ID: 960555092

View in Genome Browser
Species Human (GRCh38)
Location 3:119019539-119019561
Sequence TCTTGAAGTAAAGCAGGACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 179}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960555092_960555094 -2 Left 960555092 3:119019539-119019561 CCTTGTCCTGCTTTACTTCAAGA 0: 1
1: 0
2: 1
3: 20
4: 179
Right 960555094 3:119019560-119019582 GACAGTATCTTCCTGCATGAAGG 0: 1
1: 1
2: 1
3: 9
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960555092 Original CRISPR TCTTGAAGTAAAGCAGGACA AGG (reversed) Intronic
901447788 1:9318759-9318781 TCTGGATGTACAGCAGGACAGGG + Intronic
902101260 1:13991758-13991780 TGTTGAAGGAAAGGAGGGCAGGG - Intergenic
903835461 1:26200749-26200771 TCCTGAAGCCAAGCAGGAAAAGG + Intronic
905584161 1:39104694-39104716 CCATGAAGTAAACCAGGCCAAGG - Intronic
907746277 1:57216844-57216866 ACTTGACGTAAGGCAGGACTGGG + Intronic
910039676 1:82834558-82834580 TGTTGAATGAAAGCAGGAAAAGG - Intergenic
911745136 1:101433621-101433643 ACTAGAAGTAAACCAGGAGATGG + Intergenic
913268284 1:117066605-117066627 TGTTTACGTTAAGCAGGACAAGG + Intronic
914807898 1:151005150-151005172 GCTTGAAGAAAAGCAGGCCTTGG + Intronic
914833510 1:151188681-151188703 GCTTGATGAAAAGCAGGAGAAGG - Intronic
916541217 1:165756339-165756361 TCTTGAGAAAAAGCTGGACAGGG - Intronic
918250806 1:182701463-182701485 TCTCAAAGGAAAGCTGGACATGG - Intergenic
920194446 1:204217557-204217579 TCTTGAAGACAGGCACGACAGGG - Intergenic
920519450 1:206612543-206612565 CCTGGAACTAAAGCAGGGCAGGG + Intergenic
921226867 1:213029306-213029328 TTTGGAATTAAAGCAGGAGAAGG + Intergenic
921839053 1:219809001-219809023 TCATTAAGCAAAGCAGGACTGGG - Intronic
921970432 1:221142568-221142590 TCTTGAAGTAAAGCCAGAGAAGG - Intergenic
922460038 1:225808928-225808950 TCTTGCAGTACTGCCGGACAGGG - Intergenic
923279556 1:232430100-232430122 TAGTGAAGTTAAGCAGGACAGGG + Intronic
923598162 1:235377095-235377117 TATTTAAATAAAGGAGGACAGGG - Intronic
1067037705 10:42932250-42932272 CCTTGAAGTAAGGCAGGACAAGG + Intergenic
1067933347 10:50585938-50585960 TTATGAAGTAAAGCAGGAGCTGG + Intronic
1072016001 10:91347135-91347157 GCTTGAGGTAAAGAAGGGCATGG - Intergenic
1074072136 10:110082957-110082979 TCTTAGAATAAACCAGGACAGGG - Intronic
1082974198 11:59056201-59056223 TATTGAGGTAAAGGAGGAAACGG - Intergenic
1082978609 11:59099998-59100020 TATTGAGGTAAAGGAGGAAATGG - Intergenic
1085893475 11:80609129-80609151 TCTTGAAGTAAACCAGGGTCAGG + Intergenic
1086381216 11:86256759-86256781 TCTCAAAGTAAACCATGACAAGG - Intronic
1087025122 11:93642097-93642119 TCTTGAAGAAAAGTGGTACAGGG + Intergenic
1087606370 11:100383512-100383534 GAATGAAGAAAAGCAGGACAGGG + Intergenic
1088173933 11:107029459-107029481 TATTGAATTAAAGCAGGATATGG + Intergenic
1088996822 11:115007803-115007825 TCTTGAAGTAGAGCTGGAGTTGG - Intergenic
1089194367 11:116685124-116685146 TCTTGAAATTAAGTAGTACAAGG - Intergenic
1089875894 11:121722189-121722211 TCTTGAGGTAAAGAAGGAGAGGG - Intergenic
1092949750 12:13490512-13490534 CCTTGAAGTAAGGCAAGGCATGG + Intergenic
1092996627 12:13957271-13957293 TTTTGATGTAATGCAGGATATGG + Intronic
1093375732 12:18425328-18425350 TTTTGAAGTAAAGAAGGAAATGG + Intronic
1095564345 12:43603786-43603808 TCTTGGTGTAAAGCAGGAAATGG + Intergenic
1096718758 12:53506106-53506128 TCTTGAGGTACTGCAGGGCACGG - Exonic
1097203486 12:57299949-57299971 TGTTGTAGTAAAACAGGGCATGG - Intronic
1097444700 12:59655795-59655817 TCTTGGTCTAAAGCAGGTCAGGG + Intronic
1098932616 12:76437593-76437615 TCTTGAAGAAAAGCAGAACCAGG - Intronic
1099958279 12:89372498-89372520 ACCTGAACTAAAGCAGGAGAAGG + Intergenic
1100721073 12:97358729-97358751 TCTTGACAAGAAGCAGGACATGG + Intergenic
1100934544 12:99648156-99648178 TCTTGATTTAAAGGAAGACATGG + Exonic
1101700257 12:107167216-107167238 TAGTAAAATAAAGCAGGACACGG - Intergenic
1106677006 13:31971084-31971106 TCTTGGAGTTAATTAGGACAAGG - Intergenic
1108546643 13:51501794-51501816 TCTTGAAGGACAGCAGGGCTTGG - Intergenic
1110166567 13:72449661-72449683 TCTTGGAGTAAAGCAGGATGTGG - Intergenic
1111400168 13:87723385-87723407 TCTAGAAGTAGAGCATGAAATGG - Intergenic
1116253405 14:42516853-42516875 CCTTAAAGTAAAGCAGGTAAAGG - Intergenic
1117904559 14:60570930-60570952 TCTTGAAGTAAGGCATGGCAAGG + Intergenic
1118697432 14:68398446-68398468 TCTTGAAGCAATGCAGGTCAAGG + Intronic
1123117432 14:105900986-105901008 TCTTGCAGAAATGCAGGACAGGG + Intergenic
1123119521 14:105910253-105910275 TCTTCCAGAAATGCAGGACATGG + Intergenic
1124137106 15:27044290-27044312 TCTAGAAGTAAAACCAGACATGG + Intronic
1127684174 15:61325660-61325682 TCTTCAGGTAAAGGATGACAAGG + Intergenic
1128061428 15:64738158-64738180 TCTGGAAAGAGAGCAGGACAGGG + Intergenic
1129069589 15:72939617-72939639 TTTTAAAGTAATGCAGTACATGG + Intergenic
1134812853 16:17182026-17182048 GCTTGAAATAAAGCAGTACCTGG + Intronic
1139060746 16:63248375-63248397 TCTTGAAGGAAACCAGAGCAGGG + Intergenic
1140150559 16:72359929-72359951 TCAGGAAGTAGAGCTGGACATGG - Intergenic
1142319775 16:89373630-89373652 TCGTGAAGTAAAGCAGCTCGTGG - Intronic
1147700994 17:42394874-42394896 ACTGGAAGAAAAGAAGGACATGG - Intergenic
1148695417 17:49555592-49555614 TCTTGGAATGAAGCAAGACACGG + Intergenic
1149019610 17:51948066-51948088 ACTTCAAGTAAAGGAGGCCAAGG + Intronic
1150149118 17:62794354-62794376 TATAGAAGTAAACCAGGAAATGG - Intronic
1151145250 17:72034508-72034530 TCAGGAAATAAGGCAGGACAAGG + Intergenic
1152989139 18:346856-346878 TCTTCAAGCCAAGAAGGACACGG - Exonic
1155623268 18:27806021-27806043 TCTTGATGGAAAACAGGAAATGG - Intergenic
1156451648 18:37269874-37269896 CCAAGAAGTAGAGCAGGACATGG - Intronic
1156602782 18:38630119-38630141 CCATGAAGTAATGCAGGAGAAGG + Intergenic
1157869743 18:51218954-51218976 TCTTTAAGTAATGGAGGCCAGGG + Intergenic
1159573494 18:70146909-70146931 TCTTGAGGTAACTCAGGAAATGG - Intronic
1159791787 18:72790783-72790805 TCTTAAAATAAAAAAGGACATGG - Intronic
1163923045 19:20311319-20311341 TCTAGAAATAAAGAAGGAAAGGG - Intergenic
1165064390 19:33220506-33220528 TCTGGAAGTCAAGCAAGATAAGG - Intronic
925319649 2:2952285-2952307 TCTGGAAGCAAAGGAGGAGAAGG - Intergenic
925349649 2:3191903-3191925 TCTAGAAGTGAAGTAGGACCCGG + Intronic
928257219 2:29733209-29733231 ACATGAAGTAAAGCAGGATCAGG + Intronic
929787999 2:45005766-45005788 TCTAGAAGGAAAGCAATACAAGG + Exonic
931204827 2:60137066-60137088 TCTTGAAGCCAAGCGGGGCAGGG - Intergenic
931468449 2:62513443-62513465 TCTGGAGGTAAAGGAGGAAAAGG + Intergenic
931611507 2:64106282-64106304 TCTAGAAGTGAAGCTGGACAAGG - Intronic
932957912 2:76377003-76377025 TCTTGAATTAAACTAGGCCAGGG - Intergenic
935253607 2:101288151-101288173 GCTTGAAGGAAGGCAGGGCATGG - Intronic
935356882 2:102209600-102209622 TCATGGAGTTAAGCAGGGCAAGG + Intronic
939948915 2:148445087-148445109 TTTTGAACCAGAGCAGGACAGGG - Intronic
940497911 2:154457365-154457387 TGCTGAAGAAAAGCAAGACAGGG - Intergenic
940849281 2:158672808-158672830 TCATGAAGTGGAGGAGGACAAGG - Intronic
941863278 2:170307569-170307591 CCTTGAAGTGTTGCAGGACAGGG + Intronic
942057238 2:172195973-172195995 TCTGGCAGTAGGGCAGGACATGG + Intergenic
943036467 2:182752081-182752103 TCTGGTAGTAAAGCTCGACATGG - Exonic
945746346 2:213723621-213723643 TCTTGAAGCAAAGGAAGACCTGG - Intronic
947351648 2:229252647-229252669 TCTGGAAGTAAGGCAGGCTAGGG - Intronic
948026522 2:234782381-234782403 TCTTTGAATATAGCAGGACAGGG - Intergenic
948194668 2:236086412-236086434 TCTTTAAGAAGAGCAGTACAAGG + Intronic
1170662169 20:18352646-18352668 TGTTGAAGAAAACCAGGACGGGG - Intergenic
1171248381 20:23631479-23631501 TCTTGCAGCCACGCAGGACACGG + Intronic
1174706584 20:52662441-52662463 TTTTGAAGAAAAGAAGGACCAGG - Intergenic
1176720395 21:10388018-10388040 ACTTGAAGTGAAGAAGGAGAAGG + Intergenic
1178761663 21:35408849-35408871 TCTAGAAGTCAAGAAGGAAAAGG - Intronic
1180104341 21:45608055-45608077 CCCTGAAGTCAAGTAGGACACGG - Intergenic
1180301591 22:11040771-11040793 ACTTGAAGTGAAGAAGGAGAAGG + Intergenic
1181440593 22:22933472-22933494 TCCTGAAGTAAAGCAAGCAAGGG + Intergenic
1182450122 22:30415057-30415079 CATTGAAGTACAGCAGGAGAGGG - Intronic
1182722096 22:32411540-32411562 TCTTGCAGTAGCGCAGGGCAGGG - Intronic
1184297425 22:43533734-43533756 TCTTGAAGTAACGGAGCAAATGG + Intronic
949501380 3:4683437-4683459 TCGTCAAGTGGAGCAGGACACGG - Exonic
950763638 3:15257022-15257044 TCCTGAACTAAAGCTGGACACGG + Exonic
954753961 3:52829017-52829039 TCTTGAAGTAAGGCATGCCAGGG - Intronic
954905870 3:54062318-54062340 CCTAGAAGTAGAGCAGGAGAGGG - Intergenic
957057263 3:75453313-75453335 CCTTGAAGGGACGCAGGACAAGG + Intergenic
957354674 3:79066209-79066231 TCATAAAGTAAGGCAGGAAAAGG + Intronic
960529676 3:118749088-118749110 TTTTCAAGAAAAGCAGCACATGG + Intergenic
960555092 3:119019539-119019561 TCTTGAAGTAAAGCAGGACAAGG - Intronic
960787007 3:121384549-121384571 TCTAGAAGTAAGAGAGGACATGG + Intronic
960963490 3:123089066-123089088 TCTGGAAGTAAAGCAGCTCTAGG + Intronic
961296187 3:125886422-125886444 CCTGGAAGGGAAGCAGGACAAGG - Intergenic
961324584 3:126102742-126102764 TCATAAAGGAAAGCAGGGCAGGG + Intergenic
965016259 3:163161294-163161316 TCATGAAGTAAGGCTGGGCACGG - Intergenic
965692005 3:171367434-171367456 TCTTTAAGTAAATCAACACAAGG + Intronic
966311466 3:178598759-178598781 TGTTGAAGTTAAGCATGACTGGG + Intronic
967399395 3:189043708-189043730 TCTTGAATTGAAGGAGGGCACGG + Intronic
967684116 3:192399807-192399829 CCTAGAAGTAAAGAATGACATGG - Intronic
967704011 3:192629308-192629330 TTCTGCAGTAATGCAGGACAAGG - Intronic
972316988 4:37935869-37935891 TCTAGAAGTAAGACAGAACATGG - Intronic
973008715 4:45045195-45045217 TTTGGAATTAAAGCAGGAGAAGG - Intergenic
975256605 4:72243829-72243851 GCTTGAAGGCAAGCAAGACACGG - Intergenic
975772207 4:77738265-77738287 ACTTGAAATAAAGCATGATAAGG + Intronic
977613562 4:99062148-99062170 CCTTGAAGTAAAACAGAAAAGGG - Exonic
977658199 4:99549129-99549151 ACATGAAGAAAAGCAGGATAAGG - Exonic
978349175 4:107803368-107803390 TCTGGAAGTAGAGCAGGAGAAGG + Intergenic
978702563 4:111666074-111666096 CCTTTAACTAAAGCAGGGCAAGG + Intergenic
982285606 4:153730559-153730581 TCTGGTAGTAAAGAAGGAAATGG + Intronic
983873933 4:172854150-172854172 GCTTGAAGAAAGGTAGGACAAGG - Intronic
984270658 4:177545156-177545178 TGTTGAAGTGAAGCAGGATAGGG + Intergenic
984635803 4:182107780-182107802 TCTTGAAGTTAAGCATCATAAGG - Intergenic
985695973 5:1340353-1340375 ACATGAAGTTAAACAGGACATGG + Intronic
985874754 5:2586221-2586243 TCGTCCAGTAAAGGAGGACAAGG - Intergenic
986389686 5:7273130-7273152 TCTAGAAGAAAATGAGGACAAGG - Intergenic
993101408 5:83544938-83544960 ACTTGAAGAAAAGCAACACATGG - Intronic
995156076 5:108915008-108915030 AGTTGAAGTAAAGTAGGATATGG + Intronic
996613473 5:125412085-125412107 TCTTGGAGTGAAACAGGAGAAGG + Intergenic
997794371 5:136793974-136793996 TCTTGGAGTCCAGTAGGACAGGG + Intergenic
999217352 5:149946433-149946455 TCTGGAAGTTAAGAAGGAGATGG - Intergenic
1000006094 5:157186326-157186348 TCTTGAAGTGAATAAAGACAAGG - Intronic
1003965452 6:11248560-11248582 TCTTGGAGAACAGCTGGACAGGG + Intronic
1009508644 6:64519309-64519331 TCTTGAGGAAAAAAAGGACAGGG + Intronic
1009978059 6:70694417-70694439 TCTTCAAGTACATCAGGATATGG - Intronic
1010735674 6:79441560-79441582 GCTTGAACTAAAAAAGGACATGG - Intergenic
1011802589 6:91034411-91034433 TCTTGAAGTCACACAGGATAAGG + Intergenic
1015926524 6:138315365-138315387 TCTAGATGTAGAACAGGACAGGG - Intronic
1016336090 6:143006633-143006655 TCTTGATGTAAATTAGCACATGG + Intergenic
1016634570 6:146272795-146272817 GCCTGTAGTAAAGCAGGACAGGG + Intronic
1019757930 7:2787247-2787269 TCTTGAAGTAATGTAGGTGACGG - Intronic
1021523373 7:21558842-21558864 TTGTGAAGTAAAACAGGACCAGG - Exonic
1023959262 7:44913031-44913053 TCAGGAAGGAAAGCAGGAAATGG + Intergenic
1024982534 7:55169761-55169783 CCTTGAAGAGAAGCTGGACAAGG - Intronic
1027470288 7:78565093-78565115 TGTTGAAGAAAAGAAGGTCAAGG - Intronic
1027853752 7:83482784-83482806 TCTTGGAATAAGGAAGGACAAGG + Intronic
1028269975 7:88776493-88776515 TCTTGAATTAAAGCTGTACCAGG - Intronic
1028721070 7:94032253-94032275 TTTTCAAGGAAAGCAGGATATGG + Intergenic
1030081159 7:105779449-105779471 ACTTGAAGTGAAGCAAAACATGG + Intronic
1032734650 7:134680742-134680764 TCTTGAAGTACATTAAGACATGG - Intergenic
1034878655 7:154747265-154747287 CTTTGAAGTAAAGCAGTACAAGG - Intronic
1035397703 7:158546124-158546146 TCATGCAGAAAAGCAGGACTGGG + Intronic
1039575286 8:38618677-38618699 TCTTAAACCAAAGAAGGACATGG - Intergenic
1040398904 8:47028047-47028069 TCCTGAAGTATGGCATGACAAGG - Intergenic
1043539504 8:81243664-81243686 TATGGAAGAAAAGCAGGCCAGGG + Intergenic
1044073882 8:87794554-87794576 TAATGAAATAAAGCAAGACAAGG + Intergenic
1044157323 8:88863573-88863595 TCTTCAAGAAATGCAGTACAAGG + Intergenic
1045053457 8:98347987-98348009 TCTTGAAGTTAAGCAGTATCAGG - Intergenic
1046224507 8:111260433-111260455 TCTTGATGGAAAGAAGCACAGGG - Intergenic
1046870568 8:119200992-119201014 ACGGTAAGTAAAGCAGGACAAGG - Intronic
1047574372 8:126136721-126136743 TCTTTAAGTCATGCAGGACTTGG - Intergenic
1048172122 8:132117311-132117333 TGTTGAGGTAACGCAGGATATGG - Intergenic
1048403842 8:134098133-134098155 TCTTTAAATGAAGCAGAACAAGG - Intergenic
1048835420 8:138514423-138514445 TCTTGAAGTAAAGGTGAACCAGG - Intergenic
1049753333 8:144296185-144296207 CCCTGAAGTAAGGCAGGGCAGGG + Intronic
1050228811 9:3493934-3493956 AGATGAGGTAAAGCAGGACATGG - Intronic
1051071905 9:13179878-13179900 TATTGAAGAAAAGCAGGTTATGG - Intronic
1052235437 9:26208072-26208094 ACTAGAAGAAAAGAAGGACATGG + Intergenic
1055400255 9:75916135-75916157 TCTTAAAGTTAATCAGGTCAGGG + Intronic
1056482395 9:87018816-87018838 ACTTGAAGTTCATCAGGACATGG + Intergenic
1056778484 9:89531865-89531887 ACTTGGAGTACAGCAGGACCTGG + Intergenic
1057279486 9:93699614-93699636 TCTTGAAACAAATGAGGACATGG + Intergenic
1057744340 9:97739538-97739560 CATGGAAGTAAAGCAGGAGAGGG - Intergenic
1058785250 9:108380763-108380785 TCTGGAAATAGAGCTGGACAAGG - Intergenic
1058932745 9:109737583-109737605 GGTTGAAGGAAAACAGGACAAGG + Intronic
1060589173 9:124805229-124805251 CCTTGGACCAAAGCAGGACAGGG - Intronic
1061632382 9:131881145-131881167 TATTAAAGCAAAGCAAGACAAGG + Intronic
1185540512 X:899578-899600 ACTTGAAGTGAAGAAGGAGAAGG - Intergenic
1187138255 X:16569368-16569390 TCTTGAAGAGAAAAAGGACATGG - Intergenic
1189149733 X:38693934-38693956 TTTTCTTGTAAAGCAGGACAAGG + Intergenic
1190942603 X:55056791-55056813 TATTGAAATAAATGAGGACAGGG - Intergenic
1194857694 X:98954538-98954560 TCTTGCAGTAAAGAAAAACATGG - Intergenic
1195504914 X:105645951-105645973 ACTTGAAGTAAAGAAGGGCAAGG - Intronic
1196200231 X:112878505-112878527 TCTCTAAATAAATCAGGACATGG + Intergenic
1198063791 X:133075368-133075390 ACTTGAAATAACTCAGGACAAGG - Intronic
1199150842 X:144484919-144484941 TGATGAAATAAAGCAGGAAATGG + Intergenic