ID: 960554449

View in Genome Browser
Species Human (GRCh38)
Location 3:119011967-119011989
Sequence GTGTATACACACATATATAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1277
Summary {0: 1, 1: 6, 2: 34, 3: 232, 4: 1004}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960554449 Original CRISPR GTGTATACACACATATATAT AGG Intronic
901330076 1:8400568-8400590 TTCTATAAACACACATATATAGG + Intronic
902049429 1:13550183-13550205 ATGTATATACATATATAAATGGG - Intergenic
902458907 1:16556105-16556127 ATATATACACATACATATATGGG - Intergenic
902493249 1:16851811-16851833 ATATATACACATACATATATGGG + Intronic
903171102 1:21554323-21554345 GTGTGTATATATATATATATGGG - Intronic
903567176 1:24276580-24276602 GTATATACAAACATCTATAAGGG + Intergenic
903599331 1:24523555-24523577 GTATACACACACATATATAAAGG + Intronic
903687816 1:25145382-25145404 GTGTGTATACATATATATATGGG + Intergenic
905155458 1:35975596-35975618 GTGCACACATACATATGTATTGG + Intronic
905420272 1:37838069-37838091 GTGTGTATACACAAACATATAGG - Intronic
906493992 1:46290451-46290473 TTGTAAAAACAAATATATATAGG - Intronic
906956165 1:50376622-50376644 ATATATACACACGTATATATGGG - Intergenic
907076021 1:51579328-51579350 ATGTATACAAAGATATACATAGG + Intronic
907209079 1:52803065-52803087 GTGTATATATATATATATAGTGG - Intronic
907961680 1:59289491-59289513 ATGTAGACACACATACACATAGG - Intergenic
908341284 1:63182277-63182299 ATGTATATACATATACATATAGG + Intergenic
908341297 1:63182436-63182458 GTATATATGTACATATATATGGG - Intergenic
908527507 1:65002185-65002207 GTGTATATATGCACATATATGGG + Intergenic
908536302 1:65081155-65081177 TTATATACACACATATATGTGGG - Intergenic
908908498 1:69044674-69044696 GTGTGTATATACTTATATATTGG + Intergenic
909458922 1:75885339-75885361 GTGTATATATATATATATAAAGG + Intronic
909473718 1:76058510-76058532 GTGTATATATATATATATGTGGG - Intergenic
909529499 1:76666370-76666392 ATATATACACATATATATATGGG - Intergenic
909876003 1:80804332-80804354 ATATATATACACATACATATAGG - Intergenic
909913152 1:81285216-81285238 GTGTATATATATATATATACAGG + Intergenic
909971735 1:81998924-81998946 GTGTATATATAGTTATATATAGG - Intergenic
909971736 1:81998946-81998968 GTGTATATATAGGTATATATAGG - Intergenic
909971738 1:81998968-81998990 GTGTATATATAGTTATATATAGG - Intergenic
909971739 1:81998990-81999012 GTGTATACATAGGTATATATAGG - Intergenic
910487097 1:87726955-87726977 ATACATACATACATATATATCGG + Intergenic
910574980 1:88751305-88751327 GTGTAGACACACATACATACAGG + Intronic
910769634 1:90817927-90817949 ACACATACACACATATATATAGG + Intergenic
910793938 1:91079178-91079200 GTGTATATATACGTATATATAGG + Intergenic
911001934 1:93175298-93175320 GTGTATATATATATATATATAGG - Intronic
911396061 1:97311879-97311901 GTCTTTAGAGACATATATATGGG + Intronic
911644583 1:100324697-100324719 GTGCATGTATACATATATATTGG + Intergenic
911701992 1:100964390-100964412 ATATATACATACACATATATAGG - Intronic
911824738 1:102467375-102467397 GTGTATATACACACATACATAGG - Intergenic
912704641 1:111902996-111903018 GTGTTTACACACATACATATAGG + Intronic
913247477 1:116882865-116882887 GTGTGTGCACACAAATCTATTGG + Intergenic
913571899 1:120129028-120129050 GTGTATGCACATATATTTGTAGG + Intergenic
913597295 1:120390758-120390780 ATATACACACACATATATATGGG - Intergenic
913983507 1:143544740-143544762 GTGTACACCCACATATGTTTAGG - Intergenic
914090033 1:144488555-144488577 ATATACACACACATATATATGGG + Intergenic
914292818 1:146290651-146290673 GTGTATGCACATATATTTGTAGG + Intergenic
914308579 1:146445682-146445704 ATATACACACACATATATATGGG - Intergenic
914514067 1:148358889-148358911 TTATATATATACATATATATAGG + Intergenic
914514069 1:148358947-148358969 TTATATATATACATATATATAGG + Intergenic
914553862 1:148741434-148741456 GTGTATGCACATATATTTGTAGG + Intergenic
914593530 1:149127448-149127470 ATATACACACACATATATATGGG + Intergenic
915383224 1:155463191-155463213 TTGGACACATACATATATATTGG - Intronic
915427034 1:155835513-155835535 CTGTATAGCCATATATATATGGG - Intronic
915847330 1:159280184-159280206 GTGTGTATATATATATATATGGG + Intergenic
916184528 1:162117830-162117852 TTGTATGCACACATATGTGTTGG + Intronic
916281042 1:163051736-163051758 ATATATTCACACATATAGATAGG - Intergenic
916367585 1:164050202-164050224 ATATATACATATATATATATAGG - Intergenic
916617355 1:166456442-166456464 ATATACACACACATATATAGTGG + Intergenic
917624690 1:176833807-176833829 ATATATACACATATATATGTAGG - Intronic
917960350 1:180138990-180139012 ATATATACACATATATATGTGGG + Intergenic
918532530 1:185539009-185539031 GTGTATACATATATGTATATCGG - Intergenic
918823463 1:189290053-189290075 GCAGATACAGACATATATATGGG - Intergenic
919000125 1:191820609-191820631 ATATATACACATACATATATTGG + Intergenic
919000792 1:191828583-191828605 GTGCATATATATATATATATGGG + Intergenic
919009254 1:191938493-191938515 GTATATATATATATATATATAGG + Intergenic
919169961 1:193941043-193941065 ATATACACACACATATGTATAGG + Intergenic
919415886 1:197308922-197308944 GGGTATATATACATATATGTGGG + Intronic
919493218 1:198231264-198231286 GTATATACACACACACATATAGG - Intronic
919509247 1:198440220-198440242 ATATATACACACATATGTACAGG - Intergenic
919580103 1:199360997-199361019 GTGTGTATATATATATATATAGG + Intergenic
920674155 1:208027503-208027525 ATACATACATACATATATATAGG - Intronic
920929654 1:210375295-210375317 GTATATACACACACACATTTAGG + Intronic
921035412 1:211373525-211373547 GTTTGTATACACACATATATAGG - Exonic
921440295 1:215177707-215177729 ATATATACACATATATATATAGG - Intronic
921501438 1:215908967-215908989 ATGTATATATAGATATATATAGG - Intronic
921771617 1:219047329-219047351 GGGAATATACACAAATATATAGG - Intergenic
923259975 1:232259112-232259134 GTATATATATACATGTATATAGG + Intergenic
923307952 1:232705540-232705562 CTGCATACACAAATATAAATTGG + Intergenic
923398754 1:233594924-233594946 ATATATACACACACATATAGAGG + Intergenic
923478877 1:234364129-234364151 ATATATACATACATACATATAGG + Intergenic
923638832 1:235730499-235730521 GTGTGTGTATACATATATATGGG + Intronic
923638833 1:235730536-235730558 GTATATATATACACATATATGGG - Intronic
923835616 1:237608011-237608033 GTGTATACATATGTGTATATAGG - Intronic
923881586 1:238109599-238109621 GTATATAAACTCATACATATTGG - Intergenic
923972878 1:239225098-239225120 ATATATATACATATATATATAGG - Intergenic
924009470 1:239648981-239649003 GTATATACACACATATAGATGGG - Intronic
924494987 1:244578743-244578765 ATATATACAGGCATATATATGGG + Intronic
924621194 1:245662484-245662506 GGGTGTACATATATATATATTGG - Intronic
924908385 1:248481785-248481807 GTTTATACACACAGGAATATTGG - Intergenic
924915725 1:248566300-248566322 GTTTATACACACAGGAATATTGG + Intergenic
1063856372 10:10258863-10258885 ATATATACACACATATATCTAGG + Intergenic
1063879007 10:10511459-10511481 GTGTATATATATTTATATATGGG + Intergenic
1064025131 10:11842814-11842836 ATGTATACATACATATATTTGGG - Intronic
1064397014 10:14990361-14990383 GTGTACACACACTTCGATATTGG - Intergenic
1064672077 10:17725390-17725412 GTGTATACATATATATATATAGG + Intergenic
1064777336 10:18793291-18793313 ATGTATACACATATATAAAGAGG + Intergenic
1065457152 10:25918681-25918703 GTGTATATATATGTATATATAGG - Intergenic
1065615581 10:27518530-27518552 GTCTATATGCACATTTATATAGG + Intronic
1066204015 10:33169875-33169897 GTATATATACACACACATATAGG - Intergenic
1066286650 10:33973540-33973562 ATACATACACACAGATATATAGG + Intergenic
1066597758 10:37070570-37070592 ATATATATACATATATATATAGG - Intergenic
1066627376 10:37420693-37420715 GTATATACACATATATATTTAGG - Intergenic
1067106082 10:43367462-43367484 GTGTATATATATATATATATGGG - Intergenic
1067390787 10:45861518-45861540 ATGTGTACACACATACATATAGG + Intergenic
1067500684 10:46802332-46802354 ATGTGTACACACATACATATAGG - Intergenic
1067593900 10:47537568-47537590 ATGTGTACACACATACATATAGG + Intronic
1067641011 10:48045681-48045703 ATGTGTACACACATACATATAGG + Intergenic
1067872492 10:49974586-49974608 ATGTGTACACACATACATATAGG - Intronic
1068292633 10:55023866-55023888 GTATATACATGTATATATATAGG - Intronic
1068350516 10:55838766-55838788 ATGTATACACATATACATATGGG - Intergenic
1068478470 10:57559103-57559125 GTGTATATATAAATATATATAGG - Intergenic
1068557453 10:58474939-58474961 ATATATACACACACACATATAGG - Intergenic
1069006550 10:63323830-63323852 GTGTATACATATATATATATAGG + Intronic
1069102407 10:64338691-64338713 GTATATACATACATATATGACGG + Intergenic
1069135380 10:64757106-64757128 GTGTGTATACACCTATATATGGG - Intergenic
1069142988 10:64851772-64851794 TTGTACACAGGCATATATATTGG + Intergenic
1069553987 10:69384702-69384724 GTGTATACACACACACACGTAGG - Intronic
1070063379 10:73008472-73008494 GTGTGTACACATATGTATATAGG - Intronic
1070115532 10:73525128-73525150 GTTTATGTACATATATATATAGG - Intronic
1070137973 10:73711735-73711757 ATGTGTACACACAAACATATAGG + Intergenic
1070311099 10:75274586-75274608 GTGTATATATATATATATAATGG - Intergenic
1071021824 10:81066298-81066320 GTCAATGCACACATATTTATTGG + Intergenic
1071053914 10:81486813-81486835 ATATACACATACATATATATGGG + Intergenic
1071061871 10:81579807-81579829 GTGCATAAACACATATATGTAGG - Intergenic
1071664281 10:87538730-87538752 TTGTATACTTACATAAATATGGG + Intronic
1071756920 10:88552737-88552759 ACATATACACACACATATATAGG + Intronic
1071781286 10:88848135-88848157 ATATATACACGCATATATGTTGG - Intronic
1073557733 10:104468771-104468793 GTATATTCCCATATATATATGGG + Intergenic
1074008363 10:109451800-109451822 GTGAATATATACATACATATAGG + Intergenic
1074238241 10:111608193-111608215 GTGTATGTATACATATGTATGGG - Intergenic
1074339773 10:112616294-112616316 GTGTGTACAAATATATATGTGGG - Intronic
1074701212 10:116094321-116094343 GAGTGTATATACATATATATGGG + Intronic
1074730092 10:116362231-116362253 GTGTGTACACACATGTACATAGG + Intronic
1075224611 10:120616147-120616169 GTGTATAAACATATATATTGTGG + Intergenic
1076078481 10:127556592-127556614 ATATATATACACACATATATAGG - Intergenic
1076098724 10:127756420-127756442 GTGAAAACACATATATCTATTGG + Intergenic
1076745970 10:132514681-132514703 GTGTGTATGCACATATGTATTGG + Intergenic
1076989480 11:263785-263807 ATATATACACACACACATATAGG + Intergenic
1077618250 11:3694960-3694982 GTATATACAAACATGTAAATAGG + Intronic
1077738093 11:4813013-4813035 ATGTATATATATATATATATGGG + Intronic
1078005334 11:7528287-7528309 ATGCATACACATATATATTTAGG + Intronic
1078024781 11:7684469-7684491 GTGTATATATATATATATATAGG - Intergenic
1078263136 11:9730472-9730494 GTGCATACACACATATACCTTGG - Intronic
1078378952 11:10822519-10822541 ATAAATACACACATATGTATAGG + Intronic
1078487956 11:11741354-11741376 GTATATTCACATATATATTTAGG - Intergenic
1078534981 11:12165701-12165723 GTGTATACACGCACATATGGTGG - Intronic
1078907165 11:15698283-15698305 ATATATGCACACATATATGTAGG - Intergenic
1079462844 11:20699326-20699348 GTGTATACATATATATACCTTGG - Intronic
1079492727 11:21007358-21007380 GTGTACATACACATACACATTGG - Intronic
1079526416 11:21394427-21394449 ATATATATACACACATATATAGG - Intronic
1079711952 11:23695644-23695666 GTGTATTCATATATATACATGGG + Intergenic
1079795880 11:24802400-24802422 CTGTATAGACACATTTATGTTGG + Intronic
1079799131 11:24846820-24846842 ATGTATACACACACACATAGAGG - Intronic
1079884896 11:25975131-25975153 ATATATACAAATATATATATAGG - Intergenic
1079917291 11:26385247-26385269 GTGTTTACAAACATATAAAAGGG + Intronic
1079993132 11:27267343-27267365 GTATATATACATATATATATAGG + Intergenic
1080019628 11:27546510-27546532 GCCTATACACAGATACATATGGG + Intergenic
1080034126 11:27693926-27693948 GTGTATGCACATATATCTAAAGG - Intronic
1080724717 11:34885295-34885317 GTATATATATACACATATATAGG + Intronic
1080909873 11:36585087-36585109 GTGAATACACACATTTTTTTTGG + Intronic
1081035621 11:38141527-38141549 GATTATACACACATATATAGTGG + Intergenic
1081331941 11:41812852-41812874 GTGTGTTCACACTTATATGTAGG + Intergenic
1081464958 11:43307945-43307967 ATGTATATATATATATATATTGG + Intergenic
1081476768 11:43440916-43440938 TTGTCTACACACATACATACAGG - Intronic
1082219374 11:49615026-49615048 ATGTATGTACACATGTATATGGG - Intergenic
1082632063 11:55555221-55555243 GTGTATATACAAATATGCATGGG - Exonic
1082755945 11:57076541-57076563 GTGTATACACACATATATGTGGG + Intergenic
1083017709 11:59473264-59473286 ATGTATACACAGACACATATGGG - Intergenic
1083946554 11:65926594-65926616 ATATATATACACACATATATAGG - Intergenic
1084227497 11:67726341-67726363 GTGTACACACACTTCGATATTGG - Intergenic
1084260917 11:67978038-67978060 GTGTACACACACTTCGATATTGG - Intergenic
1084807706 11:71590524-71590546 GTGTACACACACTTCGATATTGG + Intronic
1084811728 11:71616080-71616102 GTGTACACACACTTCGATATTGG + Intergenic
1084844811 11:71890527-71890549 GTGTACACACACTTTGATATTGG + Intronic
1085470596 11:76755060-76755082 ATATATATACACATATATCTGGG + Intergenic
1085749153 11:79145129-79145151 GTCTATACACACATATTTAGAGG + Intronic
1085812438 11:79696325-79696347 GGGTTTACATATATATATATGGG - Intergenic
1086056216 11:82650211-82650233 ATGTGTATATACATATATATAGG - Intergenic
1086141774 11:83507429-83507451 ATATATACAGATATATATATAGG - Intronic
1086624395 11:88928889-88928911 GTGTATATACACATACACATAGG - Intronic
1086762898 11:90655620-90655642 ATGTATACACACATAGACATAGG + Intergenic
1086838813 11:91659159-91659181 GTTTGGACACACATATAGATGGG - Intergenic
1086848001 11:91775621-91775643 GTATATATACACATATTTTTTGG + Intergenic
1086960647 11:92977155-92977177 TAGTGTACACAGATATATATGGG - Intronic
1086983504 11:93224320-93224342 ATGTATATACATATTTATATAGG - Intergenic
1087115119 11:94516272-94516294 TTTTAAACTCACATATATATGGG - Intergenic
1087208704 11:95424018-95424040 GTATATATACACATATATGTGGG - Intergenic
1087495189 11:98882081-98882103 ATATATACACATATATATATGGG + Intergenic
1087495192 11:98882199-98882221 GTATATACATACATATATATGGG - Intergenic
1087496432 11:98895633-98895655 GTATGTACAGACAAATATATGGG + Intergenic
1088009261 11:104979511-104979533 GTTTATACAGACATATACACAGG + Intergenic
1088161994 11:106883311-106883333 AGGTATACACACATAGATAAAGG - Intronic
1088440257 11:109862635-109862657 ATACACACACACATATATATAGG - Intergenic
1088572820 11:111240269-111240291 GTGTATATACATATGTGTATGGG - Intergenic
1089554468 11:119308581-119308603 ATATATACATACATATATAAAGG + Exonic
1090112090 11:123923538-123923560 GTATGTACAATCATATATATAGG + Intergenic
1090285887 11:125498494-125498516 ATATACACACACACATATATAGG - Exonic
1090708731 11:129365415-129365437 GTTTATATACACATGTATATAGG - Intergenic
1090996141 11:131867573-131867595 GTGTACACACACATACACACAGG - Intronic
1091318161 11:134630684-134630706 GTGTATACACACACATACACAGG - Intergenic
1091896149 12:4106666-4106688 GTCTCTACACACCTATTTATAGG - Intergenic
1092014453 12:5146533-5146555 GTGTATACATATATATGAATAGG - Intergenic
1092268752 12:7004622-7004644 GTGTGTATACACATATGTATGGG - Intronic
1092316500 12:7421185-7421207 GTGTATATATGTATATATATGGG + Intronic
1092432174 12:8418588-8418610 GTGTACACACACTTCGATATTGG - Intergenic
1092582481 12:9858686-9858708 GTGTATATATATATGTATATAGG + Intronic
1092680195 12:10970257-10970279 GTATGTGCACACATATATGTTGG - Intronic
1092774434 12:11930101-11930123 GTATATATATACACATATATAGG + Intergenic
1092874129 12:12833511-12833533 GTGAAGACACAAAGATATATGGG - Intergenic
1093017195 12:14166516-14166538 GTGCATATATATATATATATAGG + Intergenic
1093072465 12:14721266-14721288 ATGTATACACACATACACAATGG - Intergenic
1093121918 12:15280694-15280716 GTGTATATACATTTACATATGGG + Intronic
1093342412 12:17994926-17994948 GTGTATACACACTTATATAATGG - Intergenic
1093713313 12:22352789-22352811 ATATATGCCCACATATATATGGG + Intronic
1094010799 12:25807477-25807499 TCCTATACACACATATATTTGGG + Intergenic
1095210337 12:39486509-39486531 GTGTGTATACATATATATAATGG - Intergenic
1095228970 12:39713942-39713964 CTGTATATACACGTATATATAGG - Intronic
1095245841 12:39920246-39920268 TTACATACACACATATATTTAGG - Intronic
1095314047 12:40737303-40737325 GTGTATATACACATATACATGGG + Intronic
1095318451 12:40795536-40795558 ATTTATAGGCACATATATATAGG + Intronic
1095527830 12:43149079-43149101 GTATGTATACACATGTATATTGG + Intergenic
1095723705 12:45428862-45428884 GTATATATACACACATATAATGG - Intronic
1095839714 12:46679621-46679643 GTATATATGCACACATATATAGG + Intergenic
1095931713 12:47634650-47634672 GTGTATATACACATATATGTGGG + Intergenic
1096001260 12:48132570-48132592 GTGAATACATACATGTATGTTGG - Intronic
1096322073 12:50623376-50623398 GTGTGTAGATACATATATTTTGG - Intronic
1096506704 12:52098291-52098313 GTGTACACACACTTCGATATTGG + Intergenic
1096508816 12:52115544-52115566 GTGTACACACACTTCGATATTGG - Intergenic
1096663686 12:53147082-53147104 ATATACATACACATATATATAGG + Intergenic
1096945117 12:55397313-55397335 ATATATACACATATGTATATAGG + Intergenic
1097461326 12:59866211-59866233 GTGTATACATACATATACTTAGG + Intergenic
1097485583 12:60194665-60194687 CTGTATAAACACATACATTTAGG + Intergenic
1098259127 12:68649752-68649774 ATGTATACACACATACATGCAGG - Intronic
1098391650 12:69975961-69975983 GTGCAAACACACACACATATTGG + Intergenic
1098610851 12:72455986-72456008 GAGTATACACATATATGTATAGG - Intronic
1098625572 12:72661657-72661679 ATATATACACACATATATAAAGG - Intronic
1098903936 12:76142098-76142120 ATTTATAAAAACATATATATGGG + Intergenic
1098938187 12:76504296-76504318 ATGAATATATACATATATATTGG - Intronic
1099047160 12:77736241-77736263 ATGTATACACACACTTATATGGG + Intergenic
1099106398 12:78502050-78502072 ATATATACACACATATATGGAGG + Intergenic
1099127650 12:78784679-78784701 ATGTATGCACACATTTAAATAGG - Intergenic
1099248684 12:80225006-80225028 GTGTATATACATATATATATGGG - Intronic
1099313223 12:81053637-81053659 ATTCATACACACATGTATATAGG + Intronic
1099493314 12:83312759-83312781 GTATATATATACACATATATAGG + Intergenic
1099796167 12:87402756-87402778 GTGTATATACAAATATTTGTAGG + Intergenic
1099896584 12:88655260-88655282 ATATATATATACATATATATAGG - Intergenic
1100066746 12:90656131-90656153 ATGTATATATATATATATATAGG + Intergenic
1100133964 12:91531633-91531655 ATACATACACCCATATATATGGG + Intergenic
1100265297 12:92970109-92970131 GTGTATAAACATCTATAAATTGG - Intergenic
1101244044 12:102868039-102868061 GTATATATATACATATATATAGG - Intronic
1101392240 12:104312016-104312038 ATATATACACACATATATATGGG + Intronic
1101451546 12:104784332-104784354 ATAGATACACACATATATATAGG + Intergenic
1102176362 12:110878219-110878241 GTGTATACATATATGCATATAGG - Intronic
1102429557 12:112871876-112871898 GTATATATACATATATATAGTGG + Intronic
1102749938 12:115283882-115283904 GTGTATATATATATATATCTGGG - Intergenic
1103286800 12:119809438-119809460 ATATATATATACATATATATAGG + Intronic
1104160432 12:126174438-126174460 ATGTTTACATACATATATAACGG - Intergenic
1104174149 12:126312939-126312961 ATATATACATACATATATACAGG - Intergenic
1104236148 12:126938534-126938556 GTGTATATACACATACATATAGG - Intergenic
1104359578 12:128119793-128119815 GTGTGTACACATATATTTATGGG + Intergenic
1104359588 12:128120091-128120113 GTGTGTACACATATGTTTATGGG + Intergenic
1104359593 12:128120232-128120254 GTGTGTACACATATATTCATGGG + Intergenic
1104526507 12:129528669-129528691 TTGTATGCACACATATTTAGTGG - Intronic
1104596505 12:130123930-130123952 GTGTGTGTATACATATATATGGG + Intergenic
1104759880 12:131290572-131290594 GTGTGTACACAGAGGTATATGGG - Intergenic
1104811281 12:131621734-131621756 GTGTACACACACATGCACATGGG + Intergenic
1104820844 12:131676599-131676621 GTGCGTACACACAGGTATATGGG + Intergenic
1105448544 13:20477985-20478007 ATGTATATAAAAATATATATGGG + Intronic
1105774483 13:23644829-23644851 GTGTATATATATATATATTTGGG + Intronic
1105788838 13:23776913-23776935 GTGTATATGTACATATATGTGGG - Intronic
1105873721 13:24534953-24534975 GTGTATATATATATGTATATGGG + Intergenic
1106056670 13:26244483-26244505 GTGTATACACACACACATAGAGG + Intergenic
1106200631 13:27533764-27533786 GTGTATATATATATATATACAGG - Intergenic
1106261592 13:28072193-28072215 AAGTATATATACATATATATGGG + Intronic
1106311567 13:28559260-28559282 ATGTATATACACATACTTATAGG - Intergenic
1106352384 13:28945176-28945198 GTGTATATATATATATATAATGG - Intronic
1106722015 13:32444946-32444968 GTGTATATAAACATATCTAGAGG + Intronic
1106867376 13:33981010-33981032 ATCTATATATACATATATATAGG + Intergenic
1107091348 13:36484400-36484422 GTGTATATATATATATATGTAGG - Intergenic
1107226795 13:38059735-38059757 ATGTATACTCACAAATATTTTGG - Intergenic
1107245089 13:38284321-38284343 GTATATACACACACACATTTGGG - Intergenic
1107704165 13:43082843-43082865 GTGTGTATATATATATATATAGG - Intronic
1108051413 13:46444428-46444450 GTGTATACACACATGCACAGGGG + Intergenic
1108633083 13:52305381-52305403 GTGTATATATATATATATATAGG - Intergenic
1108832101 13:54492418-54492440 ACATATACATACATATATATAGG + Intergenic
1108895331 13:55320043-55320065 GTGTAAATACATATATTTATAGG + Intergenic
1108918764 13:55651241-55651263 GTGTATATATACACATACATAGG + Intergenic
1108948676 13:56058986-56059008 ATATATACACATATATATATAGG + Intergenic
1109064438 13:57667842-57667864 ATGTATATACTTATATATATGGG - Intronic
1109153860 13:58879642-58879664 GTGAATACACACCGATGTATGGG + Intergenic
1109254893 13:60067900-60067922 GTGCATGCACACACCTATATAGG - Intronic
1109309971 13:60681713-60681735 GTATATATACACACGTATATAGG - Intergenic
1109393325 13:61721736-61721758 ATATATACACACATACACATAGG - Intergenic
1109543969 13:63818051-63818073 GTGTATACACACATGCACAGGGG + Intergenic
1109550424 13:63890772-63890794 GTGTATATATATATATATCTGGG + Intergenic
1109569965 13:64175114-64175136 ATGTGTATACACATATTTATAGG - Intergenic
1109626999 13:64987637-64987659 GTGTATACACACATACACTCAGG - Intergenic
1109982982 13:69935047-69935069 GTATACACATACACATATATAGG + Intronic
1110000430 13:70191740-70191762 GTGTGTACACACACGCATATAGG + Intergenic
1110016205 13:70407433-70407455 GTATATATATACATATATATGGG - Intergenic
1110025540 13:70534017-70534039 GTGTAAACTCACTAATATATGGG - Intergenic
1110052347 13:70920107-70920129 GTGTATACATACATATAAGATGG - Intergenic
1110096303 13:71526706-71526728 GTATATATATATATATATATAGG + Intronic
1110110013 13:71734100-71734122 GTGTATATATATATGTATATGGG + Intronic
1110201858 13:72860416-72860438 GTGTTTAAACTCATATATTTTGG + Intronic
1110325733 13:74213162-74213184 GTATACACACACACATAAATGGG + Intergenic
1110550042 13:76801787-76801809 GTGTATACACACAAATGTATTGG + Intergenic
1110873311 13:80478757-80478779 GTATATATACATATATATATAGG + Intergenic
1110904478 13:80868462-80868484 ATATATACATACACATATATGGG - Intergenic
1111133670 13:84010107-84010129 GTGTATACACACATGCAGAGAGG - Intergenic
1111151476 13:84259716-84259738 ACGTATATATACATATATATGGG + Intergenic
1111173789 13:84565591-84565613 ATACATACACAGATATATATTGG + Intergenic
1111215594 13:85136445-85136467 TTATGTACACACATATGTATGGG - Intergenic
1111215608 13:85136798-85136820 TTATATAAACACATATGTATAGG + Intergenic
1111290644 13:86165461-86165483 TTATATACATACATATGTATGGG + Intergenic
1111378950 13:87420393-87420415 GGGTATATACATATTTATATTGG + Intergenic
1111530826 13:89535875-89535897 GTATATATATATATATATATCGG + Intergenic
1111535210 13:89594910-89594932 ATATATACACTCACATATATGGG - Intergenic
1111535214 13:89595132-89595154 ACATATACACACATATATAGTGG - Intergenic
1111811143 13:93095910-93095932 GTGTATACCCACTATTATATTGG - Intergenic
1111816149 13:93155799-93155821 ATATATATACACACATATATAGG - Intergenic
1111846583 13:93516742-93516764 GTGTATAAGAACATATATGTGGG + Intronic
1111948140 13:94687200-94687222 ATGTATATACATATATATATGGG + Intergenic
1112458062 13:99579637-99579659 ATGTATACACACATACAAACAGG - Intergenic
1112603748 13:100882773-100882795 ATATATACACATATATATAAAGG - Intergenic
1112668453 13:101605284-101605306 GCGTATATATACACATATATAGG + Intronic
1112668455 13:101605368-101605390 GCGTATATATACACATATATGGG + Intronic
1112818838 13:103307005-103307027 GTGTATATATATATGTATATAGG + Intergenic
1112841662 13:103586894-103586916 GTGTATATATATATATATAAAGG + Intergenic
1113132894 13:107057895-107057917 GTATATATATATATATATATGGG - Intergenic
1113134374 13:107073500-107073522 GAGGAAACACACATATTTATGGG - Intergenic
1113157610 13:107341770-107341792 GTGTATATATACATATTTATAGG + Intronic
1114137798 14:19872464-19872486 GTGTATATATATATATAAATAGG - Intergenic
1114137800 14:19872526-19872548 GTGTATATATATATATAAATAGG - Intergenic
1114786929 14:25611175-25611197 GTATAAACTCCCATATATATGGG + Intergenic
1115047751 14:29017983-29018005 ATATATACACACATGTATATAGG - Intergenic
1115105168 14:29751904-29751926 ATGTGTACACACAAATAAATGGG + Intronic
1116078253 14:40140974-40140996 ATATATATACACATATATACGGG - Intergenic
1116130049 14:40844375-40844397 ATATATATACACATATATGTGGG + Intergenic
1116132665 14:40877204-40877226 GTATATATATATATATATATGGG - Intergenic
1116258121 14:42584135-42584157 ATATATACACACATATATATGGG - Intergenic
1116272599 14:42791009-42791031 GTGTATAAACACATAATTTTGGG + Intergenic
1116330603 14:43592721-43592743 ATATATATACACACATATATAGG + Intergenic
1116351040 14:43863179-43863201 ATATATACACACATACATATAGG + Intergenic
1116518971 14:45828483-45828505 GTGTATACCCACTTCAATATTGG - Intergenic
1116606531 14:47004378-47004400 ATATATATCCACATATATATGGG + Intronic
1116654992 14:47641130-47641152 TTGAATACATACATATGTATAGG - Intronic
1116677939 14:47929189-47929211 GTGTATACATATATATGTGTGGG + Intergenic
1116793977 14:49369755-49369777 ATATATATACACCTATATATAGG - Intergenic
1116793978 14:49369783-49369805 ATATATACACACACATATATAGG - Intergenic
1116793979 14:49369811-49369833 ATATACACACACATATATATAGG - Intergenic
1116793980 14:49369839-49369861 GTATATATATACACATATATAGG - Intergenic
1116793981 14:49369861-49369883 GTATATATATACACATATATGGG - Intergenic
1116793983 14:49369883-49369905 GTATATATATACACATATATAGG - Intergenic
1116917648 14:50540712-50540734 ATCTATACTCACATATATTTTGG - Intronic
1116981751 14:51178416-51178438 ATATATACACACACATACATAGG + Intergenic
1117281934 14:54249504-54249526 ATGTACACACAAATGTATATTGG - Intergenic
1117311480 14:54528053-54528075 ATGTAAACAAACACATATATGGG + Intronic
1117382112 14:55174674-55174696 ATCTATATACATATATATATCGG - Intronic
1117587267 14:57222695-57222717 GGGTATATATATATATATATGGG - Intronic
1117847520 14:59927157-59927179 ATGTATACACACATGCCTATGGG + Intronic
1117949487 14:61067719-61067741 ATATATATACACATATGTATAGG + Intronic
1118074385 14:62282425-62282447 GTGTATACATATACACATATAGG - Intergenic
1118078889 14:62335336-62335358 CATTCTACACACATATATATAGG + Intergenic
1118916253 14:70109286-70109308 ATATATACATATATATATATAGG - Intronic
1119239926 14:73050861-73050883 GTGTAGAAAAACATATACATGGG - Intergenic
1120010606 14:79409452-79409474 ATGTATACATATACATATATAGG + Intronic
1120433412 14:84448643-84448665 ATATATACACACACATATATAGG + Intergenic
1120549220 14:85848634-85848656 GTGTATATATATATATATAAAGG + Intergenic
1120690980 14:87592309-87592331 GTATATACATATATATATGTAGG - Intergenic
1120713932 14:87820326-87820348 GTGTATACACACACACATCTTGG - Intergenic
1120925937 14:89797072-89797094 ATACATACACACACATATATGGG - Exonic
1121056057 14:90854017-90854039 GTGTATACACACATGTATTGGGG - Exonic
1121627599 14:95397788-95397810 GTGTGTACACACATGTATGCAGG + Intergenic
1123188275 14:106540946-106540968 ATGAAAACACACATATATATTGG + Intergenic
1202893259 14_KI270722v1_random:179697-179719 GTGTGTATATACATATGTATGGG - Intergenic
1123390041 15:19861645-19861667 CTGTATGCACACATATGTAGGGG - Intergenic
1124806459 15:32888835-32888857 GTGTATCTACACATATACACAGG + Intronic
1125089860 15:35777583-35777605 GTGTGTATACATATATATGTAGG - Intergenic
1126203508 15:46016051-46016073 ATATATATACACCTATATATAGG - Intergenic
1126947492 15:53839117-53839139 GTGTATATGCATGTATATATGGG + Intergenic
1126980261 15:54234240-54234262 GTATATATATATATATATATGGG + Intronic
1127481475 15:59381527-59381549 GTGTTTACACAAATATTTAAAGG - Intronic
1127778551 15:62290371-62290393 GTGTATATAAATATATGTATGGG + Intergenic
1128121619 15:65152661-65152683 ATATATATAAACATATATATGGG + Intronic
1128265079 15:66259049-66259071 GTGTATACATATATATATACAGG + Intergenic
1128269498 15:66296088-66296110 GTGTATAAACATCTATATCTTGG - Intronic
1128532329 15:68462998-68463020 GTGGATACATACTTATGTATGGG - Intergenic
1129096370 15:73212933-73212955 TTTTATATACACATAAATATGGG - Intronic
1129099802 15:73250189-73250211 GGGTGTATATACATATATATGGG - Intronic
1129410138 15:75346208-75346230 GTGTATATATATATATATTTGGG + Intergenic
1129544724 15:76383138-76383160 ACATATATACACATATATATAGG + Intronic
1130201599 15:81834149-81834171 ATATATATATACATATATATAGG + Intergenic
1130365103 15:83229073-83229095 ATATATACACACATATATGATGG - Intergenic
1130601998 15:85282099-85282121 GTATACACACATATATATAGGGG - Intergenic
1130602000 15:85282101-85282123 ATGTATACACACATATATATAGG - Intergenic
1131069196 15:89454375-89454397 GTGTATATATATATATATGTTGG - Intergenic
1132100484 15:99019527-99019549 ATATATACACACATATATGAAGG + Intergenic
1132401624 15:101511588-101511610 GTGTATATATATATATATATAGG + Intronic
1133197404 16:4181033-4181055 ATATATATAGACATATATATAGG + Intergenic
1133485100 16:6212291-6212313 GTATATAGACACATTTGTATAGG + Intronic
1133542367 16:6768694-6768716 ATATATACATATATATATATAGG - Intronic
1133609985 16:7424256-7424278 ATATATATATACATATATATGGG + Intronic
1133684913 16:8157274-8157296 ATATACACACACATATATACAGG - Intergenic
1133709129 16:8384206-8384228 ATGTATACAGGGATATATATAGG + Intergenic
1134281857 16:12824083-12824105 ACATACACACACATATATATTGG - Intergenic
1135091225 16:19519427-19519449 GCACATACACACACATATATAGG - Intronic
1135924680 16:26682951-26682973 GTGTATATACATATATATAAAGG + Intergenic
1135951922 16:26922345-26922367 GTATATACATACACATATATGGG + Intergenic
1135964423 16:27024088-27024110 ATACATACACACATATATATAGG - Intergenic
1137221722 16:46459251-46459273 ATATATACAGACATATAGATAGG + Intergenic
1137812605 16:51367202-51367224 GTGTATATACACATATAACAAGG + Intergenic
1137859146 16:51828892-51828914 GTGTATATATATGTATATATGGG - Intergenic
1137898209 16:52237058-52237080 GTGTATATATAAATATATGTGGG - Intergenic
1138487182 16:57353599-57353621 ATATATACACATATATAGATAGG + Intergenic
1138755306 16:59476864-59476886 GTATATATATATATATATATTGG + Intergenic
1139232068 16:65293246-65293268 GTGTATGTATATATATATATAGG + Intergenic
1139258916 16:65573362-65573384 CTTTATTCAAACATATATATAGG + Intergenic
1139488752 16:67274569-67274591 GTGTGTATATATATATATATGGG - Intergenic
1139627288 16:68200400-68200422 GTTTATATATATATATATATGGG + Intronic
1140008893 16:71110223-71110245 ATATATACACACATACATACAGG - Intronic
1140096241 16:71877988-71878010 ATATATATACACACATATATAGG + Intronic
1140587781 16:76314451-76314473 GTGTATACACACATATGTATAGG + Intronic
1140630864 16:76850305-76850327 TTGTATACACCCATAAATATAGG + Intergenic
1141011911 16:80409322-80409344 GTATATATATACATATATGTGGG - Intergenic
1141032935 16:80605288-80605310 GTATAAACACATATGTATATAGG + Intronic
1141045402 16:80711940-80711962 ATATACACACACATATATATGGG - Intronic
1141278757 16:82611373-82611395 GTATATATATATATATATATGGG - Intergenic
1141413309 16:83851211-83851233 GTGGATGCATACATATGTATTGG - Intergenic
1141567651 16:84914287-84914309 ATATAGACACACATATACATTGG + Intronic
1144180707 17:12749584-12749606 ATATATACACACATATATATAGG - Intronic
1144180708 17:12749624-12749646 ATATATACACACGTATATATAGG - Intronic
1145048781 17:19642697-19642719 GTGGACACAAACATTTATATTGG + Intergenic
1145759428 17:27417805-27417827 GTGTGTGCACACATGTATGTAGG - Intergenic
1146981748 17:37168773-37168795 GTGTAAACATATGTATATATAGG + Intronic
1147601532 17:41749019-41749041 GTGTGTGCATATATATATATGGG - Intergenic
1148763723 17:50025338-50025360 GTGTATACATACATGTATACAGG - Intergenic
1148918808 17:51010611-51010633 ATGTATACACACACACATTTAGG + Intronic
1149053945 17:52340137-52340159 GTGGGTACATATATATATATGGG + Intergenic
1149109893 17:53015996-53016018 ATGCACACACACATATACATAGG - Intergenic
1149236439 17:54595989-54596011 ATATATACACATATATATAAAGG + Intergenic
1149379638 17:56080745-56080767 GTGTATACATACAAAAATAAGGG - Intergenic
1149843078 17:59983779-59983801 GTTTATATATACATATATAGAGG + Intergenic
1149952003 17:60998034-60998056 GTGTATACAGACACAAAGATGGG - Intronic
1149976214 17:61268971-61268993 GGGTATATACATATATATACAGG - Intronic
1150546898 17:66168376-66168398 ATATACACACACATATATATAGG - Intronic
1151050037 17:70967104-70967126 GTATATATATACACATATATAGG + Intergenic
1151122236 17:71806039-71806061 GTGTACACACACACACACATTGG - Intergenic
1151254060 17:72861604-72861626 ATATATACACACAGATACATGGG + Intronic
1151340897 17:73470104-73470126 GTGTATACACATACATGTATTGG - Intronic
1152746573 17:82043068-82043090 GTGTATACACGCATGTCTGTGGG - Intergenic
1152939156 17:83157540-83157562 ATATATACACATATATATATTGG + Intergenic
1153118694 18:1693127-1693149 GTGTATATATGCATATATATTGG + Intergenic
1153458586 18:5308099-5308121 GTATATATACATATATGTATAGG - Intergenic
1153756573 18:8289628-8289650 ATATACACACATATATATATAGG + Intronic
1153831216 18:8924562-8924584 GTATAAACACACATATTTAAAGG + Intergenic
1154019194 18:10647805-10647827 GTGTATGCACACATGCATGTGGG - Intergenic
1154148185 18:11884067-11884089 GTGTATACATAAATAAATATTGG - Exonic
1154185022 18:12175419-12175441 GTGTATGCACACATGCATGTGGG + Intergenic
1154250579 18:12740904-12740926 ATATACACACACATACATATAGG + Intergenic
1155369758 18:25085564-25085586 GTATGTACACATATATATAGTGG - Intronic
1155569702 18:27178993-27179015 ATGTATACACACATAATTTTAGG - Intronic
1155802738 18:30129754-30129776 GTGAATAAACACATAGAAATTGG - Intergenic
1155921227 18:31604975-31604997 GTATATATACATATATATAATGG - Intergenic
1156024594 18:32637670-32637692 GTGTGTATATATATATATATAGG - Intergenic
1156091139 18:33471251-33471273 ATGTATGTACACATATATATGGG + Intergenic
1156132731 18:33997693-33997715 ATATATACACATATATTTATAGG + Intronic
1156475025 18:37400301-37400323 ATATATACACACATATATAAAGG - Intronic
1156650494 18:39220538-39220560 ATCTATACAGACAAATATATAGG - Intergenic
1156782949 18:40874154-40874176 GAATATATACACATATATTTTGG - Intergenic
1156835450 18:41548002-41548024 ATGCATACACACCTACATATGGG - Intergenic
1156973862 18:43192726-43192748 GTGTGTATATATATATATATGGG - Intergenic
1156973868 18:43192839-43192861 ATATATACACACATATATATGGG + Intergenic
1157062442 18:44307060-44307082 GTGTATAGATAGATAGATATAGG - Intergenic
1157152839 18:45236569-45236591 GTATATATACATATATATATGGG + Intronic
1157156144 18:45268207-45268229 GTTTATCAACACATATTTATCGG - Intronic
1157167386 18:45370517-45370539 GAGTGAACACACATATATTTTGG - Intronic
1157198652 18:45640512-45640534 GTGTATACATACATATACACAGG - Intronic
1157317770 18:46607434-46607456 ATATATACACACATATATATGGG + Intronic
1157612283 18:48964934-48964956 GTACATACACACATACACATTGG + Intergenic
1157970052 18:52256759-52256781 TTATATACACACATATAAATTGG - Intergenic
1158028055 18:52927177-52927199 GTGTATATATACGTATATATAGG + Intronic
1158163782 18:54516590-54516612 GTGTATACATACATACACCTAGG + Intergenic
1158244507 18:55416126-55416148 ATGTACACACACATATAGGTAGG + Intronic
1158320890 18:56262277-56262299 GTGTATATACGTATATATACAGG + Intergenic
1158464017 18:57673595-57673617 ATGTACACACACATACATACAGG - Intronic
1159070373 18:63616290-63616312 ATATATACACACACATATCTAGG + Intergenic
1159153048 18:64545556-64545578 GGATATATACATATATATATGGG + Intergenic
1159303491 18:66609275-66609297 ATATATACACATATATATGTGGG - Intergenic
1159385621 18:67721785-67721807 GTATATTCACACTTATAAATGGG - Intergenic
1159727770 18:71983823-71983845 GTGTATACACACAAACACACAGG - Intergenic
1160360842 18:78276577-78276599 GTGTATATATATATATATACAGG - Intergenic
1160360845 18:78276631-78276653 ATGTATATACATATATGTATAGG + Intergenic
1164252228 19:23488853-23488875 GTGTATATATATATATATGTTGG + Intergenic
1164280031 19:23761019-23761041 ATATATATACACATATATATAGG + Intergenic
1164445626 19:28315380-28315402 GTGGTTTCACACAGATATATAGG - Intergenic
1164499525 19:28804560-28804582 GTATGTACACACATGTATATAGG - Intergenic
1164499536 19:28805605-28805627 ATATATACACATATGTATATAGG + Intergenic
1164501674 19:28825416-28825438 GTGTATATATATATATATAAAGG - Intergenic
1165179012 19:33951936-33951958 ATATATACATATATATATATAGG + Intergenic
1166885042 19:45955275-45955297 GTGAATATACACATATGTACAGG + Intronic
1167933620 19:52888853-52888875 GTGTATGCATATACATATATAGG + Intronic
1167936916 19:52916519-52916541 ACATATACACACACATATATAGG - Intergenic
1168186008 19:54699819-54699841 ATATATTCACACATAAATATAGG + Intronic
925311266 2:2884622-2884644 TTATATATACACATATATAAAGG - Intergenic
925540887 2:4966685-4966707 GTGTATATATATATATATACCGG - Intergenic
925543097 2:4987980-4988002 TTGTCTACACAAATATATAGTGG + Intergenic
925571042 2:5313205-5313227 ATGTATACACGAGTATATATGGG - Intergenic
926827181 2:16917414-16917436 GTATATATATACATATATATGGG + Intergenic
927350748 2:22110999-22111021 GTGTGTGCACACACATATGTGGG - Intergenic
927677700 2:25118434-25118456 GTGTATACACACACACACAGTGG - Intronic
928500352 2:31886389-31886411 GTAAATACACACATACATATAGG - Intronic
928692585 2:33816297-33816319 GTGTATACGTATATTTATATAGG - Intergenic
929244995 2:39691879-39691901 AAGCATACACACATATATAATGG + Intronic
929369952 2:41210856-41210878 ATATATACACACATAGATATTGG + Intergenic
929733285 2:44519264-44519286 GTTTATAAACACATGTATAGAGG - Intronic
930274272 2:49293453-49293475 GTGTATACACAAATATTAGTTGG - Intergenic
930363456 2:50410991-50411013 GTGAATTCAAACATATATTTGGG + Intronic
930378615 2:50598539-50598561 ATATATATACACACATATATAGG - Intronic
930443440 2:51438671-51438693 ATATATACACACACATATATAGG - Intergenic
930499574 2:52195770-52195792 GCTTATACATACACATATATGGG - Intergenic
930534126 2:52626544-52626566 GTGTACACACACATACACAGAGG + Intergenic
930967594 2:57350030-57350052 GTATACACACACATATATAAAGG - Intergenic
931254730 2:60560319-60560341 GTGTGTTCCTACATATATATAGG + Intergenic
931682818 2:64767091-64767113 GGATATACATACATAGATATAGG - Intergenic
931726754 2:65118835-65118857 TTGTATATACATATATACATAGG - Intronic
931904063 2:66823002-66823024 TTGTATACACTTATATATAGTGG - Intergenic
931928489 2:67101631-67101653 CTGAAGACACACACATATATAGG - Intergenic
932193776 2:69765057-69765079 GTGTATACACATATATACAGTGG - Intronic
932524971 2:72455778-72455800 GTGTGTATACATATATACATGGG + Intronic
932983230 2:76696032-76696054 TTTTATACACACATATATAAGGG - Intergenic
933009260 2:77037179-77037201 CTGTATATAGACATATATAATGG - Intronic
933208800 2:79541326-79541348 GTGTATATATATATATATATAGG - Intronic
933231659 2:79814590-79814612 GTGTATACACACATATATAATGG - Intronic
933325238 2:80827298-80827320 ATGTATACACACACATAGGTTGG - Intergenic
933325241 2:80827311-80827333 GTGTATACATACATATGTATGGG + Intergenic
933453740 2:82494612-82494634 ATATATACACATACATATATAGG - Intergenic
933453741 2:82494633-82494655 ATATACACACACACATATATAGG + Intergenic
933453742 2:82494663-82494685 ATATATATACACACATATATAGG + Intergenic
934466007 2:94263670-94263692 ATATATATATACATATATATAGG + Intergenic
935168138 2:100587636-100587658 GTGTGTGTATACATATATATGGG - Intergenic
935742608 2:106163552-106163574 GCGTATACAGACATTTATTTAGG + Intronic
935973231 2:108551595-108551617 ATATATATACATATATATATAGG - Intronic
936554701 2:113484991-113485013 GTGCATATAGACAGATATATAGG - Intronic
936659917 2:114531492-114531514 TGGTATACATAGATATATATAGG - Intronic
937126471 2:119477933-119477955 GTGCACACACACACATATTTGGG - Intronic
937457960 2:122059325-122059347 ATGTATATATACAGATATATAGG + Intergenic
937457961 2:122059354-122059376 ATGTATATATACAGATATATAGG + Intergenic
937457987 2:122060184-122060206 GTGTATATATATATATAAATAGG + Intergenic
937482261 2:122274644-122274666 GTGTATATATAGGTATATATAGG - Intergenic
937482270 2:122274806-122274828 GTGCATATATGCATATATATAGG - Intergenic
937482324 2:122275625-122275647 GTGTATATATAGGTATATATAGG - Intergenic
937482327 2:122275681-122275703 GTGTATATATAGGTATATATGGG - Intergenic
937482330 2:122275703-122275725 GTGTATGTACAGATATATATAGG - Intergenic
937635277 2:124148928-124148950 ATGTATATATACACATATATAGG + Intronic
937784866 2:125884945-125884967 GTGTGTATATACACATATATTGG - Intergenic
938625900 2:133108890-133108912 GTGTATACACACAGACACAATGG - Intronic
939181278 2:138804970-138804992 ATATATACATATATATATATAGG + Intergenic
939250401 2:139674712-139674734 GTTTATACACTCATAGATAAGGG - Intergenic
939274346 2:139981055-139981077 ATGCATACACACACATATAATGG - Intergenic
939298554 2:140303057-140303079 ATACACACACACATATATATCGG + Intronic
939579925 2:143936295-143936317 GAGTATACACACGTATGTATAGG - Intergenic
939677685 2:145092939-145092961 GTATATATATATATATATATAGG - Intergenic
939721331 2:145656185-145656207 GTGTATACATATATGTATAAAGG - Intergenic
939788284 2:146542857-146542879 GTGTGTATACATATATACATAGG - Intergenic
939862333 2:147435191-147435213 GTGTGTACACACACATGTTTTGG - Intergenic
940114091 2:150188752-150188774 GGGTATACACAGATTTATTTGGG + Intergenic
940404805 2:153288262-153288284 GTGTTTAGACACACACATATAGG - Intergenic
940548654 2:155122991-155123013 GTATACACACATATATTTATAGG + Intergenic
940606336 2:155927722-155927744 ATGTATATATATATATATATAGG + Intergenic
940812368 2:158259562-158259584 TTGTGTACACATATATTTATTGG + Intronic
940874602 2:158886686-158886708 GTGTACACACACTTCGATATTGG + Intergenic
941092737 2:161197023-161197045 ACGTATACACACATGTATACAGG + Intronic
941219759 2:162762293-162762315 GTGTATATATATATACATATAGG + Intronic
941316382 2:163998235-163998257 GTGTATACATACATATATTCAGG - Intergenic
941620370 2:167771276-167771298 GTTTAAACACACACATATCTAGG - Intergenic
941880941 2:170479873-170479895 ATATATGCACACATATTTATAGG + Intronic
941880945 2:170479987-170480009 ATACATACACACATATATATAGG - Intronic
942014752 2:171801523-171801545 ATATATAAACACATATATACAGG + Intronic
942139614 2:172964813-172964835 GTATATACACTCACATATTTGGG - Intronic
942550504 2:177111030-177111052 ATATATATACACATATATATGGG - Intergenic
942770334 2:179510407-179510429 GTGAATATACATATATATATAGG + Intronic
942914594 2:181288509-181288531 ATGTACACACACACATATTTTGG - Intergenic
942969201 2:181937100-181937122 GAATGTACACACATATGTATGGG + Intergenic
943245675 2:185447799-185447821 GTATATATACACATATATACAGG + Intergenic
943419151 2:187647142-187647164 ATATATACACACATATAAAGAGG - Intergenic
943525169 2:189007451-189007473 TCATATACACACATACATATTGG - Intronic
943541036 2:189214461-189214483 CTTTATACATACATACATATAGG + Intergenic
943735376 2:191348359-191348381 GTGTACATAGACATACATATAGG - Intronic
943848414 2:192683412-192683434 GTATATACATATATATATATGGG + Intergenic
943874749 2:193051003-193051025 GAGTAAACACACATAGACATGGG + Intergenic
943890831 2:193284909-193284931 GTATATATATACATATATAACGG - Intergenic
943945026 2:194049946-194049968 ATGTATATATACATGTATATAGG - Intergenic
944034146 2:195273053-195273075 ATACATATACACATATATATGGG - Intergenic
944315494 2:198281003-198281025 GTGTATAGATATATATATTTGGG - Intronic
944410332 2:199435298-199435320 GTTTATTCCCAAATATATATAGG + Intronic
944901434 2:204220638-204220660 GTATATATATACATATATAGAGG - Intergenic
945148260 2:206761636-206761658 GTATATGTATACATATATATGGG + Intronic
945449991 2:209982937-209982959 GTGTATATATATATATACATGGG - Intronic
945569178 2:211442607-211442629 GTATACACACATATATATTTTGG - Intronic
945642522 2:212446576-212446598 ATATATACATATATATATATGGG - Intronic
945820741 2:214661970-214661992 ATGTGTATACACATATACATAGG - Intergenic
947682599 2:232048951-232048973 TTATATACACACATATAGTTTGG + Intronic
947836262 2:233178019-233178041 ATATATACACATATATATTTGGG + Intronic
948227150 2:236320167-236320189 GTGCTTTCACACATATATTTTGG + Intergenic
1169043555 20:2517351-2517373 ATATATACACACATATACATTGG - Intronic
1169170624 20:3461859-3461881 GAGTATACATACATTTCTATTGG - Intergenic
1169626746 20:7579672-7579694 CTGTATAAACACATCTAAATGGG - Intergenic
1170003469 20:11640623-11640645 GTGTGTACACATAAGTATATGGG - Intergenic
1170255494 20:14338367-14338389 GTGTATATATATACATATATTGG - Intronic
1170339865 20:15312816-15312838 ATATATACACACACATATAATGG - Intronic
1170427438 20:16248908-16248930 ATATATACACATACATATATGGG + Intergenic
1170427440 20:16248943-16248965 ATATATGCACACACATATATGGG + Intergenic
1170606832 20:17881024-17881046 GTGTGTAGATACATATATATAGG + Intergenic
1170900588 20:20458855-20458877 GTATATATATATATATATATAGG - Intronic
1170951688 20:20942260-20942282 ATGCATACATACATATATATAGG + Intergenic
1170965439 20:21065752-21065774 ATGTATACACTAATATATTTGGG + Intergenic
1170965532 20:21066820-21066842 ATGTATACACTAATATATTTGGG - Intergenic
1171000127 20:21406113-21406135 ATATATACACATATATATACAGG - Intergenic
1171545855 20:26000701-26000723 ATGTATATACAAATATAGATTGG + Intergenic
1172069048 20:32242871-32242893 ATGTACACATACACATATATGGG - Intergenic
1172890688 20:38261598-38261620 GTGTATATATGTATATATATAGG - Intronic
1172890689 20:38261620-38261642 GTGTATATATGTATATATATAGG - Intronic
1173950028 20:46984753-46984775 GTGTGTGTATACATATATATAGG + Intronic
1174234939 20:49081913-49081935 ATGTATACATACATATACAATGG + Intronic
1174720550 20:52807411-52807433 TTGAATAAACACATACATATGGG + Intergenic
1174726906 20:52872108-52872130 GTGCGCACACACATATATATAGG - Intergenic
1174775165 20:53336954-53336976 GTGTATGTATACACATATATAGG - Intronic
1174856885 20:54054374-54054396 GTGTATACATATATGTATAGAGG - Intronic
1174954514 20:55082479-55082501 GTGTATACCCATGTATATATAGG + Intergenic
1174967549 20:55234820-55234842 GTGTGTATAAATATATATATAGG - Intergenic
1175000158 20:55619130-55619152 GTGTATACACACACACAGAATGG + Intergenic
1175023049 20:55872014-55872036 GTGTATATATATATATATAAAGG + Intergenic
1176518844 21:7809456-7809478 GTGTGTATACACACATATACTGG + Intergenic
1176658136 21:9606759-9606781 GCGTATACACACATTTGTTTAGG - Intergenic
1176701764 21:10061554-10061576 GTATATACATATATGTATATAGG - Intergenic
1176709876 21:10141121-10141143 ATATATATACACATATATATTGG + Intergenic
1177069410 21:16484652-16484674 ATATATATACACATATATATAGG + Intergenic
1177085488 21:16697456-16697478 GTGTCTTAAAACATATATATAGG - Intergenic
1177295484 21:19168704-19168726 ATTTACACACACATATATATAGG - Intergenic
1177342389 21:19821054-19821076 ATATATACACACACACATATAGG - Intergenic
1177394494 21:20514934-20514956 ATGTATAAATACATATATATAGG + Intergenic
1177403397 21:20635653-20635675 ATATATACACAAACATATATAGG - Intergenic
1177465579 21:21474770-21474792 GTGTATACACACACATATATGGG - Intronic
1178652872 21:34439469-34439491 GTGTGTATACACACATATACTGG + Intergenic
1178910922 21:36672815-36672837 GTGTATACATATATATATATAGG - Intergenic
1179206467 21:39285118-39285140 GTGTATACACACACACAAAATGG + Intronic
1179419804 21:41226467-41226489 GTATACATACACATACATATTGG - Intronic
1179516195 21:41908826-41908848 GTGTACACACACACACATACAGG + Intronic
1179671866 21:42954953-42954975 GTGTACACACACTTCGATATTGG - Intergenic
1180513187 22:16113693-16113715 CTGTATGCACACATATGTAGGGG - Intergenic
1181028013 22:20136814-20136836 GTGCACACACACAAATATACAGG - Intronic
1181300543 22:21877598-21877620 ATATATACACACACATAAATAGG - Intergenic
1181490477 22:23258156-23258178 ATATATACACACATATACACAGG + Intronic
1181527456 22:23498257-23498279 GTGTGTATATATATATATATAGG - Intergenic
1181933776 22:26425341-26425363 GTGTATACCCACATGTGTACAGG + Intergenic
1182706467 22:32284051-32284073 GTGTACAGACACATATAGAGAGG - Intergenic
1183153973 22:36059938-36059960 ATATATACACACACATATACAGG - Intergenic
1184394788 22:44227121-44227143 GTGTACAGACACATATAGAGAGG - Intergenic
949224307 3:1675013-1675035 ATATACACACACATATATATAGG - Intergenic
949427073 3:3929139-3929161 GTGTATATATACATATATGAAGG - Intronic
949453274 3:4211101-4211123 GTATATATATATATATATATGGG - Intronic
949752124 3:7365687-7365709 ATATATATACACATATATATGGG + Intronic
950278769 3:11686963-11686985 TTATATACATACATATGTATAGG + Intronic
950727290 3:14924630-14924652 GTGTATTCACAGACATACATTGG - Intronic
951011593 3:17688233-17688255 ATATATATACACATACATATAGG + Intronic
951083276 3:18478113-18478135 GTGTATATATAGGTATATATAGG - Intergenic
951083278 3:18478135-18478157 GTGTATATATAGGTATATATAGG - Intergenic
951083281 3:18478167-18478189 GTGTATATATAGATATATATAGG - Intergenic
951083285 3:18478223-18478245 GTGTATATATAGGTATATATAGG - Intergenic
951310650 3:21122053-21122075 GTGTGTATACATATATATATAGG - Intergenic
951391378 3:22108195-22108217 ATACATACACACATATATAGAGG + Intronic
953268278 3:41414334-41414356 GTGAATACACACATACAACTTGG + Intronic
953445695 3:42963638-42963660 ATATACACATACATATATATGGG + Intronic
953594643 3:44298825-44298847 ATATATAAACATATATATATAGG - Intronic
954944360 3:54406439-54406461 GTGTGTACACATATATACAATGG + Intronic
955563701 3:60221935-60221957 GTGCATACCCACATTTATATAGG - Intronic
956081790 3:65565100-65565122 GGGTGCACACACATATATACGGG + Intronic
956147753 3:66208670-66208692 ATATATATACACATTTATATGGG + Intronic
956147755 3:66208696-66208718 ATATATATACACATTTATATGGG + Intronic
956147757 3:66208722-66208744 ATATATATACACATTTATATGGG + Intronic
956147759 3:66208744-66208766 GTGTATATATATATTTATATGGG + Intronic
956147775 3:66208959-66208981 ATATATACACACCTTTATATGGG - Intronic
956147808 3:66209787-66209809 ATATATACACACCTATATAAAGG + Intronic
956294643 3:67698620-67698642 TTTTAGATACACATATATATAGG - Intergenic
956484248 3:69704663-69704685 TTTTATACACACATATATTTAGG + Intergenic
956594646 3:70952828-70952850 GTGTATATATATATATATTTTGG + Intergenic
957016572 3:75070681-75070703 ATATACACACACATATATATTGG + Intergenic
957044188 3:75361409-75361431 GTGTACACACACTTCGATATTGG - Intergenic
957167445 3:76692961-76692983 GTGTATATACATACATATATAGG - Intronic
957167449 3:76693106-76693128 GTATATACACATACATATATAGG - Intronic
957167451 3:76693219-76693241 GTATATACGCATACATATATAGG - Intronic
957194282 3:77047741-77047763 ATGTATATAAAGATATATATGGG + Intronic
957251159 3:77772558-77772580 ATATATGCACATATATATATAGG - Intergenic
957446761 3:80322496-80322518 ATCTATACACACACGTATATGGG + Intergenic
957527984 3:81401945-81401967 GTATATATACACACATATGTAGG - Intergenic
957563190 3:81851723-81851745 GTATATACACACATATATGTAGG + Intergenic
957615577 3:82522168-82522190 GTGGATACACACACATATTCAGG + Intergenic
957677472 3:83387561-83387583 GTGTATGTACACACACATATAGG - Intergenic
957711669 3:83868201-83868223 ATATACACACACATATACATAGG + Intergenic
957721163 3:84001321-84001343 GTGTGTGCATATATATATATAGG + Intergenic
957814833 3:85283587-85283609 GTGTATGCAAACATATGCATTGG + Intronic
957843043 3:85695562-85695584 ATATATACACATATATATACGGG + Intronic
957882807 3:86243193-86243215 GTATAAACACACAAATGTATAGG + Intergenic
957888974 3:86330091-86330113 GTGTATGTATATATATATATAGG - Intergenic
957929475 3:86860206-86860228 GTATATTTCCACATATATATAGG + Intergenic
957954494 3:87167333-87167355 CTGTATATATACATATAGATAGG - Intergenic
958087856 3:88835485-88835507 GTATATACACATATATATGATGG - Intergenic
958141984 3:89572851-89572873 GTGAAGACAAACATATAAATTGG + Intergenic
958550744 3:95608587-95608609 GTATATATACACACACATATAGG - Intergenic
958910782 3:99991894-99991916 GTGTATATATATACATATATAGG + Intronic
959300520 3:104593964-104593986 GTGTACAGAGACATATATAAGGG + Intergenic
959377862 3:105607162-105607184 GTATATACACACACACATACAGG + Intergenic
959745183 3:109768166-109768188 ATATATACACACTTATATATAGG - Intergenic
959916502 3:111822315-111822337 GTGTATATATATATATATAATGG + Intronic
959998550 3:112705537-112705559 GTGTATATATACATATATGATGG + Intergenic
960201064 3:114837252-114837274 GTGCATACTCACATACATACAGG - Intronic
960267873 3:115641394-115641416 GTGTATACATACACACATAGGGG + Intronic
960554449 3:119011967-119011989 GTGTATACACACATATATATAGG + Intronic
960568682 3:119163915-119163937 CTATACACACACATATATCTAGG - Intronic
960858225 3:122124408-122124430 GTGTACACACACTTAAAAATAGG - Intergenic
961108784 3:124265757-124265779 GCATATACATACACATATATAGG + Intronic
961275314 3:125721594-125721616 GTGTACACACACTTCGATATTGG + Intergenic
961278227 3:125744215-125744237 GTGTACACACACTTCGATATTGG + Intergenic
961876179 3:130025440-130025462 GTGTACACACACTTCGATATTGG - Intergenic
961983841 3:131111012-131111034 CTGTGTACATACATTTATATTGG + Intronic
962499894 3:135980648-135980670 GTGTATAGACTCCTATACATTGG + Intronic
962713255 3:138105105-138105127 GTGTTTACATATATATATATTGG - Intronic
963447340 3:145429163-145429185 GTGTATATATATATATATTTGGG - Intergenic
964008255 3:151857267-151857289 GTATATACACACACACACATTGG + Intergenic
964098496 3:152962096-152962118 GTGTATACATACATGTACATAGG + Intergenic
964285795 3:155116588-155116610 GAGTATATATATATATATATTGG + Intronic
964287409 3:155133598-155133620 GTATATACATATATATATATGGG - Intronic
964723259 3:159789085-159789107 CTGTATACATACACATATACAGG - Intronic
964731280 3:159868053-159868075 ATGTACATATACATATATATGGG + Intronic
964731282 3:159868138-159868160 ATGTACATATACATATATATGGG - Intronic
964896687 3:161605307-161605329 GTGTATATATATATACATATGGG - Intergenic
964956808 3:162369429-162369451 GTGTGAACTCACATACATATGGG - Intergenic
964977615 3:162639155-162639177 ATATATCCTCACATATATATAGG - Intergenic
965013853 3:163131110-163131132 GTGTATATATATATATGTATGGG + Intergenic
965030679 3:163362574-163362596 GTGTATATTTAAATATATATGGG - Intergenic
965327256 3:167322538-167322560 TTGTATAAACACATACATAAAGG + Intronic
966107599 3:176355913-176355935 GTGTGTACACAAATTTTTATAGG - Intergenic
966113856 3:176437208-176437230 ATACACACACACATATATATGGG + Intergenic
966268263 3:178072754-178072776 GAGTATTCACTCATATTTATTGG + Intergenic
966607908 3:181840192-181840214 GTGTATACACAATTACATATAGG - Intergenic
966953012 3:184841297-184841319 GTGTATAGATACACATATATAGG - Intronic
967480759 3:189970313-189970335 ATATATACACACATACCTATAGG + Intronic
968024501 3:195428306-195428328 ATATATACACTCATATATATAGG + Intronic
968263989 3:197348449-197348471 ATATATACACACACATATGTGGG + Intergenic
968323139 3:197789152-197789174 ATGTATTCATACATATAGATAGG + Intergenic
968715232 4:2153238-2153260 GTATATGTACAGATATATATGGG + Intronic
969024142 4:4160285-4160307 GTGTACACACACTTCGATATTGG - Intergenic
969287178 4:6210320-6210342 ATATATACATACATACATATGGG + Intergenic
969729678 4:8946854-8946876 GTGTACACACACTTCGATATTGG + Intergenic
969785842 4:9456405-9456427 GTGTACACACACTTCGATATTGG + Intergenic
969789264 4:9480810-9480832 GTGTACACACACTTCAATATTGG + Intergenic
969876980 4:10142796-10142818 ATGGATACACACATATAAAGGGG + Intergenic
969999121 4:11346018-11346040 ATGTATACATATGTATATATAGG - Intergenic
970334161 4:15016229-15016251 GTGTATACACATATGTAACTGGG + Intronic
970336139 4:15045368-15045390 ATATATACACACATATGTACAGG - Intronic
970477841 4:16441728-16441750 ATGTATACATATATACATATGGG + Intergenic
970682711 4:18529082-18529104 GTTTAAACATACCTATATATGGG + Intergenic
970830163 4:20328857-20328879 GTACATACACACATTTATTTTGG - Intronic
970926872 4:21462202-21462224 GTGAAAACACACAAATACATGGG - Intronic
971043048 4:22776552-22776574 ATATACACACACATATATATGGG + Intergenic
971692301 4:29852469-29852491 GGATATACACACATATATAAGGG + Intergenic
971747933 4:30609206-30609228 CTGTCTAGACACACATATATGGG - Intergenic
971820295 4:31544533-31544555 GTGTGTATACATATATATATGGG - Intergenic
971861657 4:32114314-32114336 ATATATTCACACACATATATAGG + Intergenic
971882709 4:32399598-32399620 ATATATACACACACATATACCGG - Intergenic
971937776 4:33175138-33175160 ATGTTTACACAGATATATACAGG + Intergenic
972114594 4:35615068-35615090 TTGTGTATACACATATATGTAGG + Intergenic
972199672 4:36699614-36699636 GTGTATCTACACATATCTAAAGG - Intergenic
972475000 4:39441858-39441880 GTGTCTATACATATATTTATTGG - Intronic
972698048 4:41467132-41467154 ATACATACACATATATATATGGG - Intronic
972854193 4:43086615-43086637 CTATACACACACATAGATATAGG + Intergenic
972968781 4:44546627-44546649 AAGTATATACACATATATATGGG - Intergenic
973053298 4:45621914-45621936 GTACATATACAAATATATATAGG - Intergenic
973326081 4:48863443-48863465 GGGTACACACGAATATATATGGG + Intergenic
974088253 4:57283766-57283788 ATATATACACACACATATACAGG - Intergenic
974270324 4:59642506-59642528 GTGTATACACACAGATGATTAGG + Intergenic
974287217 4:59883948-59883970 ATGCACACACACACATATATTGG + Intergenic
974430361 4:61789295-61789317 GTGTACACACACATATATGTTGG + Intronic
974693055 4:65326058-65326080 ATATATTCACACATATAAATTGG + Intronic
974720511 4:65732184-65732206 ATATATACACACATATATATAGG + Intergenic
975145079 4:70957974-70957996 GTATATATACACATACACATAGG + Intronic
975428789 4:74263086-74263108 ATATATACACATATATATATAGG - Intronic
975616169 4:76249899-76249921 ATATATACACATATATATAATGG - Intronic
975697946 4:77032586-77032608 GTGTGTACACATACATCTATAGG + Intronic
975879724 4:78889729-78889751 GTATATACACACATACACCTGGG - Intronic
976039398 4:80864509-80864531 ATGTATATATACGTATATATAGG - Intronic
976440580 4:85068992-85069014 TTATATATATACATATATATGGG - Intergenic
976875201 4:89845974-89845996 GTATACACATACATATATATAGG - Intergenic
977007321 4:91585512-91585534 GTATATACATACATATGTATAGG + Intronic
977018442 4:91726181-91726203 ATGTATACACATATATGAATGGG - Intergenic
977096493 4:92750843-92750865 ATATATACATACATATTTATTGG + Intronic
977112816 4:92981200-92981222 GCACACACACACATATATATAGG - Intronic
977138098 4:93331661-93331683 ATGAATACATACACATATATAGG + Intronic
977540252 4:98309881-98309903 GTATATACATATATATATAATGG + Intronic
977676646 4:99755501-99755523 GTGGGAACAGACATATATATTGG - Intergenic
977858976 4:101932344-101932366 GTACATACACAAACATATATAGG - Intronic
978064555 4:104380319-104380341 GTGTACACACACACATATATAGG - Intergenic
978101385 4:104844932-104844954 GAGTATAGAAACATGTATATAGG + Intergenic
978179673 4:105777279-105777301 ATATATACACACACATACATCGG - Intronic
979262091 4:118660012-118660034 ATATATACACACATATACATAGG - Intergenic
979391577 4:120134841-120134863 CTATATACACACATGTAGATAGG - Intergenic
979457156 4:120940167-120940189 GTGTATACACACTTACACATGGG - Intergenic
979608244 4:122662199-122662221 GTATATATACACACATATATAGG + Intergenic
979756909 4:124352042-124352064 GTGTATAGATACATGTGTATGGG + Intergenic
979804898 4:124959526-124959548 GTATATATAGAAATATATATGGG - Intergenic
979942356 4:126777631-126777653 ATAGATACACATATATATATGGG - Intergenic
980445577 4:132902648-132902670 GTGTATATATACATATACATTGG - Intergenic
980445793 4:132906043-132906065 GTGTATGTATAAATATATATGGG + Intergenic
980460252 4:133101481-133101503 GTATACACACACACATATACTGG - Intergenic
980944263 4:139303453-139303475 ATGTATATATACATATACATAGG - Intronic
981155158 4:141426460-141426482 GTGTAAAGGCAAATATATATGGG - Intergenic
981284452 4:142999298-142999320 ATGTACACACACATTTATAAGGG + Intergenic
981436858 4:144734142-144734164 TAGTATACACACATATATTATGG + Intronic
981437539 4:144743613-144743635 ATATATACACACATGTATTTTGG - Exonic
981536281 4:145803157-145803179 ATGCATACACACATATAAACAGG + Intronic
981645209 4:146991314-146991336 GTGCACACACACATACAAATTGG + Intergenic
981834436 4:149039113-149039135 ATATATACACACACATATATGGG - Intergenic
981863745 4:149388657-149388679 ATATATATATACATATATATAGG + Intergenic
981942342 4:150295689-150295711 GTGTATACACATATAGGCATAGG + Intronic
982145776 4:152389382-152389404 GTGTAAACATATATATATGTGGG - Intronic
982341741 4:154307382-154307404 GTGCATACACACATAGGTATGGG - Intronic
982416451 4:155138736-155138758 GTGTAAACACATACATATATTGG - Intergenic
982590670 4:157305277-157305299 GTGTCTACAGACATATAATTAGG - Intronic
982897181 4:160946662-160946684 GTGTGTACACATATATATTTGGG - Intergenic
983034239 4:162842837-162842859 ATATATACACACATATGAATAGG + Intergenic
983095742 4:163559266-163559288 AAGTATACACACAAATGTATTGG + Intronic
983328348 4:166289612-166289634 GTGTGTATACATATATATACTGG - Intergenic
983447370 4:167870590-167870612 GTGTGTATATATATATATATGGG + Intergenic
983450505 4:167905369-167905391 GTGTATATACATATATGTATAGG - Intergenic
983779989 4:171657103-171657125 ATGTATATACATATGTATATAGG - Intergenic
983826742 4:172271592-172271614 ATATATACACACCTATATATAGG + Intronic
984041360 4:174738396-174738418 GTTTATGCATACATATATAAAGG + Intronic
984272347 4:177562526-177562548 ATATATATACACATATATGTAGG - Intergenic
984305033 4:177978496-177978518 ATTCATGCACACATATATATGGG - Intronic
984326690 4:178263945-178263967 ATGTACATACCCATATATATGGG + Intergenic
984358933 4:178702860-178702882 GTGTATGTGCACACATATATAGG - Intergenic
984876534 4:184372843-184372865 GTATATACATAGGTATATATAGG + Intergenic
984876545 4:184372986-184373008 GTGTATATATAGGTATATATAGG + Intergenic
984960464 4:185092717-185092739 GTCTACACAAACACATATATGGG + Intergenic
985254747 4:188058583-188058605 GTGTATACACACACACACAAAGG + Intergenic
985417276 4:189749314-189749336 GGGTATACACACATTTGTTTAGG + Intergenic
985632289 5:1020325-1020347 GTGTATACATACATGTATAGAGG + Intronic
986036529 5:3945562-3945584 GTGTATATATATATATATAGTGG + Intergenic
986109152 5:4693757-4693779 GTGCATACACACATACATTATGG + Intergenic
986294515 5:6426544-6426566 ATATATACACACACACATATAGG - Intergenic
986313198 5:6570009-6570031 GTGTATATATATATATATAAAGG + Intergenic
986965479 5:13265891-13265913 GTATATATACACATGTATATAGG - Intergenic
986965482 5:13265963-13265985 GTGTGTATACATACATATATAGG - Intergenic
986965483 5:13266005-13266027 GTGTGTATACATACATATATAGG - Intergenic
987125188 5:14805367-14805389 ACACATACACACATATATATAGG - Intronic
987151692 5:15047028-15047050 ATGTATACATATATGTATATGGG - Intergenic
987197462 5:15541349-15541371 GTGTATATATACATATAGTTTGG - Intronic
987705357 5:21456960-21456982 GTGTGTATATATATATATATGGG + Intergenic
987753945 5:22075944-22075966 GTTTATACATACATATATAATGG + Intronic
987779220 5:22411098-22411120 GTATATACAAAGATATATAATGG + Intronic
987974876 5:25002011-25002033 GTATACACACACACATATAATGG - Intergenic
988010892 5:25483916-25483938 ATGTATATATACATATATAATGG + Intergenic
988159374 5:27500251-27500273 ACACATACACACATATATATAGG - Intergenic
988184518 5:27843050-27843072 ATTTATATACACATATATATAGG - Intergenic
988291382 5:29292534-29292556 ATATATACAAACATATATATGGG + Intergenic
988291386 5:29292600-29292622 GTATATATATACATATATATGGG + Intergenic
988291389 5:29292687-29292709 ATATATACAAACATATATACGGG - Intergenic
988804017 5:34723219-34723241 CTATATACACATCTATATATAGG - Intronic
988910920 5:35842362-35842384 ATATACACACACACATATATGGG + Intergenic
989207080 5:38820765-38820787 GTGTATATTCATATATACATAGG - Intergenic
989401392 5:41011394-41011416 TGCTATACACACAAATATATGGG + Intronic
989768240 5:45111982-45112004 GTGTGTACACTCTAATATATAGG + Intergenic
989959841 5:50399488-50399510 GTTTATACCCCCAAATATATGGG + Intronic
990647890 5:57865093-57865115 GTGTACATATACATATTTATGGG + Intergenic
990649547 5:57882742-57882764 ATATATACACACACATACATAGG + Intergenic
990880753 5:60535023-60535045 GTGTGTACACACATACACAATGG - Intergenic
990958638 5:61369081-61369103 GTGTTTACACACATATTCATTGG + Intronic
991229653 5:64317158-64317180 GTGTGTACACACACATATACAGG + Intronic
991229684 5:64317727-64317749 GTGTAAACATATATATATATAGG - Intronic
992231302 5:74666837-74666859 GAACACACACACATATATATAGG + Intronic
992357288 5:75999312-75999334 AGATACACACACATATATATAGG + Intergenic
992462623 5:76975956-76975978 GTGTATATATATATATATGTTGG + Intronic
992970334 5:82050069-82050091 ATTTATACACATTTATATATGGG + Intronic
992975099 5:82108371-82108393 ATATATATGCACATATATATAGG - Intronic
993100207 5:83529030-83529052 ATGTATACACACATATATACAGG + Intronic
993168882 5:84390139-84390161 ATATAAACACACATATATAGGGG - Intergenic
993213193 5:84981548-84981570 GTTTCTACATATATATATATAGG - Intergenic
993351634 5:86857089-86857111 GTGTTTACCAAAATATATATCGG - Intergenic
993854547 5:93057000-93057022 ATGTACACACACATATATATAGG - Intergenic
994493497 5:100479007-100479029 GTGGATACAGATATATAGATAGG - Intergenic
994564810 5:101430165-101430187 ATATATACACATATATATATGGG - Intergenic
994602973 5:101930891-101930913 ATATATAAATACATATATATAGG + Intergenic
994828787 5:104749620-104749642 ATATATAGACACATATATATTGG - Intergenic
994837280 5:104871947-104871969 GTGTATATATACATATATAAAGG - Intergenic
995149152 5:108822206-108822228 GTGTGTATACACATATATAATGG - Intronic
995832995 5:116374230-116374252 GTGTATATATATATATATATAGG - Intronic
996476113 5:123922933-123922955 ATAGACACACACATATATATTGG - Intergenic
996497168 5:124172069-124172091 TTGTATAAACACATATTTCTGGG - Intergenic
996609880 5:125365997-125366019 GTGTCTTCACTCATATGTATTGG + Intergenic
996797163 5:127360862-127360884 GTGTATATATATATATATGTTGG + Intronic
996986867 5:129578425-129578447 GTGTATATATACATGCATATAGG - Intronic
997243783 5:132328820-132328842 GTGTATATATATATATATAAAGG - Intronic
997317179 5:132946463-132946485 ATATATACACACATACATAATGG + Intronic
997599426 5:135129242-135129264 GTGTATATGCACATTTAAATTGG + Intronic
997652279 5:135531302-135531324 GTGTATACAAATATATATGTTGG + Intergenic
998344801 5:141452488-141452510 GTGTGTACAAATATAAATATGGG - Intronic
998452252 5:142244157-142244179 GTTTATATATATATATATATTGG - Intergenic
998597981 5:143554161-143554183 GTGTGTAAACACATATGTATGGG + Intergenic
998951511 5:147397173-147397195 GTGTGTATATATATATATATAGG - Intronic
999622424 5:153486649-153486671 ATATATACACACACATATATGGG - Intergenic
999675703 5:153999983-154000005 GTATACACACACACATATAATGG + Intronic
999991890 5:157057578-157057600 ATGCATAGACACATGTATATAGG - Intronic
999994791 5:157081931-157081953 TAGTATATATACATATATATAGG + Intergenic
1000114552 5:158141189-158141211 ATCTACACACACATATATATGGG - Intergenic
1000153330 5:158525449-158525471 ATATATACATATATATATATCGG + Intergenic
1000268755 5:159662977-159662999 GTGTATACATACATATGAAGAGG - Intergenic
1000570481 5:162906692-162906714 ACGTGTATACACATATATATAGG + Intergenic
1000787779 5:165567716-165567738 GTGTATAGACAGGTAGATATTGG - Intergenic
1001798467 5:174522577-174522599 GTGTATATACACATCTATGTAGG + Intergenic
1001832382 5:174800100-174800122 GTGTATACATACATATGTGGTGG - Intergenic
1001946561 5:175783637-175783659 ATATATATACATATATATATAGG + Intergenic
1002837494 6:877366-877388 GTTTATACACACATAAATTCAGG + Intergenic
1002848943 6:974243-974265 GTGTATATATATATATATATGGG + Intergenic
1002949515 6:1795430-1795452 ATGTATATATACAGATATATGGG - Intronic
1003265225 6:4559923-4559945 GTGTATAGATAAATAGATATAGG + Intergenic
1003311219 6:4971425-4971447 ATATATACATATATATATATAGG - Intergenic
1004139549 6:13003950-13003972 ATATATACATATATATATATAGG - Intronic
1004533846 6:16480374-16480396 CTCTAAATACACATATATATTGG + Intronic
1004622745 6:17345528-17345550 GTGTGTACATACAAACATATTGG + Intergenic
1004648603 6:17586959-17586981 ATGTATATACGTATATATATGGG - Intergenic
1004848717 6:19674261-19674283 ATGCATACACACATATATTTTGG + Intergenic
1005237414 6:23780794-23780816 GTAGATACACACATATAGATAGG + Intergenic
1005320908 6:24652722-24652744 GTGTGTATATATATATATATAGG - Intronic
1007010440 6:38411928-38411950 GTGTACACATATATATATATAGG - Intronic
1008135048 6:47765263-47765285 GTGTATACACACATAAGTATGGG + Intergenic
1008424456 6:51340724-51340746 ATATATACACACATGTATAAAGG + Intergenic
1008451605 6:51657701-51657723 ATATATACACACATATATGTGGG - Intronic
1008728384 6:54450075-54450097 ATATATACATATATATATATAGG + Intergenic
1009353676 6:62712616-62712638 ATTTATATATACATATATATAGG + Intergenic
1009730045 6:67590178-67590200 ATATACACACACATATACATGGG - Intergenic
1009730909 6:67605077-67605099 ATATATATATACATATATATAGG + Intergenic
1009980273 6:70719489-70719511 GTGTTTGTACACATATATAAAGG - Intronic
1010451320 6:76006456-76006478 GTGTATATACATATGTATATAGG + Intronic
1011100686 6:83718286-83718308 ATATACACACACATATATATAGG + Intergenic
1011320129 6:86081602-86081624 ATATATATACATATATATATAGG + Intergenic
1011369611 6:86621035-86621057 GTTGATACATACATGTATATTGG + Intergenic
1011838191 6:91459859-91459881 AAATATATACACATATATATGGG + Intergenic
1012101331 6:95089501-95089523 ATATATACACATACATATATTGG - Intergenic
1012312308 6:97740567-97740589 ATATATAGATACATATATATAGG + Intergenic
1012366407 6:98445979-98446001 GTATATATACGCACATATATTGG + Intergenic
1012556153 6:100514587-100514609 ATGTGTACACATATATTTATTGG + Intronic
1012695058 6:102370378-102370400 GTGTGCACACACATATTTAGAGG - Intergenic
1012774659 6:103484305-103484327 GTGTATACCCCCTTAGATATTGG + Intergenic
1012820389 6:104079593-104079615 GTATATATATATATATATATGGG - Intergenic
1013477590 6:110523357-110523379 ATGTACACATACATATATATGGG + Intergenic
1013730951 6:113166234-113166256 TTGAATACACAAATAAATATAGG - Intergenic
1013796092 6:113890618-113890640 GTGTACACACATATATATACAGG + Intergenic
1014638173 6:123874929-123874951 GTGTACATACACCTATATAAAGG + Intronic
1014984908 6:127993291-127993313 ATAGATACACACATATATATAGG + Intronic
1015048008 6:128802071-128802093 ATATATATACACACATATATAGG - Intergenic
1015447960 6:133329780-133329802 ATATATACTCACATATAAATTGG + Intronic
1015467354 6:133561661-133561683 GTGTATATATATATATATATAGG + Intergenic
1016573958 6:145546784-145546806 ATGTATACAATCTTATATATGGG - Intronic
1016653631 6:146492484-146492506 ATATGTACACACATATACATTGG - Intergenic
1016729433 6:147412672-147412694 GTATATACACACACATATAATGG + Intergenic
1017043810 6:150328797-150328819 ATATATACACACAAACATATTGG + Intergenic
1017383003 6:153851524-153851546 CTTTATACATATATATATATAGG + Intergenic
1017447870 6:154525665-154525687 GTGTATATATACACATACATTGG + Intergenic
1017475101 6:154782576-154782598 GTATATATACACACATATATAGG + Intronic
1017506184 6:155070811-155070833 ATGTAGACACACATAAATAAAGG - Intronic
1017610317 6:156178544-156178566 ATGTATATACTCATATATATGGG - Intergenic
1017610319 6:156178574-156178596 ATGTATATACTCATATATATGGG - Intergenic
1017613636 6:156219212-156219234 GTGTATATATATTTATATATTGG - Intergenic
1017960262 6:159215602-159215624 GAATACACACACATATATAAAGG + Intronic
1017967984 6:159283251-159283273 GTATATATACATATATATATAGG - Intergenic
1017967990 6:159283397-159283419 GTATATACATATATGTATATAGG - Intergenic
1017967991 6:159283423-159283445 GTATATACATATATGTATATAGG - Intergenic
1017967992 6:159283449-159283471 GTATATACATATATGTATATAGG - Intergenic
1017967995 6:159283527-159283549 GTATATACATATATGTATATAGG - Intergenic
1018161092 6:161042993-161043015 ATTTACACACACATATATATAGG - Intronic
1018642013 6:165912935-165912957 ATGTGTACACATATATATACAGG + Intronic
1018929367 6:168230345-168230367 GTGTGTACATACATATATGTAGG + Intergenic
1019521571 7:1462972-1462994 GTGTGTACACATACATATATGGG + Intergenic
1019926183 7:4194472-4194494 ATATATACTCCCATATATATGGG + Intronic
1020306816 7:6841903-6841925 GTGTACACACACTTAGATATTGG - Intergenic
1020553219 7:9634570-9634592 GTGTACATACATATATATCTTGG + Intergenic
1020765777 7:12318822-12318844 GTGTATTCACATATATGTGTGGG + Intergenic
1020973180 7:14972894-14972916 GTGTATACATACATATAGGTGGG + Intronic
1021254486 7:18374215-18374237 ATATACACACACACATATATAGG + Intronic
1021290559 7:18838566-18838588 GAGTATATACATATATAGATGGG - Intronic
1021345489 7:19522310-19522332 ATATATACACACATATATATAGG - Intergenic
1022725490 7:32977868-32977890 ATATATACATATATATATATGGG - Intronic
1022756754 7:33301133-33301155 ATATATACACACACATAAATGGG + Intronic
1023098525 7:36688861-36688883 GTATCTATACACATGTATATGGG + Intronic
1024560693 7:50642500-50642522 ATATATATACACATACATATAGG + Intronic
1024624332 7:51191626-51191648 GTGTATACATAAATACATGTAGG - Intronic
1024772983 7:52746403-52746425 ATGTACACACACATGTTTATAGG - Intergenic
1024899756 7:54305563-54305585 ATGTAAACAAACATATATCTTGG - Intergenic
1025168862 7:56737724-56737746 GTGTACACACACATATATTTTGG + Intergenic
1025264603 7:57445845-57445867 ATATATATACACATATATATAGG + Intergenic
1025703528 7:63842174-63842196 GTGTATACACACATATATTTTGG - Intergenic
1025728771 7:64091632-64091654 GTGTGTATATATATATATATGGG + Intronic
1026136597 7:67667999-67668021 GTGTATATATACATATGTGTGGG - Intergenic
1026294968 7:69043399-69043421 GTGTATATATATATATTTATAGG - Intergenic
1026727900 7:72884732-72884754 ATATATACACACACGTATATAGG - Intronic
1026995175 7:74611137-74611159 GTGTACACACACATACACACAGG + Intergenic
1027633134 7:80633745-80633767 ATGTATACATACATACATTTAGG - Intronic
1027739453 7:81981946-81981968 GTATAGATACACATAAATATTGG + Intronic
1027810958 7:82897480-82897502 GTGTATACACACACATACATAGG + Intronic
1027867825 7:83670706-83670728 GTGTATACTTACAAAAATATAGG + Intergenic
1028239519 7:88402599-88402621 GTATATACATACATGTATGTAGG + Intergenic
1028735447 7:94206818-94206840 CTGTTTTCACACAGATATATTGG - Intergenic
1028915513 7:96254569-96254591 ATATATACACACACATATGTGGG - Intronic
1028935353 7:96457806-96457828 GTGTATACATATATATATTTGGG - Intergenic
1029077981 7:97950850-97950872 GTGTACACACACTTCGATATTGG - Intergenic
1029151982 7:98486924-98486946 GTGTGTGCACACATGTATCTGGG + Intergenic
1029290272 7:99497047-99497069 ATATATACACATATATATATAGG - Intronic
1029607450 7:101607755-101607777 GTGTATATATATATATATATGGG - Intergenic
1029721606 7:102369610-102369632 ATATATACACATACATATATAGG - Intronic
1029801613 7:102953901-102953923 GTGTATACACATATACCTATAGG + Intronic
1029881705 7:103818875-103818897 TTGAACACACACATATTTATTGG + Intronic
1029950341 7:104577485-104577507 ACTTGTACACACATATATATAGG - Intronic
1030076951 7:105745262-105745284 GTATAGATACACATATATATAGG + Intronic
1030503674 7:110392067-110392089 ATATATACACACACACATATGGG - Intergenic
1030763296 7:113378015-113378037 ATATATATACACATATATATAGG + Intergenic
1030768706 7:113444712-113444734 CTATATACAATCATATATATAGG - Intergenic
1031063313 7:117076377-117076399 GTGTATACATACACATATATTGG - Intronic
1031100770 7:117477634-117477656 ATGTACACACACATGTACATAGG - Intronic
1031304667 7:120111257-120111279 GTATATACATATATATACATGGG + Intergenic
1031535165 7:122924920-122924942 GTATATATATATATATATATGGG - Intergenic
1031536467 7:122939715-122939737 ATATATACACACACACATATAGG + Intergenic
1031599274 7:123685888-123685910 ATGTATATAAATATATATATAGG + Intronic
1031677473 7:124628637-124628659 GTATATATATATATATATATGGG - Intergenic
1031780615 7:125958097-125958119 ATATATACACATATATATATAGG - Intergenic
1031879692 7:127182679-127182701 GTGTATAGACAGATATATGATGG + Intronic
1032144339 7:129365626-129365648 GAGTATATATATATATATATGGG + Intronic
1032745705 7:134783846-134783868 GGGTAAATACACAGATATATAGG + Intronic
1033037880 7:137891968-137891990 TAGTTTACACACATACATATGGG - Intronic
1033441760 7:141386493-141386515 GTGTAGTTACACATATTTATGGG + Intronic
1033539346 7:142342291-142342313 ATATATATAGACATATATATGGG + Intergenic
1033647130 7:143314170-143314192 GTGTATATAAATATATATAATGG - Intergenic
1033796659 7:144853160-144853182 GTGTATATGCATGTATATATAGG - Intergenic
1033825946 7:145189078-145189100 TTATATACAGACATATATAGAGG - Intergenic
1033876559 7:145826481-145826503 ATATATACATACATATATATAGG + Intergenic
1033987027 7:147238384-147238406 GTGTCTGCACACATATTTGTAGG - Intronic
1034117673 7:148598685-148598707 TTATATATATACATATATATAGG - Intronic
1034297074 7:149983447-149983469 GTGTATATATATATATATGTAGG + Intergenic
1034762818 7:153689455-153689477 ATATGTACACACATATGTATAGG - Intergenic
1035180047 7:157082772-157082794 GTGTGGACACATATATATGTAGG - Intergenic
1035448961 7:158962771-158962793 GTGTATGCACACACATACACGGG - Intergenic
1035682695 8:1500042-1500064 ATGTATTCACACACATATGTGGG - Intergenic
1035741633 8:1932236-1932258 GTGCATACACACATGTGCATGGG - Intronic
1035906763 8:3520019-3520041 GTATATATATATATATATATAGG - Intronic
1035932432 8:3796659-3796681 ATGTATACATATAGATATATAGG - Intronic
1036025075 8:4898126-4898148 GAGGATATACACATATATATGGG - Intronic
1036192863 8:6687050-6687072 ATATATACACATATATATCTGGG - Intergenic
1036240023 8:7073659-7073681 GTGTACACACACTTCGATATTGG + Intergenic
1036395350 8:8365789-8365811 GTGTGTATATATATATATATAGG - Intronic
1036819977 8:11932578-11932600 GTGTACACACACTTCGATATTGG - Intergenic
1036903299 8:12687922-12687944 GTGTACACACACTTCGATATTGG - Intergenic
1037153754 8:15673979-15674001 GTGTATGCACATGTGTATATAGG - Intronic
1037178875 8:15979622-15979644 GTGTATACACACACACACAATGG - Intergenic
1037201477 8:16258450-16258472 ATATATACACACATATATGTTGG + Intronic
1037201478 8:16258501-16258523 TCATATACACACATATATGTGGG - Intronic
1037247657 8:16855025-16855047 GTATAAACACACATATTTAAAGG - Intergenic
1037692779 8:21196753-21196775 GTGTATACACACACGTGTATAGG - Intergenic
1038020234 8:23546618-23546640 GTGTATATATATATATATTTGGG + Intronic
1038094132 8:24288434-24288456 GTGTATAAAAATATATATTTAGG - Intergenic
1038763173 8:30403629-30403651 GTGTATACACAGATTTAGCTAGG - Intronic
1038896013 8:31783074-31783096 CTGTATGCAGACATAAATATAGG + Intronic
1038946467 8:32366614-32366636 GTGTATATATACATATATTATGG - Intronic
1039605807 8:38879489-38879511 ATATATACATATATATATATGGG + Intergenic
1039605815 8:38879585-38879607 ATATATACACATATATATATGGG + Intergenic
1039605817 8:38879607-38879629 GTATATATATACATATATATGGG + Intergenic
1039605819 8:38879635-38879657 ATATATACATATATATATATGGG + Intergenic
1039605821 8:38879661-38879683 ATATATATACATATATATATGGG + Intergenic
1039605823 8:38879685-38879707 ATATATATATACATATATATGGG + Intergenic
1039605825 8:38879709-38879731 ATATATATATACATATATATGGG + Intergenic
1039605827 8:38879729-38879751 GGGTATATATACATATATATGGG + Intergenic
1039605831 8:38879769-38879791 ATATATATACATATATATATGGG + Intergenic
1039605833 8:38879795-38879817 ATATATATACATATATATATGGG + Intergenic
1039605835 8:38879819-38879841 ATATATACATATATATATATGGG + Intergenic
1039625382 8:39045453-39045475 GTGTACACACACGCACATATAGG - Intronic
1039625383 8:39045479-39045501 ATGTATACACACGCACATATAGG - Intronic
1039655656 8:39402552-39402574 TTGTAAACCCACATTTATATAGG - Intergenic
1039872228 8:41556170-41556192 ATATATACACACATATAAAATGG - Intergenic
1040640474 8:49328578-49328600 GTGTGTGTACACATATAAATAGG - Intergenic
1040901774 8:52424888-52424910 GTGCATACACACTTTTTTATGGG - Intronic
1040988572 8:53323924-53323946 ATGCATACACACAAATATAAAGG + Intergenic
1041191245 8:55357261-55357283 GTTTATATGCACATATATTTTGG + Intronic
1041440765 8:57894084-57894106 GTGCATATACACATATCTGTAGG + Intergenic
1041817415 8:61990304-61990326 ATTTATAAACACATATTTATAGG + Intergenic
1041819704 8:62017175-62017197 ATATATACATACATATATAATGG + Intergenic
1042803788 8:72749755-72749777 GTATATATACAAATATATATTGG - Intronic
1042880804 8:73486608-73486630 GTGTATATATATATATATAATGG - Intronic
1042975847 8:74468537-74468559 ATATACACACACACATATATAGG + Intronic
1043009659 8:74866195-74866217 GTATATACAATAATATATATGGG + Intergenic
1043031557 8:75140242-75140264 GTGTATATGCACACACATATAGG - Intergenic
1043117734 8:76280518-76280540 GTATAAACACACTCATATATAGG - Intergenic
1043169235 8:76943786-76943808 TTATATACACATATATATTTGGG + Intergenic
1043317954 8:78944584-78944606 ATTTATACACACATAAATCTGGG - Intergenic
1043664900 8:82797735-82797757 ATAAATACACATATATATATGGG - Intergenic
1043677237 8:82972874-82972896 GGGTATATATATATATATATGGG + Intergenic
1043719282 8:83526079-83526101 ATACACACACACATATATATAGG - Intergenic
1043719573 8:83530612-83530634 GTGTGTACAGCCATATATGTGGG - Intergenic
1043874793 8:85473626-85473648 CTGCATACACATATATACATAGG - Intronic
1045039083 8:98203874-98203896 GTGTGTACATACACATATGTAGG + Intronic
1045175592 8:99721188-99721210 GTATCCACACACATATATAATGG + Intronic
1045549723 8:103160627-103160649 GTCTATACATATATATATAAAGG + Intronic
1045817014 8:106288501-106288523 ATATATACACACACATATTTAGG - Intronic
1045922786 8:107551662-107551684 ATATAAACACACACATATATGGG - Intergenic
1046339476 8:112833673-112833695 ACACATACACACATATATATTGG - Intronic
1046373801 8:113348991-113349013 ATGTATATACATACATATATAGG + Intronic
1046500571 8:115071075-115071097 GTGTGTATATATATATATATGGG - Intergenic
1046582392 8:116109584-116109606 TTGTATACACAGATATAATTAGG + Intergenic
1046587358 8:116163905-116163927 GTGCACACACACATATACATAGG + Intergenic
1046836876 8:118811650-118811672 AATTATACACACATATATTTTGG + Intergenic
1046870413 8:119199286-119199308 ATATATACACATATATACATGGG - Intronic
1047451543 8:124969490-124969512 ATGTATATATACACATATATAGG - Intergenic
1047626547 8:126662395-126662417 ATATATACACATGTATATATTGG + Intergenic
1047913475 8:129556173-129556195 GTACACACACACATATATAGTGG - Intergenic
1048582633 8:135742891-135742913 GTCTATACATACATACATATTGG + Intergenic
1048607569 8:135985485-135985507 ATATATACACAAATATATATAGG - Intergenic
1048722769 8:137345389-137345411 ATATATACACACACATATATAGG - Intergenic
1048754538 8:137722526-137722548 GTGTATATATATATATATATGGG + Intergenic
1048875024 8:138829906-138829928 GGTTATACACACACATATGTGGG + Intronic
1048893406 8:138967456-138967478 TTATATACACACATATATTGTGG - Intergenic
1049113254 8:140663228-140663250 GTGTGTACACACATAGACAATGG + Intronic
1049278575 8:141732321-141732343 GTGTTTACACACTTCTTTATAGG + Intergenic
1049898311 9:132193-132215 GTGCATATAGACAGATATATAGG + Intronic
1050003693 9:1105203-1105225 GTGTATATATATATATATAAAGG - Intergenic
1050196929 9:3095218-3095240 GTGTACATGCACATATACATGGG - Intergenic
1050511406 9:6399873-6399895 GTGTATATGCACACATATATGGG - Intergenic
1050665319 9:7929179-7929201 GTGTATAATCACATATGTACTGG + Intergenic
1050686503 9:8176055-8176077 AAATATTCACACATATATATTGG - Intergenic
1050766072 9:9135395-9135417 GTGTATACACACATCGATTTGGG - Intronic
1050826841 9:9957149-9957171 ATATATACATACATATAAATGGG - Intronic
1050981712 9:12026407-12026429 GTATATATATAGATATATATGGG - Intergenic
1051111434 9:13641924-13641946 ATATATACACACATATATAATGG + Intergenic
1051317016 9:15849310-15849332 CTCTATATACATATATATATAGG - Intronic
1051378038 9:16424629-16424651 GTGTGTACATATATGTATATGGG + Intronic
1051897018 9:21997439-21997461 ATGTCTACACACACATATGTGGG + Intronic
1052139779 9:24966296-24966318 AAGTATACAAACATATAAATTGG + Intergenic
1052161852 9:25272199-25272221 TTGGATACACACATGTATAGAGG + Intergenic
1052184164 9:25570355-25570377 TTAGATACACACAAATATATTGG - Intergenic
1052369003 9:27643611-27643633 ATATATACACATATGTATATGGG - Intergenic
1052573402 9:30259420-30259442 GTATGTATAGACATATATATGGG - Intergenic
1052686289 9:31761625-31761647 GTATATATACACATTAATATTGG - Intergenic
1053127058 9:35590432-35590454 ATATATATACACGTATATATAGG - Intergenic
1053244414 9:36522877-36522899 GTGTATACACACATGGAAAATGG + Intergenic
1053254715 9:36606412-36606434 GTATATATATACATATGTATAGG + Intronic
1053254717 9:36606467-36606489 GTATATATATACATATGTATAGG + Intronic
1053405105 9:37867219-37867241 TTATATATACACATACATATAGG - Intronic
1053530878 9:38879553-38879575 GTGGATACACACACAATTATTGG + Intergenic
1053638304 9:40038685-40038707 GTGTATATATATATATAGATGGG - Intergenic
1053741374 9:41142473-41142495 GTGCATATAGACAGATATATAGG + Intronic
1053771393 9:41481994-41482016 TTGTATATGCACATATTTATGGG - Intergenic
1054203101 9:62103986-62104008 GTGGATACACACACAATTATTGG + Intergenic
1054346586 9:63971976-63971998 GTGCATATAGACAGATATATAGG + Intergenic
1054444363 9:65298625-65298647 GTGCATATAGACAGATATATAGG + Intergenic
1054485909 9:65722880-65722902 GTGCATATAGACAGATATATAGG - Intronic
1054635262 9:67484379-67484401 GTGGATACACACACAATTATTGG - Intergenic
1054686975 9:68288821-68288843 GTGCATATAGACAGATATATAGG - Intronic
1054703650 9:68439500-68439522 ATATATACACTCATATATATGGG - Intronic
1054841043 9:69740179-69740201 GTGTATACATATATGTATATAGG + Intronic
1054841056 9:69740388-69740410 GTGTATACACATATGTATACAGG + Intronic
1055019433 9:71653241-71653263 TTGTATATACACATATTTATTGG + Intergenic
1055369146 9:75578199-75578221 GTGCACACACACCTATCTATGGG + Intergenic
1055406895 9:75984376-75984398 GTTTATGCACACATATAGGTTGG + Intronic
1055743034 9:79410929-79410951 GTGTACACACACATACATAGTGG - Intergenic
1056139517 9:83662241-83662263 GTATATACACACACACATACAGG - Intronic
1056558940 9:87712958-87712980 GTGTATACACATGTATATATGGG + Intergenic
1056652207 9:88475676-88475698 GTATACACACATATAGATATAGG - Exonic
1056866047 9:90228152-90228174 GTGTACACACACTTCGATATTGG + Intergenic
1056916978 9:90754754-90754776 GTGTACACACACTTCGATATTGG - Intergenic
1057093154 9:92278680-92278702 GTATATACAAACAAACATATAGG + Intronic
1057639823 9:96808187-96808209 GTGTATACACATACATACAATGG + Intergenic
1057665576 9:97042463-97042485 GTGTATAAATAGATATAAATAGG - Intergenic
1057753745 9:97812863-97812885 ATATGTACACACATATATATAGG + Intergenic
1057809887 9:98249706-98249728 GTATATACACAAACATATATAGG - Intronic
1057996876 9:99827286-99827308 GTGTGTATATATATATATATGGG + Intronic
1058129759 9:101238106-101238128 ATATATACACACACGTATATAGG - Intronic
1058306641 9:103451348-103451370 ATATATATACACACATATATAGG - Intergenic
1058719917 9:107754522-107754544 ATACACACACACATATATATAGG + Intergenic
1059243002 9:112824349-112824371 GAATATACACATATATATGTTGG - Intronic
1059384227 9:113951390-113951412 GTATATATACGTATATATATAGG - Intronic
1059420602 9:114188607-114188629 ATGTATATACAAATATATCTTGG - Intronic
1059877455 9:118650966-118650988 GAGTATACACAAATATAGAATGG - Intergenic
1060231102 9:121826230-121826252 ATATACACGCACATATATATGGG + Intronic
1060338179 9:122747245-122747267 ATTTATGCATACATATATATAGG - Intergenic
1060907828 9:127323756-127323778 GTGTATATATATATATTTATGGG - Intronic
1202794639 9_KI270719v1_random:110118-110140 ATATATATACACATATATATTGG + Intergenic
1202799105 9_KI270719v1_random:157361-157383 GTATATATACATATATATGTGGG + Intergenic
1203635864 Un_KI270750v1:110334-110356 GCGTATACACACATTTGTTTAGG - Intergenic
1185654818 X:1676451-1676473 ATGTAAACACACATGTAGATAGG - Intergenic
1185740326 X:2526817-2526839 GTGCATAGACACATATTTCTAGG + Intergenic
1185786288 X:2893873-2893895 GTATATATATACATATATATGGG - Intergenic
1186038867 X:5454359-5454381 GTGCATACCTATATATATATAGG - Intergenic
1186138227 X:6542831-6542853 GTACACACACACATATATATGGG - Intergenic
1186277990 X:7961128-7961150 GTATATACAAACATATATGTAGG + Intergenic
1186310732 X:8315709-8315731 ATATATACACACATATATATAGG - Intergenic
1186853114 X:13600009-13600031 GTGTATTCACACATCTGTGTTGG - Exonic
1187329688 X:18326174-18326196 ATGCATACACACATATGTAATGG - Intronic
1187451058 X:19396718-19396740 GTGTAAACACCCATGTATCTGGG - Intronic
1187623164 X:21081389-21081411 ATGTATAGAAATATATATATAGG - Intergenic
1187735133 X:22295323-22295345 GTACATACACGCACATATATAGG + Intergenic
1187861937 X:23691319-23691341 ATATATTCATACATATATATAGG + Intergenic
1187969462 X:24645388-24645410 ATATACACACATATATATATTGG + Intronic
1187983580 X:24786063-24786085 ATGTATACACACATACAAAATGG - Intronic
1188205110 X:27346331-27346353 CCGTATACACATATATATAGGGG - Intergenic
1188280630 X:28263596-28263618 ATATATATACATATATATATAGG - Intergenic
1188453400 X:30334300-30334322 ATCTATACACACATACATACTGG + Intergenic
1188680581 X:32998596-32998618 GTGTATATATATATATAAATAGG - Intronic
1189009554 X:37033285-37033307 GTGTATATAAATATAAATATAGG + Intergenic
1189015755 X:37094868-37094890 GTGTATACACAGATTTAGCTAGG - Intergenic
1189091866 X:38091909-38091931 GAGTATATATACATATACATAGG + Intronic
1190013289 X:46804026-46804048 GTGTAGACAAGCAGATATATGGG + Intergenic
1190153821 X:47971388-47971410 ATGTATACATATATACATATAGG - Intronic
1190298277 X:49041266-49041288 GTGTGTACACACATATACCTGGG - Intronic
1190365480 X:49689838-49689860 GTGTATATACACACATATATAGG + Intronic
1190365481 X:49689872-49689894 GTGTATATACACACATATATAGG + Intronic
1190365482 X:49689906-49689928 GTGTATATACACACATATATAGG + Intronic
1190553806 X:51613597-51613619 ATGCATACACAGATATTTATTGG + Intergenic
1190576941 X:51849228-51849250 AAGCAGACACACATATATATAGG - Intronic
1190636356 X:52438370-52438392 ATATATATACATATATATATAGG - Intergenic
1190946406 X:55098340-55098362 ATGTATATATACATATATAAGGG + Intronic
1190946408 X:55098367-55098389 GTGTATATATACATATATAAGGG + Intronic
1190996364 X:55614282-55614304 ATATATATACACATATATAAAGG - Intergenic
1191079746 X:56496827-56496849 GTGTATGCACACACATATTAGGG - Intergenic
1191131493 X:57017094-57017116 ATGTATATACTTATATATATAGG - Intergenic
1191170155 X:57437919-57437941 ATGTATACACATATATACATAGG + Intronic
1191709167 X:64130520-64130542 GTATTTACATATATATATATAGG + Intergenic
1191941621 X:66487135-66487157 GTATACACACACACATATAAAGG + Intergenic
1192753835 X:74024426-74024448 GTATATATGTACATATATATGGG - Intergenic
1192899009 X:75474430-75474452 GTGTATATATATATATATAAAGG - Intronic
1193162892 X:78247650-78247672 GTATAAAAACACATATATGTAGG + Intergenic
1193349170 X:80438304-80438326 GTGTAAACACACAGATTTCTGGG - Intronic
1193370208 X:80687085-80687107 ATATATACACACATACAGATAGG - Intronic
1193422639 X:81301646-81301668 GTTTATAAAAACATATATAAAGG - Intergenic
1193503044 X:82304038-82304060 ATATATACACACATACACATTGG + Intergenic
1193537660 X:82733290-82733312 GTATATACATGCATATATAGTGG - Intergenic
1194107542 X:89790398-89790420 GTATATATATATATATATATAGG - Intergenic
1195580463 X:106494923-106494945 GTGTATACAGTTATATACATAGG - Intergenic
1196219353 X:113093895-113093917 GTGTATATATATATATATAGTGG + Intergenic
1196409746 X:115403796-115403818 ATGTATATATACATATATGTAGG - Intergenic
1196409747 X:115403822-115403844 ATGTATATATACATATATGTAGG - Intergenic
1196409748 X:115403848-115403870 ATGTATATATACATATATGTAGG - Intergenic
1196492429 X:116283939-116283961 GTGTGTATATATATATATATAGG - Intergenic
1196492433 X:116284043-116284065 GTGTATATATATATATATATAGG + Intergenic
1196755905 X:119156800-119156822 GTGTATATATACATACATGTAGG - Intergenic
1196992223 X:121342907-121342929 GTGGGAACACACATACATATGGG + Intergenic
1197418815 X:126210671-126210693 ATATATATACACATATATATCGG + Intergenic
1197621619 X:128756776-128756798 ATATATACACACCTATATATCGG + Intergenic
1197659420 X:129154074-129154096 ATATATATACATATATATATGGG - Intergenic
1197659422 X:129154100-129154122 ATATATATACATATATATATGGG - Intergenic
1197659424 X:129154126-129154148 ATATATATACATATATATATGGG - Intergenic
1197875973 X:131107066-131107088 GTGCATGCACACACACATATGGG + Intergenic
1198140072 X:133793655-133793677 GGTTTTACACACAAATATATAGG - Intronic
1198244916 X:134821086-134821108 GTGTATATATATATATATATGGG + Intronic
1198692947 X:139304023-139304045 TTATATATACACAGATATATAGG + Intergenic
1198778887 X:140212963-140212985 GTGTATATACATATATGTATGGG - Intergenic
1198778890 X:140213004-140213026 ATGTATATACATATATGTATGGG + Intergenic
1198790955 X:140345388-140345410 ATATATACACATATATATATGGG + Intergenic
1198852268 X:140977528-140977550 GTGTATATATACACATATGTAGG + Intergenic
1199018177 X:142844484-142844506 GTATATACACATATACACATAGG + Intergenic
1199038984 X:143088025-143088047 TTATACACACACACATATATAGG - Intergenic
1199235232 X:145485167-145485189 ATGTATATGTACATATATATAGG + Intergenic
1199518300 X:148704215-148704237 ATATACACACATATATATATAGG - Intronic
1199891794 X:152091305-152091327 GCATATATTCACATATATATGGG - Intergenic
1199926215 X:152467360-152467382 ATATACACACACATATATAATGG + Intergenic
1200469448 Y:3564876-3564898 ATATATACACACCTATATATGGG + Intergenic
1200786949 Y:7269157-7269179 GTGTGTATATATATATATATGGG - Intergenic
1201517266 Y:14831569-14831591 GTATATACACAGAAATATACTGG - Intronic
1201650992 Y:16286005-16286027 ATATATACACACATATATCCTGG - Intergenic
1202188097 Y:22209522-22209544 ATATACACACACATATATGTTGG + Intergenic
1202339625 Y:23849159-23849181 GAGTATACATATATATATACAGG + Intergenic
1202531141 Y:25820917-25820939 GAGTATACATATATATATACAGG - Intergenic