - Intergenic
990505192 5:56436997-56437019 CTATATATTCTTAGAAACTTAGG + Intergenic
991721676 5:69499489-69499511 ATTTCAGTGCTTAGGCACTTAGG - Intronic
992625264 5:78631043-78631065 CTTACTCTTCTTAGTAAGTTGGG - Intronic
992706312 5:79397333-79397355 ATTTCTGTTATTATGAACTGTGG - Intronic
993106201 5:83603877-83603899 ATTTCTGTTCTTTGTAAATTAGG - Intergenic
993298375 5:86174018-86174040 CTTTCAGCTCTTACCAACTTTGG + Intergenic
994177487 5:96727467-96727489 CTTTCTTTTTTTCTGAACTTAGG + Exonic
994294426 5:98072835-98072857 CTTTCTGTTAATATGAACTTGGG + Intergenic
995429629 5:112059393-112059415 CTTTCAGATATTAGAAACTTTGG - Intergenic
996051886 5:118943887-118943909 CTTTCAGTATTTAGGAACTGAGG - Intronic
996961405 5:129254958-129254980 CTCTCTGTTCTGAGCCACTTGGG + Intergenic
998444866 5:142190899-142190921 CTTTCTTCTCTTGGGAACGTGGG - Intergenic
999046568 5:148475989-148476011 CTGTCTTTGGTTAGGAACTTGGG - Intronic
999087332 5:148904445-148904467 CTTTCTGTCCTTATGCACTAGGG + Intergenic
999819445 5:155210913-155210935 CTTTCTGTTCTTAAGTGCCTTGG + Intergenic
1000131569 5:158305048-158305070 CTTTCTGTACTTAGGACAATTGG - Intergenic
1000494480 5:161963558-161963580 CTTTCTGTACTTAGTAATGTTGG - Intergenic
1000548680 5:162632784-162632806 TTTTCTGTTCTTAGGAACCTAGG - Intergenic
1003633766 6:7812304-7812326 ATTCCAGTTCTTAGGAACATTGG + Intronic
1003752763 6:9079521-9079543 TTTGCTGATCTCAGGAACTTTGG + Intergenic
1003872681 6:10414557-10414579 CTTTCTGTTCCTGGTGACTTGGG + Intronic
1004892151 6:20111311-20111333 GTCTCTGTCCTGAGGAACTTAGG - Intronic
1005061449 6:21780421-21780443 GTTTCTGTGCTAAGGAACTCAGG + Intergenic
1005346830 6:24898752-24898774 CTTTCTGCTAGCAGGAACTTAGG + Intronic
1005387850 6:25303518-25303540 TTCTCTGTTCTTAGAACCTTTGG + Intronic
1007274717 6:40664854-40664876 TTTTCTGTCCTCAGAAACTTGGG - Intergenic
1009507322 6:64501169-64501191 CTTTTTTTTCTTAGGAAATAAGG - Intronic
1010700114 6:79034368-79034390 CTTTCTACTGTTAGGCACTTTGG + Intronic
1012436264 6:99218141-99218163 AATTCTGATCTTAGGAATTTAGG + Intergenic
1013297671 6:108773377-108773399 CTTTCTGTTCTGACCAATTTTGG - Intergenic
1013585267 6:111572654-111572676 CTTGCTGTTCAGAGGTACTTGGG + Intronic
1014178073 6:118351715-118351737 CTTTGTCTTCTTAGGGATTTTGG - Intergenic
1014335703 6:120133315-120133337 CTTTAATTTCTTAGGATCTTTGG - Intergenic
1016070867 6:139737265-139737287 CATTCTGTTGTTAGAAATTTAGG - Intergenic
1016673935 6:146741004-146741026 CTTTTAGTTATTTGGAACTTTGG + Intronic
1016745062 6:147570502-147570524 CTTTCTGGCCTCAGGACCTTTGG + Intronic
1018266275 6:162028030-162028052 CTTTCTGTTCTTTGGAATCTGGG - Intronic
1019188362 6:170234754-170234776 CATTCTGTGCTGAGGATCTTTGG - Intergenic
1020828982 7:13069215-13069237 CATTGTGTTCTTAGGAAGTCAGG + Intergenic
1021529353 7:21626351-21626373 CTATCTGTTAGTAGGCACTTAGG + Intronic
1023082635 7:36539504-36539526 CTTTCTGTGGGCAGGAACTTAGG + Intronic
1026678971 7:72451048-72451070 AGTTCTGTTCTGAGGAACTGTGG - Intergenic
1028452742 7:91004263-91004285 CTTTCTTTTCTTAGTAAGTCAGG - Intronic
1028737543 7:94234667-94234689 CTTCCTGTTTTTATGAAATTTGG + Intergenic
1031631634 7:124049993-124050015 CTTTCTGTTTGTATGACCTTGGG + Intergenic
1031781048 7:125965468-125965490 CTTTCTTTACTAAGGAACTTGGG - Intergenic
1032063790 7:128748242-128748264 CTTTTAATTCTTATGAACTTGGG + Exonic
1033463329 7:141567481-141567503 CTTTTTTTTCTTTGAAACTTGGG - Intronic
1034954123 7:155322869-155322891 CTTTCTGTCCCTAGAAACATTGG - Intergenic
1036212694 8:6855036-6855058 CTCTCTGTTCTTAGTATCTTAGG + Intergenic
1036213305 8:6860029-6860051 CTTTGTGTTTTTAGTAAATTTGG + Intergenic
1036409011 8:8480993-8481015 CTTTCTGTGCTTAGGAACACGGG + Intergenic
1036762071 8:11516271-11516293 CTTTCTGTTCTTTGTTACTGTGG - Intronic
1041504545 8:58581054-58581076 CTATCTGTGCTCAGGAACTGAGG + Intronic
1042002667 8:64143802-64143824 CTATCTGTTCATAGGCACTTAGG - Intergenic
1042050073 8:64694178-64694200 ATTTCTTTTCTTATGAATTTGGG - Intronic
1042125872 8:65536620-65536642 GTTTCTGATCTTAAGAACGTGGG - Intergenic
1042188339 8:66159449-66159471 GTTTGTGTTCTTAGCAGCTTTGG + Intronic
1043207440 8:77464101-77464123 CTTTCAATCCTTAGAAACTTGGG - Intergenic
1043827002 8:84941360-84941382 CTTTCTTTTTTTAAGAACTCAGG - Intergenic
1045244385 8:100430126-100430148 CTTTCTGTTGTTAAGACCCTAGG - Intergenic
1047646112 8:126871895-126871917 TTTTCTGTTCTCAGGTATTTGGG - Intergenic
1047974681 8:130118238-130118260 CTTTCCCTTTTTAGGAGCTTGGG - Exonic
1048358615 8:133675099-133675121 CTTTGTCTTATTAGGAATTTAGG + Intergenic
1048652934 8:136500520-136500542 ATTTCTATTCTTAAAAACTTGGG - Intergenic
1048955142 8:139529823-139529845 GTTTCTGTTCTCAGAAACTTGGG + Intergenic
1049868961 8:144958710-144958732 TTTTATGTTCTTAAGAACATAGG + Intergenic
1050124289 9:2340397-2340419 CTTTGTTTTCTAAGAAACTTAGG + Intergenic
1050174741 9:2857944-2857966 CTGTCTGTTCTGAGGCAATTCGG + Intergenic
1050347358 9:4704480-4704502 CTTACAGTTCTTAGGAAGATGGG + Intronic
1052456474 9:28705547-28705569 CATTCTGTTCTTATGAGCATGGG - Intergenic
1052565130 9:30140167-30140189 ACTTCTATTCTTAGGATCTTTGG + Intergenic
1053526566 9:38835898-38835920 CACTCTGTTCTTAGGCACTGGGG - Intergenic
1055157829 9:73086708-73086730 CTTTCTGTGCCTAGCAAATTTGG - Intergenic
1055550304 9:77426725-77426747 CTGTCTGTTCTCAGTAAATTAGG - Intronic
1055794187 9:79956604-79956626 CTTTCTGCTCTATGAAACTTGGG - Intergenic
1056171074 9:83985032-83985054 CCTTCTTTGCTTAGGAAATTGGG - Intronic
1056687336 9:88777534-88777556 CTTTCTTTTCTTGGAAATTTTGG + Intergenic
1057610159 9:96535441-96535463 CTTCCTGTTATTAGGTCCTTTGG + Intronic
1057951608 9:99373505-99373527 CTTTCTAATCTTATGAGCTTGGG - Intergenic
1058268133 9:102933260-102933282 TTTTCAGTTCTTTGGCACTTTGG - Intergenic
1058420478 9:104828545-104828567 ATTATTGTTCTTAGAAACTTAGG + Intronic
1060780672 9:126410041-126410063 CTTTATGCATTTAGGAACTTGGG + Intronic
1061603372 9:131688039-131688061 CTTTCTTTTCTTGGGTACTTGGG - Intronic
1186191075 X:7068151-7068173 TTTTCAGTTCTTATAAACTTTGG - Intronic
1186627263 X:11307562-11307584 CTCCCTGTGATTAGGAACTTGGG + Intronic
1187466900 X:19535612-19535634 CTGTCTCCTCTTAGGACCTTTGG + Exonic
1188949491 X:36351888-36351910 TTTTTTGTTCTTAGTAACATCGG + Intronic
1189261934 X:39685570-39685592 GCTTCTGTTCTTGGGAACTTGGG - Intergenic
1189667366 X:43371032-43371054 CTTTCTGATATTAGTAATTTGGG - Intergenic
1191036953 X:56035361-56035383 CCATCTGTTCTTAGACACTTAGG + Intergenic
1193110392 X:77723709-77723731 CTTTTGGTTCTCAGGAATTTTGG - Intronic
1195416207 X:104622105-104622127 GTTTCTTTTCTAAGGAACTGAGG - Intronic
1196403527 X:115340849-115340871 ATATCTATTCTAAGGAACTTGGG + Intergenic
1199619000 X:149682668-149682690 CTTTCTTTGCTTAGGAACACAGG + Intergenic