ID: 960555937

View in Genome Browser
Species Human (GRCh38)
Location 3:119030727-119030749
Sequence CAGATCCTCCAGATGGTGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 232}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960555933_960555937 12 Left 960555933 3:119030692-119030714 CCAGTTGCTCACAAAGTATGGTC 0: 1
1: 0
2: 2
3: 30
4: 190
Right 960555937 3:119030727-119030749 CAGATCCTCCAGATGGTGTGGGG 0: 1
1: 0
2: 2
3: 26
4: 232
960555930_960555937 30 Left 960555930 3:119030674-119030696 CCAACAACCTCTCTTAAGCCAGT 0: 1
1: 0
2: 0
3: 9
4: 121
Right 960555937 3:119030727-119030749 CAGATCCTCCAGATGGTGTGGGG 0: 1
1: 0
2: 2
3: 26
4: 232
960555931_960555937 23 Left 960555931 3:119030681-119030703 CCTCTCTTAAGCCAGTTGCTCAC 0: 1
1: 0
2: 0
3: 8
4: 90
Right 960555937 3:119030727-119030749 CAGATCCTCCAGATGGTGTGGGG 0: 1
1: 0
2: 2
3: 26
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960555937 Original CRISPR CAGATCCTCCAGATGGTGTG GGG Intronic
900525746 1:3127794-3127816 CAGAGCGTCCCCATGGTGTGGGG + Intronic
900792630 1:4690202-4690224 CAGACCCTCCAGGAGGTTTGTGG + Intronic
903292947 1:22326196-22326218 CAGCCCCTCCAGCTGGAGTGTGG + Intergenic
904592638 1:31623566-31623588 CAGGTCCCCCAGCTGGTCTGAGG - Exonic
904675939 1:32199350-32199372 CAGATCCTCTGGAGGGTGTGGGG + Intergenic
904758017 1:32779985-32780007 CAGAGCTTCCACCTGGTGTGTGG + Intronic
906919480 1:50048382-50048404 CAGAGCCGCCAGATGGGCTGCGG - Intronic
907677386 1:56531207-56531229 CAGATGCTGCAGATTGTCTGAGG - Intronic
908326401 1:63028097-63028119 CAGTTTCTCCACATGGTGGGAGG - Intergenic
908525676 1:64985404-64985426 GAGATCCTCCAGTGGTTGTGGGG - Intergenic
908746564 1:67382237-67382259 CAGATCCTCCTGATTGTATGGGG + Intronic
911301168 1:96176147-96176169 CTGACCCTACAGATGGCGTGGGG + Intergenic
911613154 1:99979244-99979266 CAGAGCAACCAGATGGAGTGAGG - Intronic
913339869 1:117747733-117747755 CACTTCCTTCAGAGGGTGTGTGG + Intergenic
915782202 1:158564634-158564656 AAGAGCCTCCAGAGGGAGTGCGG + Intergenic
916001027 1:160615917-160615939 TAAAGCCTCCAGATGGAGTGTGG + Intronic
916263594 1:162868494-162868516 CACTTCCTCCAGAGGGTCTGTGG - Intronic
916858253 1:168774429-168774451 CAGCTCAGCCAGCTGGTGTGAGG + Intergenic
917665919 1:177225563-177225585 CAGTTCCACCAGAAGTTGTGAGG + Intronic
918077309 1:181180517-181180539 CAGCTGATCCAGATGGTCTGTGG - Intergenic
918083396 1:181224532-181224554 TAGAGCCTCCAGAGGGAGTGTGG + Intergenic
918151359 1:181800136-181800158 CAGATTCTGCAGCTGGTGTGGGG + Intronic
918308417 1:183267870-183267892 CTGATCCTGCCCATGGTGTGGGG - Intronic
920436188 1:205948500-205948522 CAGATCCTAGAGATAGGGTGAGG - Intergenic
920825778 1:209423203-209423225 CAGATTTTCCAGTGGGTGTGGGG - Intergenic
921078391 1:211718829-211718851 TAGATCCTCCAGAGGGAGGGTGG - Intergenic
921670683 1:217920711-217920733 TAGAGCCTTCAGAGGGTGTGTGG + Intergenic
924274540 1:242372258-242372280 GAGATCATCCTGCTGGTGTGTGG - Intronic
924691421 1:246355442-246355464 CAGTTCCTTCAGAGGGTCTGTGG - Intronic
1062884231 10:1004460-1004482 CAGCTCCTCCCCATGGTATGTGG + Intronic
1064797659 10:19031545-19031567 CAGGTCCTCCATATGTCGTGTGG + Intergenic
1067718366 10:48707297-48707319 AAGAGCCTTCAGATGCTGTGGGG + Intronic
1068878360 10:62022217-62022239 GAGGTTCTCTAGATGGTGTGCGG + Intronic
1069636634 10:69929207-69929229 CAGAGCCTTCTGATGCTGTGGGG + Intronic
1070333277 10:75432749-75432771 CAGCTCCTACAGATGCAGTGAGG + Intronic
1076125874 10:127973479-127973501 CAGATCAGCCAGTTGTTGTGGGG + Intronic
1076705110 10:132297218-132297240 CATGTCCTGCAGAGGGTGTGGGG - Intronic
1077303286 11:1856799-1856821 CACATCCTCCAGGTGGTGCCTGG - Intronic
1077503408 11:2919393-2919415 GGGCTCCTCCAGATGGTGAGTGG + Exonic
1077987213 11:7365209-7365231 GAAATCCTCAAGATGGGGTGGGG + Intronic
1078363893 11:10691342-10691364 CTGCTCCTCCAGGAGGTGTGGGG + Intronic
1079383625 11:19959870-19959892 CAGACAGTCCAGATGGTGGGGGG - Intronic
1081906710 11:46674906-46674928 CAAATCCCCCAGATGGCTTGGGG - Intergenic
1084937776 11:72596204-72596226 GGGATCCTCCAGATGGGGTGGGG - Intronic
1085623556 11:78055241-78055263 CAGATCATCCAGATACTCTGGGG + Intronic
1086074165 11:82832343-82832365 CAGATACTGGAGAGGGTGTGGGG - Intronic
1086074254 11:82833444-82833466 CAGATACTGGAGAGGGTGTGAGG + Intronic
1086544742 11:87954642-87954664 CTGATCCTCTTGATGGTGTGTGG - Intergenic
1086934366 11:92728704-92728726 CAGAACCTCCAGAGGGTGCCTGG - Intronic
1088198613 11:107304810-107304832 TAGACCCTCCAGATGGAGTGTGG + Intergenic
1088887809 11:114021309-114021331 GAGGTCCTACAGATGGTCTGGGG - Intergenic
1088972741 11:114787947-114787969 CAGATCCTCCAGGGGGTGACAGG - Intergenic
1090174824 11:124639209-124639231 CACATCCTACAGTTAGTGTGTGG + Intronic
1090353805 11:126125609-126125631 AAGATCCCCCAGCTGGTGAGTGG + Intergenic
1090746566 11:129710290-129710312 CAGATCCTCCAGCAGGTGATGGG - Intergenic
1091612775 12:2025274-2025296 CAGCTCTTCCAGATGTTCTGTGG - Intronic
1091984623 12:4898950-4898972 CATACCTTCCAGATGATGTGGGG + Intergenic
1096470559 12:51872735-51872757 AAGATCACCCAGCTGGTGTGTGG - Intergenic
1102868591 12:116394245-116394267 CAGAGCCTCCAGAGGCAGTGTGG - Intergenic
1104177702 12:126348997-126349019 CAGTTCCTCCAAATGATGTATGG - Intergenic
1105251452 13:18702164-18702186 CAGTTCCTGCAAATGGTGTGGGG + Intergenic
1105885294 13:24636891-24636913 CAAATCCTCCAGCTGCGGTGAGG - Intergenic
1107022212 13:35763982-35764004 GACTTCCTCCAGATGGTGTCTGG + Intergenic
1107756135 13:43623609-43623631 CACTTCCTTCAGAGGGTGTGTGG + Intronic
1112352425 13:98647258-98647280 CAAATCACCCAGATGGTGAGTGG - Intergenic
1112947639 13:104950897-104950919 CTGATCCTCCAGCTGGAGTCTGG - Intergenic
1113644246 13:111981171-111981193 CAGCTCCTCCTGAGGCTGTGGGG + Intergenic
1114216865 14:20663699-20663721 CAGACCCTGCAGCTGGTCTGCGG - Intergenic
1114541240 14:23461093-23461115 TAGAGCCTCCAGAGGGAGTGTGG + Intergenic
1114727330 14:24953061-24953083 TAGTGCCTCCAGATGGAGTGTGG - Intronic
1115745863 14:36436975-36436997 AAGATACTGCAGATGGTATGAGG - Intergenic
1117239554 14:53815943-53815965 CAGATCCTGGAGAGGATGTGGGG - Intergenic
1117741596 14:58824535-58824557 CTGATCTGCCAGATGGTTTGGGG - Intergenic
1118596701 14:67441233-67441255 CTGATCCTCCAGGTCCTGTGAGG + Intergenic
1120841409 14:89088712-89088734 CAGATGCTGCAGATACTGTGGGG + Intergenic
1121459716 14:94065615-94065637 CAGTTCCTTCAGAGGGTCTGTGG - Intronic
1121476615 14:94213753-94213775 CAGAGCCTCTAGATGGAATGTGG + Intronic
1121613649 14:95298293-95298315 CAGATCTGCCAGAAGGTGAGTGG + Intronic
1121880685 14:97498029-97498051 CAGCTCCTGCAGATGGACTGGGG - Intergenic
1125677027 15:41507576-41507598 CTGAGCCTCCTTATGGTGTGTGG - Exonic
1125729218 15:41883351-41883373 CAGCTCCTCCAGCTGGTGGGAGG + Exonic
1131182650 15:90250945-90250967 CAGCTCCTCCAGATGTTGAAGGG - Intronic
1131629200 15:94157986-94158008 TAGAGCTCCCAGATGGTGTGGGG - Intergenic
1132418917 15:101647519-101647541 CAGAAGCACCACATGGTGTGTGG + Intronic
1133330035 16:4967185-4967207 TAGAGCCTCCAGAGGGAGTGTGG - Intronic
1134232560 16:12439942-12439964 CAAACCGTCCAGCTGGTGTGTGG + Intronic
1135269220 16:21054479-21054501 CAGATTGTCCAGCTGGTGCGAGG - Exonic
1135569935 16:23541456-23541478 CTGATCCTCAAGATGGTAAGCGG + Intronic
1135992417 16:27226108-27226130 CAGATCCTGCAGGTGGCGTGTGG + Intronic
1137665928 16:50248998-50249020 CAGATACTGCAGACTGTGTGTGG + Intronic
1138433516 16:56984166-56984188 CAGATCCTGAGGATGGTGGGAGG + Intergenic
1139036227 16:62949927-62949949 CAGAGCCTCCAGAGAGTGAGAGG - Intergenic
1142075552 16:88115655-88115677 CAGAGCCTCCAGAGGGAGTACGG - Intronic
1142759191 17:2033615-2033637 TGGATCCTCCAGATGGTCTTGGG - Exonic
1143343448 17:6232147-6232169 CAGACCCTCCAGATTGTGATGGG + Intergenic
1143426440 17:6843010-6843032 CAGCACCTCCAGCTGGGGTGAGG + Intergenic
1145999274 17:29121688-29121710 CAGATCCTCCAGACGGTCGCAGG + Exonic
1146486646 17:33248616-33248638 TGGAGCCTCCAGAGGGTGTGTGG - Intronic
1147313777 17:39609312-39609334 CAAATGCTCCAAATGGGGTGTGG - Intronic
1148048423 17:44758015-44758037 CAGATACCTGAGATGGTGTGGGG - Intergenic
1149419611 17:56496473-56496495 TAGAGCCTCCAGAGGGAGTGTGG - Intronic
1149420532 17:56506507-56506529 TAGAACCTCCAGAGGGAGTGTGG + Intronic
1149913578 17:60587906-60587928 GAATTCCTCCAGATGGTTTGGGG - Intergenic
1150639933 17:66942668-66942690 CAGATCATTCAGCTGGTGGGAGG - Intergenic
1153815255 18:8785346-8785368 CTGATCCTCCAGTGGGAGTGGGG - Intronic
1155055278 18:22176949-22176971 CAGGTCCTCCAGCAGGTCTGCGG - Exonic
1155621537 18:27785741-27785763 CAGATGTTCCAGAAAGTGTGAGG - Intergenic
1157698646 18:49745308-49745330 CAGATGCCCCAGCTGCTGTGTGG + Intergenic
1158941789 18:62411565-62411587 CTGAGCCTCCAGAAGGAGTGTGG - Intergenic
1159978020 18:74740134-74740156 GAGAACCTCCAGAGGGAGTGTGG - Intronic
1162584033 19:11548152-11548174 CAGATCTTCCAGCTGATGCGTGG + Intronic
1163400300 19:17088119-17088141 TAGAGCCTCCAGAGGGAGTGTGG - Intronic
1163489396 19:17607993-17608015 CAGCTACTCCAGAGGGTGAGGGG - Intronic
1165732564 19:38155705-38155727 CAGCTCCCCCAGATGCTGTGGGG + Intronic
1166368484 19:42289169-42289191 CCTATCCTGCAGATGGTGTCTGG + Exonic
1167180741 19:47901535-47901557 CAGAGCCTCCAGAGGGAATGTGG + Intergenic
1167950090 19:53019487-53019509 AGGATCCTCCAGATGCTGGGAGG + Intergenic
1168458514 19:56534378-56534400 CAGTTTCTCCAGTTGGGGTGGGG + Intergenic
926394344 2:12425935-12425957 AAGAACCTGCAGCTGGTGTGAGG - Intergenic
926768323 2:16344836-16344858 CAGAAGCTGCAAATGGTGTGTGG + Intergenic
926777797 2:16439368-16439390 CAGCTCCTCCAGGTCGTATGTGG - Intergenic
928449028 2:31361765-31361787 CAGATCCTCAATATGTTTTGAGG + Intronic
929056995 2:37886885-37886907 CAGACACTTCAAATGGTGTGGGG + Intergenic
929526003 2:42703467-42703489 CAGTTCCTGCTGCTGGTGTGGGG - Intronic
930597233 2:53403513-53403535 CAGAGCCTCCATCTGGAGTGGGG - Intergenic
937487987 2:122335680-122335702 CAGGCTCTCCAGATGCTGTGTGG - Intergenic
939105347 2:137942364-137942386 TAGTTCCTGCAAATGGTGTGGGG + Intergenic
940855798 2:158727813-158727835 CAGAGCTTCCAGATGGAGTCAGG - Intergenic
943621284 2:190150587-190150609 CACTTCCTTCAGAGGGTGTGTGG + Intronic
943760753 2:191606155-191606177 TAGACCCTCCAGAGGGTGTAGGG - Intergenic
943871230 2:193003636-193003658 CAGATTCACTAGATGGTGTAGGG + Intergenic
943952164 2:194144917-194144939 CTGTTCCCCCACATGGTGTGTGG - Intergenic
944736958 2:202575755-202575777 CAGCTCTTACAGATGGTGTCCGG - Intergenic
947059173 2:226142953-226142975 CAGGTTCTTCAGATGGTGAGTGG + Intergenic
947541610 2:230983763-230983785 TAGAGCCTCCAGAGGGAGTGTGG - Intergenic
947889414 2:233603787-233603809 CAGATCCTCCAGAATGTATGAGG - Intergenic
947890846 2:233617943-233617965 CAGATCCTCCAGAGTGTATGAGG - Exonic
947896829 2:233682173-233682195 CTGATCCTCCAGAGTGTATGAGG - Exonic
948621160 2:239235569-239235591 CTGAACCTCCTGATGGCGTGGGG - Intronic
1168979338 20:1991499-1991521 CAGACCCTCGAAATGGAGTGGGG - Intronic
1169586490 20:7091505-7091527 TGGATCCTCCAGATGGAGTGAGG - Intergenic
1169690905 20:8330728-8330750 CAGATTCTGAAGATGGTGTCTGG + Intronic
1170086201 20:12535249-12535271 CAGATCCTTCAAAGGGTCTGTGG - Intergenic
1173518511 20:43682263-43682285 TAGAGCCTCCTGATGGTGAGGGG + Intronic
1173838721 20:46142276-46142298 AAGATCCTCCAGCTGCCGTGTGG - Intergenic
1175285635 20:57834897-57834919 CAGAGCCTCCAGAGGGAGTACGG - Intergenic
1176836979 21:13802050-13802072 CAGTTCCTGCAAATGGTGTGGGG + Intergenic
1178997704 21:37420335-37420357 CATATCATCCTGATGGGGTGGGG - Exonic
1179148944 21:38794093-38794115 CAGATGCTCCAGCAGGAGTGAGG + Intergenic
1179623453 21:42633604-42633626 CAGACCCTCCAGGTGGAGTCAGG - Intergenic
1180169089 21:46048494-46048516 CAGATGCTGCGGATGGTATGAGG + Intergenic
1183514925 22:38259629-38259651 CAGAGCCTCCAGAAGGAGTATGG + Intronic
1185025959 22:48412669-48412691 CTGAACCTCCAGCTGTTGTGTGG + Intergenic
1185188704 22:49418925-49418947 TAGAGCCTCCAGAAGGAGTGTGG - Intronic
949362176 3:3243622-3243644 CATAGCCTCCAGAGGGAGTGTGG + Intergenic
949469457 3:4379474-4379496 TAGAGACTCCAGATGGGGTGTGG + Intronic
950475931 3:13214770-13214792 CTGACCTTCCAGATGGTGTGCGG + Intergenic
950603683 3:14058504-14058526 CACTTCCTCCAGAGGGTCTGTGG + Intronic
951748965 3:26012618-26012640 CAGATCAGCCAGAAGGTGTGCGG - Intergenic
951818050 3:26777397-26777419 CAGATACTTCAGAAGGTGGGAGG + Intergenic
952772827 3:37017853-37017875 CAGCACCTCCTGATGGGGTGAGG - Intronic
953477307 3:43216375-43216397 CAGACTCTCCAGCTGTTGTGAGG - Intergenic
955212385 3:56954316-56954338 CAGCTCCTCCTGTTGGGGTGGGG - Intronic
955936391 3:64106876-64106898 CAGATCCTCCAGAGGATGTAGGG - Intronic
957856248 3:85882220-85882242 CAGAACCTCTAGATGGAGAGGGG + Intronic
959121297 3:102235793-102235815 GAGATCATCCAAAAGGTGTGTGG + Intronic
959547622 3:107615266-107615288 CAGATGCTCAAGCTGGTGTCTGG - Intronic
960516418 3:118607595-118607617 CACTTCCTTCAGAGGGTGTGTGG - Intergenic
960555937 3:119030727-119030749 CAGATCCTCCAGATGGTGTGGGG + Intronic
961048633 3:123727277-123727299 CAGACCACCCAGAAGGTGTGGGG + Intronic
961172558 3:124808352-124808374 CAGGACCTCCAGAAGATGTGTGG + Intronic
961765282 3:129205675-129205697 CATCTCCTCCTGAGGGTGTGTGG - Intergenic
963074376 3:141332690-141332712 AAGAGCCTGCAGATGGAGTGGGG + Intronic
963373933 3:144438398-144438420 CAGTTCCTTCAGAGGGTCTGTGG + Intergenic
964160506 3:153640351-153640373 CACATCCTTCAGAAGGTCTGTGG - Intergenic
965179944 3:165389253-165389275 CAAATCCTCCAGATGGCCTGTGG + Intergenic
965760699 3:172073020-172073042 CAAAGCCTCCAGATGGTGGCAGG + Intronic
966229974 3:177641070-177641092 CAGTTCCTTCAGAGGGTCTGTGG + Intergenic
968076824 3:195820591-195820613 CAGAACCTCCGGAGGGAGTGTGG - Intergenic
968472287 4:787663-787685 CAGAGCCTCCAGAGGGAGTGTGG + Intronic
970071368 4:12163274-12163296 CAGATCCTCAAGATGCTAGGTGG - Intergenic
970439264 4:16066072-16066094 CAGAGCCTTCAGATGGAGCGTGG + Intronic
970633028 4:17974890-17974912 CAGATTCTTCAGATGGTGAAAGG - Intronic
975632782 4:76419519-76419541 CAGAGCCTCCAGAGGGAGGGAGG - Intronic
981279827 4:142945309-142945331 CAGATCCTACGGAAGGAGTGAGG + Intergenic
981778511 4:148397945-148397967 CAGAGCCTTCAGAGGGAGTGTGG - Intronic
983939696 4:173526374-173526396 CAAATCCTGCAAATGGTCTGGGG - Exonic
985664550 5:1175286-1175308 CAGACTATCCTGATGGTGTGAGG - Intergenic
985753093 5:1694068-1694090 CAGATCCTCCAGAAGGTCTGAGG - Intergenic
986238746 5:5937811-5937833 CAGAACCCCCAGAAGGTGTCGGG - Intergenic
986244898 5:5998344-5998366 CAGACCCTTCAGAGGGAGTGAGG - Intergenic
988930398 5:36031116-36031138 AAGATACTCCAGAAGGTGTGGGG + Intergenic
988934915 5:36071972-36071994 TACATCCTCCAGATGGGGTGGGG - Intergenic
992075103 5:73184815-73184837 GAGAGCCTCCAGATGGAGTGTGG + Intergenic
993920566 5:93795447-93795469 CAGTTCCTTCAGAGGGTCTGTGG + Intronic
995240234 5:109877155-109877177 TAGATTCTCCAGAGGGTATGTGG + Intergenic
996397363 5:123026778-123026800 CAGATCCTTCTTATGGTCTGTGG - Intronic
996978997 5:129467241-129467263 CATATTTTCCAGATGGTGTGTGG + Intronic
1001341834 5:170854342-170854364 CAGATAGTCCAAATTGTGTGTGG + Intergenic
1003031558 6:2605565-2605587 GAGATCCTCGCGCTGGTGTGTGG + Intergenic
1004718239 6:18239712-18239734 GAGATGTTCTAGATGGTGTGGGG + Intronic
1006148246 6:31971866-31971888 CAGGTCCTCCAAATGCAGTGAGG + Intronic
1008584002 6:52932678-52932700 CAGATCCTGGGGATGCTGTGAGG + Intergenic
1009508671 6:64519659-64519681 CACATCCTCCAATTGGTGGGTGG - Intronic
1009761733 6:68015243-68015265 CAGACACTCCAGATTGTGTCTGG - Intergenic
1015101366 6:129485679-129485701 CAGATCCTCAAAATGTTCTGTGG + Intronic
1021533050 7:21671471-21671493 CAGATCTTCCAGATGTTCTGAGG - Intronic
1021858493 7:24881788-24881810 GAGATCCTCCAGAGGGAGCGTGG - Intronic
1021990342 7:26135207-26135229 CAGACTCTACAGATGGTTTGAGG + Intergenic
1022649218 7:32259476-32259498 CAGCTCCCCCAGCTGGTGGGAGG - Intronic
1022793261 7:33710819-33710841 TAGATCCTCCAGAGTGAGTGTGG - Intergenic
1022997829 7:35776148-35776170 CAGATCCTCCAAATGTTAGGGGG - Intergenic
1023272265 7:38476901-38476923 CAGAGCTTCCAGATGGTGGCGGG + Exonic
1026470791 7:70693248-70693270 CAGTGCCCCCAGAGGGTGTGGGG - Intronic
1027426820 7:78069378-78069400 CAGAATCTCCAGAGGGTATGTGG + Intronic
1028086386 7:86642754-86642776 CAGATCCTCATGAAGCTGTGTGG - Intergenic
1029902160 7:104052819-104052841 CCAATCCTCCAGATGGGGAGTGG - Intergenic
1030770641 7:113470680-113470702 CAGATGCTGGAGAGGGTGTGGGG - Intergenic
1032267440 7:130379456-130379478 CAGAGCCTCTAGATGGTGCTGGG + Intergenic
1032352966 7:131183026-131183048 CACATCCACCTGATGCTGTGTGG - Intronic
1033180157 7:139169313-139169335 CAGTTCTTCCAGTTGGTGGGAGG + Exonic
1034254807 7:149719074-149719096 CAGAGCCTTCAGAGGGAGTGTGG - Intronic
1035747365 8:1972069-1972091 CTTATCTACCAGATGGTGTGGGG + Intergenic
1036178101 8:6558470-6558492 CAGATGCTCAGGATGGTCTGGGG - Intronic
1036601784 8:10267682-10267704 CTGATCCCCCAGCAGGTGTGGGG - Intronic
1038659896 8:29488038-29488060 CATACCCACCTGATGGTGTGTGG + Intergenic
1039339142 8:36627667-36627689 AAGATCCTGCAGCTGGTGTACGG - Intergenic
1040656678 8:49518694-49518716 CTGCTCCTCCAAATGGTGGGAGG + Intergenic
1041028914 8:53716541-53716563 CAGTAGCTCCTGATGGTGTGGGG - Intronic
1041461988 8:58121146-58121168 ATGAGCCTCCAGATGCTGTGTGG + Intronic
1041927141 8:63248587-63248609 CACATCCTTCAGAGGGTCTGTGG + Intergenic
1042759067 8:72251576-72251598 CAGATGCACCAGATGGCGTCCGG - Intergenic
1043876489 8:85492000-85492022 CAGTTCCTTCAGAGGGTCTGTGG + Intergenic
1043968334 8:86504253-86504275 TAGATCCTCCAGCAGTTGTGGGG + Intronic
1045315148 8:101037490-101037512 GAGATCTTACAGTTGGTGTGGGG + Intergenic
1046216542 8:111155205-111155227 TAGAACCTCCAGAGGGAGTGTGG + Intergenic
1047498776 8:125427107-125427129 CAGATCCTCCAGTTGGGCAGCGG + Intergenic
1048233027 8:132662484-132662506 CACATCCTACAGAAGATGTGAGG - Intronic
1048509349 8:135048443-135048465 CAGAAGCTCGAGATGGGGTGAGG - Intergenic
1049759034 8:144323583-144323605 CAGATCCTCCAGTCAGTGAGAGG - Intronic
1050711747 9:8473371-8473393 TAAATCCTTCAGATGGTGGGAGG - Intronic
1055156272 9:73066702-73066724 CAGTTCCTTCAGAAGGTCTGTGG - Intronic
1055991503 9:82111145-82111167 TAGAGCCTCCGGATGGAGTGTGG + Intergenic
1057540203 9:95960630-95960652 TAGAGCCTCCAGAAGGAGTGTGG + Intronic
1057785356 9:98083340-98083362 CATATCCTCCAGTTGCTGGGTGG + Intronic
1058874277 9:109229603-109229625 CAGCTCCTCCAGAAGGTGTGTGG - Intronic
1059385595 9:113961877-113961899 CAGTTCATCCATATGGTTTGGGG + Intronic
1061304715 9:129725619-129725641 CAGATCCCCCAGATGGGGAAAGG - Intergenic
1062063412 9:134512307-134512329 TAGACCCTCCAGAGGGAGTGCGG - Intergenic
1062210264 9:135359820-135359842 CAGAGCCTCCCGAGGGGGTGTGG + Intergenic
1185683506 X:1908401-1908423 TAGAGCCTCCGGAGGGTGTGTGG - Intergenic
1186308342 X:8289725-8289747 CAGTTCCTTCAGAGGGTCTGTGG - Intergenic
1188397313 X:29701670-29701692 CATATCCTTCAGGTGGGGTGAGG + Intronic
1189380212 X:40497322-40497344 TAGAGCCTCCAGATGGAGTGTGG + Intergenic
1189567136 X:42254749-42254771 CAGTTCCTTCAGAGGGTCTGTGG - Intergenic
1190913442 X:54792275-54792297 CAGATCCACCATATGCTGTGTGG - Intronic
1192069207 X:67918791-67918813 CACTTCCTCCGGATGGTCTGTGG + Intergenic
1193436259 X:81478048-81478070 CAGATCTTCCAGGTGATGAGTGG - Intergenic
1196948949 X:120856981-120857003 CAGTTCCTTCAAATGGTCTGTGG - Intergenic
1197286672 X:124603120-124603142 CAGAGTCTCCAGAGGGAGTGTGG + Intronic
1200123519 X:153802489-153802511 CCCCTGCTCCAGATGGTGTGGGG + Exonic