ID: 960556267

View in Genome Browser
Species Human (GRCh38)
Location 3:119034473-119034495
Sequence AGGCCGGGTCGGCGGGCCCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 256}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960556267_960556282 2 Left 960556267 3:119034473-119034495 CCCCGGGCCCGCCGACCCGGCCT 0: 1
1: 0
2: 3
3: 19
4: 256
Right 960556282 3:119034498-119034520 CCCCACCGGGAAGAAAGGGCTGG 0: 1
1: 0
2: 1
3: 11
4: 170
960556267_960556286 26 Left 960556267 3:119034473-119034495 CCCCGGGCCCGCCGACCCGGCCT 0: 1
1: 0
2: 3
3: 19
4: 256
Right 960556286 3:119034522-119034544 GCTACTCACCGTGCAGAGAGAGG 0: 1
1: 0
2: 0
3: 7
4: 113
960556267_960556279 -3 Left 960556267 3:119034473-119034495 CCCCGGGCCCGCCGACCCGGCCT 0: 1
1: 0
2: 3
3: 19
4: 256
Right 960556279 3:119034493-119034515 CCTGGCCCCACCGGGAAGAAAGG 0: 1
1: 0
2: 2
3: 21
4: 188
960556267_960556280 -2 Left 960556267 3:119034473-119034495 CCCCGGGCCCGCCGACCCGGCCT 0: 1
1: 0
2: 3
3: 19
4: 256
Right 960556280 3:119034494-119034516 CTGGCCCCACCGGGAAGAAAGGG 0: 1
1: 0
2: 0
3: 11
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960556267 Original CRISPR AGGCCGGGTCGGCGGGCCCG GGG (reversed) Intronic
900096570 1:942369-942391 ACGCGGGGTCGGGGGGTCCGAGG - Intronic
900109848 1:1000734-1000756 CGGCCGGGTCGGCAGGCGGGAGG + Intergenic
900117212 1:1033840-1033862 ACGCCGGGCAGGCGGGGCCGGGG - Intronic
900376823 1:2358761-2358783 AAGCGGGGTGCGCGGGCCCGGGG + Intronic
901265864 1:7910271-7910293 AGGCAGGGTGGGCGGGCAGGGGG - Intergenic
901404966 1:9039488-9039510 AGGCTGGGGCGTGGGGCCCGAGG + Intronic
901411069 1:9084569-9084591 AGGCTGGGATGGTGGGCCCGGGG - Intronic
901489287 1:9588658-9588680 AGCCCGGGTGGGCGGGGCGGCGG - Intergenic
901796073 1:11680533-11680555 AGGCTGGACCTGCGGGCCCGGGG - Intronic
902072176 1:13749496-13749518 GGGCCGGGCGGGCGGGCCGGGGG - Intronic
902823388 1:18956727-18956749 AGGAGGGGTGGGCGGGGCCGCGG - Intergenic
903263447 1:22143173-22143195 CGGCCGGGGGGGCGGGCCGGGGG + Intronic
903486097 1:23690148-23690170 TGGCCTGGTTGGCGGGGCCGGGG + Intergenic
903649527 1:24914362-24914384 AGGGTGGGGCGCCGGGCCCGAGG + Intronic
903875916 1:26472880-26472902 GGGCGGGGGCGGCGAGCCCGAGG - Intronic
903925207 1:26826862-26826884 GGGCCGGGACGGCGCGCCCCCGG - Exonic
904769039 1:32870832-32870854 CGGCCGGGCCGGCCGGGCCGGGG - Intronic
906365395 1:45205903-45205925 CGGCCGGAGCGGCGGCCCCGGGG + Exonic
907010653 1:50959939-50959961 CGGGCGGGTCGGCGGGCCAGCGG + Exonic
916787692 1:168098283-168098305 AGGCCGGGTGGACGGGGCCGGGG + Intronic
919764200 1:201115671-201115693 AGGCAGGGTGGGCGGGTCTGTGG - Exonic
920385771 1:205569368-205569390 AGGCCGGGTCGCGGGGCGGGAGG - Intronic
922730728 1:227947738-227947760 GGGCGGGGGCGGCGGGGCCGGGG - Intronic
923119632 1:230978509-230978531 CGGCCGGGGCGGCGGGGCAGCGG - Intronic
1063663808 10:8050358-8050380 CAGCCGGGTCCGCGGCCCCGCGG - Intergenic
1064208839 10:13347419-13347441 AGGCCCGGGCTGCGGGCCGGCGG + Intronic
1065188638 10:23192114-23192136 AGGCGGGGTCGCGCGGCCCGGGG - Intergenic
1065214741 10:23439054-23439076 AGGCCCGGGAGGCGGGGCCGCGG - Intergenic
1069698350 10:70404342-70404364 AGGCGGCGGCGGCGGGGCCGGGG - Intergenic
1076297041 10:129394044-129394066 AGGGCGGGTCATCGGGGCCGTGG - Intergenic
1076722217 10:132397582-132397604 GGGCCGGGGCGGGGGGCGCGGGG + Intronic
1077250111 11:1557144-1557166 CGCCGGGGTCGGGGGGCCCGGGG + Exonic
1077321967 11:1946773-1946795 AGGGCGGGTCCCCGGGCCTGGGG - Intergenic
1080517829 11:33039919-33039941 AGGCGGGGTCCGCGGGCGGGTGG + Intronic
1080628517 11:34052165-34052187 AGGCCGAGCCGGCGGCTCCGCGG + Intronic
1083258114 11:61508875-61508897 AGGCCGGGGCGGGGGGCCCGGGG + Exonic
1083316433 11:61817194-61817216 AGGAAGGGTGGGCGGGGCCGGGG + Intronic
1083361575 11:62112450-62112472 AGGCCGGGTGAGCGGCCTCGCGG + Intergenic
1083849092 11:65354974-65354996 AGGCCGGGCGGGCGGGCGCCTGG + Intronic
1083890309 11:65592546-65592568 CGGCCGGGCCGGCGGCCTCGGGG + Exonic
1084086176 11:66856411-66856433 AGGGCGGGGCGGCGGGGGCGGGG + Intronic
1084192469 11:67505222-67505244 GGGCAGGGCCGGCCGGCCCGTGG + Exonic
1084410972 11:69005730-69005752 AGGCCGCGCCGGGGGCCCCGCGG + Exonic
1084946660 11:72642389-72642411 CGGCCGGGCCGGCGGGCGGGCGG - Intronic
1085784230 11:79437506-79437528 CGGCCGGGTGGGCGGGGCCTGGG - Intronic
1089560297 11:119340217-119340239 CGGCCGCGACGGCGCGCCCGGGG - Exonic
1089796568 11:120985986-120986008 GGGCCGGGGCGGCGGGACTGCGG - Exonic
1202804983 11_KI270721v1_random:2086-2108 AGGGCGGGTCCCCGGGCCTGGGG - Intergenic
1092172717 12:6383921-6383943 AGGGAAGGGCGGCGGGCCCGGGG - Intronic
1096116876 12:49060158-49060180 ACGCGGGGCCGGCGGGGCCGCGG + Intergenic
1098550332 12:71755011-71755033 CGCCCGGGTCGGCGGGGCCGGGG + Exonic
1103563421 12:121804147-121804169 AGGCCGGGGCGGCCGGACCGGGG - Intergenic
1103817540 12:123671020-123671042 AGGCCTTGTGGGCGGGGCCGGGG + Intergenic
1104906173 12:132214611-132214633 AGGCCGGGTGAGCAGGCCTGGGG - Intronic
1105270847 13:18874769-18874791 GGGCTGGGTCGGCGGGGGCGGGG - Intergenic
1107495493 13:40921972-40921994 AGGCTCGGTCGGAGTGCCCGCGG - Intergenic
1110705333 13:78597325-78597347 AGGCCGGGGCGGCGGGGCAGAGG + Intergenic
1110705942 13:78602182-78602204 CGGCCCGGGCGGCGGCCCCGGGG - Exonic
1112494748 13:99895981-99896003 AGCCGGGGTGGGCGGCCCCGCGG + Exonic
1113598044 13:111548137-111548159 AGCCCGGGTTGCTGGGCCCGAGG + Intergenic
1114519045 14:23321570-23321592 AGGCCGGGGAGGGGGCCCCGGGG + Exonic
1116817888 14:49599860-49599882 GGGCCGGGGGGGCGGCCCCGCGG + Intronic
1116945219 14:50830439-50830461 AGGCGAGGGCGGCGGGGCCGGGG - Intronic
1117302239 14:54441169-54441191 CGGCCCGGACCGCGGGCCCGGGG + Intronic
1120813096 14:88824902-88824924 AGGCCGGGGAGGAAGGCCCGAGG + Intronic
1122130979 14:99604404-99604426 CGGCCGGGAGGGCGGGACCGCGG - Intergenic
1122162301 14:99793310-99793332 CGGCGGCGGCGGCGGGCCCGGGG + Intronic
1122542882 14:102507838-102507860 TGGCGCGGACGGCGGGCCCGAGG - Exonic
1122635378 14:103127269-103127291 AGGCGGCGGCGGCGGGGCCGGGG + Exonic
1122666692 14:103334736-103334758 AGGCCGGGCCGGGGAGCGCGCGG - Intronic
1122688770 14:103521984-103522006 GGGCCGGGCGGGCGGGGCCGGGG - Intronic
1122848460 14:104513564-104513586 AGGCCGGGTGGCTGGGCCCGGGG + Intronic
1123021230 14:105398781-105398803 AGGCGGGGTCTGCGCGGCCGGGG - Intronic
1128344150 15:66842872-66842894 GGGCCAGGTCGGGCGGCCCGGGG + Intergenic
1130564581 15:84982289-84982311 AGGCCGGCGCCGCGGGTCCGGGG - Exonic
1132553182 16:561502-561524 AGGCCGGGTCTGCAGCCCCTCGG + Intronic
1132640173 16:974618-974640 AGGCCGGGACGGCGGGGACAGGG - Intronic
1132683512 16:1153186-1153208 AGGCCGGGGCGCGGGGCGCGGGG - Intergenic
1132741375 16:1414842-1414864 GGGCGGGGTCTGCGGGCCGGGGG - Intergenic
1132828938 16:1918287-1918309 CGGCCTGGGCGGCGGGGCCGGGG - Exonic
1132844221 16:1992547-1992569 AGGAAAGGTCGGTGGGCCCGAGG - Intronic
1132881172 16:2162339-2162361 AGGCCGGGCTGGGGGGCCCCAGG + Intronic
1133784241 16:8963021-8963043 ATGCCGGGTCCGCGGGCGAGGGG - Intronic
1133784439 16:8963614-8963636 GGGCCGGGGCTGCGGGGCCGCGG + Intronic
1133786752 16:8979841-8979863 AGGCCGGGTTGGCGGGGGCAGGG - Intergenic
1134143610 16:11742770-11742792 GGGCCGGGCCTTCGGGCCCGAGG - Exonic
1135745829 16:25015369-25015391 AGGGCGGGGCCGCCGGCCCGGGG - Intronic
1136428235 16:30183292-30183314 AGGCCTGGCGGGCGGGCCTGGGG + Intronic
1137531949 16:49283378-49283400 AGGCCGGGAGGCCGGGCCAGAGG - Intergenic
1137676926 16:50308432-50308454 AGGCAGGGAGGGAGGGCCCGCGG - Intronic
1137988766 16:53131415-53131437 GGGTCGGGCGGGCGGGCCCGCGG + Intronic
1139451284 16:67029574-67029596 AGTCCCGGTCGGTGCGCCCGCGG + Intronic
1139761451 16:69187444-69187466 AGGCGGCGCCGGCGGGCTCGGGG - Exonic
1141694106 16:85611876-85611898 AGGCGGGGGAGGCGGGCTCGCGG + Intronic
1141710329 16:85695276-85695298 AGGCCTGGTCGTGGGGCCGGTGG - Intronic
1142260845 16:89041883-89041905 AGGCCAGGACGGGAGGCCCGAGG - Intergenic
1142260858 16:89041923-89041945 AGGCCAGGACGGGAGGCCCGGGG - Intergenic
1142260873 16:89041963-89041985 AGGCCAGGACGGGAGGCCCGGGG - Intergenic
1142260947 16:89042163-89042185 AGGCCAGGACGGGAGGCCCGGGG - Intergenic
1142260962 16:89042203-89042225 AGGCCAGGACGGGAGGCCCGGGG - Intergenic
1142513153 17:410518-410540 AGGGCGGCGCCGCGGGCCCGCGG + Exonic
1143021500 17:3919199-3919221 AGGCCGGGGAGGCTGTCCCGGGG - Intergenic
1143078489 17:4365465-4365487 CGGCCGGGTCGGCCTCCCCGAGG - Intronic
1144656882 17:17042590-17042612 AGGCCGCGTCCATGGGCCCGCGG + Intronic
1146339553 17:32007509-32007531 GGGCCGGGTTGGGAGGCCCGAGG - Intergenic
1146646873 17:34581747-34581769 AGGCCGGGGCGGTGGGCCGCGGG + Intronic
1148284119 17:46372896-46372918 AGGCAGGGGCGCCGGGCTCGCGG + Intergenic
1148306340 17:46590817-46590839 AGGCAGGGGCGCCGGGCTCGCGG + Intronic
1148336873 17:46847842-46847864 AGGCAGGGTGGGCTGGCCTGGGG + Intronic
1148601722 17:48899277-48899299 AGGCTGGGGCGGCGGGGGCGGGG + Intergenic
1148603040 17:48908541-48908563 GCGCCGGGGCGGCGGGCCCCGGG + Exonic
1150747183 17:67825628-67825650 GGGCCGGGTGGGGAGGCCCGCGG - Intronic
1151215787 17:72575518-72575540 AGGCCAGGTCGGGGGGCCCAGGG - Intergenic
1152357329 17:79813504-79813526 CGGCGGGGGCGGCGGGCGCGGGG + Intergenic
1152552320 17:81035712-81035734 CGGCGGGGGCGGCGGGCCCAGGG + Intronic
1152609876 17:81310216-81310238 AGGACAGGTCGGTGGGCCCCGGG + Intergenic
1152694174 17:81735410-81735432 AGGAGGGGACGGCGGGCCCTGGG - Intergenic
1154416728 18:14179299-14179321 GGGCTGGGTCGGCGGGGGCGTGG + Intergenic
1156036607 18:32772102-32772124 CGGGCGGGCCGGCGGGCCGGCGG - Exonic
1156489047 18:37485649-37485671 AGGGCGCGTCGGCGGGCCCGGGG - Intronic
1158649675 18:59273864-59273886 AGGCCAGGGTGGCGGCCCCGCGG - Intronic
1160242364 18:77132822-77132844 AGCCCGGGGAGGCGGGGCCGGGG - Intronic
1160486826 18:79300586-79300608 AGCCCGGGGCTGCGGGGCCGTGG + Intronic
1160691028 19:460787-460809 AACCCGAGCCGGCGGGCCCGGGG - Exonic
1160907260 19:1457203-1457225 GGCCCGAGACGGCGGGCCCGAGG + Exonic
1161215775 19:3094504-3094526 AGGCGGGGCGGGCCGGCCCGGGG + Exonic
1161450703 19:4343856-4343878 AGGCGGCGGCGGCGGGGCCGGGG + Exonic
1161812088 19:6476831-6476853 AGGCGGGGTCCGCCGGGCCGGGG - Intronic
1162100453 19:8335588-8335610 AGGCCGGGCCGGGGCGCGCGGGG + Exonic
1162744705 19:12791928-12791950 GGGCCGGGTCCGCGAGCCCCAGG - Exonic
1162914211 19:13865556-13865578 AGGCCGGGGCGCCCGCCCCGGGG - Intronic
1163830683 19:19545864-19545886 AGGCTGGGTCGTCCGGCCGGTGG - Exonic
1164834554 19:31349281-31349303 GGGAGGGGGCGGCGGGCCCGCGG + Exonic
1165363695 19:35351533-35351555 AGGCCAGGACGGCGGCCCCATGG + Exonic
1165493937 19:36141101-36141123 AGGCCTGATCAGCGGGGCCGGGG + Exonic
1165934413 19:39380675-39380697 CGGCCGGGTGGGAGGGCCCGGGG - Exonic
1166360119 19:42249480-42249502 GGGCCGGGTGGTCGGGCGCGGGG + Exonic
1166529723 19:43535086-43535108 AGGCCGGGGAGGCGAGCCCGCGG - Exonic
1167115014 19:47484043-47484065 AGGCGGCGCCGGCGGGCGCGGGG - Exonic
1167792184 19:51689515-51689537 GGGCCCGGCCTGCGGGCCCGGGG + Intergenic
926090115 2:10043941-10043963 CGCCCGGGTCGGCGGGGGCGAGG + Intronic
927230842 2:20822972-20822994 AGGACGGGTGGGCAGGCACGCGG - Intronic
927809551 2:26173651-26173673 CGGCCGGGGCGGGGGGCCCAGGG - Intronic
927964745 2:27262146-27262168 CGGCCGGGACAGCGGGCCGGGGG - Intronic
929452697 2:42047860-42047882 AGGCCGGGCCGGGCGGCCGGAGG + Intergenic
929511383 2:42568506-42568528 AGGCCGAGTGGGCCGGGCCGGGG - Intronic
929966850 2:46542868-46542890 GGGAGGGGGCGGCGGGCCCGGGG - Exonic
930024912 2:47024073-47024095 AGGCAGGGACGGTGGGCCTGAGG - Intronic
931428954 2:62195212-62195234 AGGGCGCATCGGTGGGCCCGGGG + Intergenic
935630653 2:105210744-105210766 CGGACGGGGCGGCTGGCCCGGGG + Intergenic
935697419 2:105782222-105782244 AGGCGGGGTGGCCGGGCCCAGGG + Intronic
936452801 2:112646038-112646060 GGCCCGGGTCGGCGGCACCGGGG - Exonic
937040738 2:118818790-118818812 AGGCCAGGTCTGTGGGCCTGTGG - Intergenic
937042767 2:118834656-118834678 AGGCCGGGCAGGCGGGGGCGAGG - Intergenic
937183141 2:120013455-120013477 GGGCCGGGGCGGAGGGCCCGGGG + Intronic
937221041 2:120343572-120343594 CGGCCGGGACCGCAGGCCCGCGG - Intergenic
938301111 2:130213650-130213672 GGGAGGGGGCGGCGGGCCCGGGG + Intergenic
938895176 2:135742264-135742286 AGGCCCGGGCTGCCGGCCCGTGG + Intronic
942460561 2:176165413-176165435 GCGGCGGGCCGGCGGGCCCGGGG + Intronic
946702101 2:222424475-222424497 AGGCCGGGCGGGCGGGGCCCCGG - Intergenic
947593056 2:231395922-231395944 AGGCCGGCGCGGCGCGCGCGGGG - Intronic
948216655 2:236237603-236237625 AGGCGGGGTCGGCGGTCTCGTGG + Intronic
948484340 2:238270996-238271018 AGGCCGGGTCGTGGGGGCAGTGG - Intronic
1168750742 20:279395-279417 GGGCCGGGGCGGCGGGTCCACGG - Intronic
1168769807 20:408035-408057 AGGCGGGGTGGGCGGGGCCGGGG - Exonic
1169231121 20:3889478-3889500 GGGCCGGCTCGGCGCGCCCATGG + Exonic
1170821188 20:19757538-19757560 AGGCGGGGTGGGCGGGCCCCTGG + Intergenic
1171035410 20:21709325-21709347 AGGCGGCCACGGCGGGCCCGGGG - Exonic
1171249502 20:23637568-23637590 AGGCTGGGACGGCGGGGCCGGGG + Intronic
1172764948 20:37346275-37346297 TGGCCGGGGCGGGGGGTCCGCGG - Intronic
1174611426 20:51801454-51801476 TGGCCGGGGTGGCGGGCGCGCGG - Intronic
1175831069 20:61965785-61965807 AGCCAGGGGCGGGGGGCCCGGGG - Intronic
1175847109 20:62065009-62065031 CGGCGGGGGCGGCGGGCGCGGGG + Exonic
1176221154 20:63969850-63969872 GGGCCGGGGCGGGGGGCGCGGGG + Intronic
1176549239 21:8214373-8214395 CGGCCGTGTCGGCGGCCCGGCGG + Intergenic
1176568171 21:8397411-8397433 CGGCCGTGTCGGCGGCCCGGCGG + Intergenic
1176576074 21:8441631-8441653 CGGCCGTGTCGGCGGCCCGGCGG + Intergenic
1176867978 21:14064228-14064250 GGGCTGGGTCGGCGGGGGCGGGG + Intergenic
1178555708 21:33588496-33588518 AGGGCGGCTCGGCGGGCCGCCGG + Exonic
1178610339 21:34073863-34073885 AGGCCGGGGCGGCGGGCGGGCGG + Intronic
1179571788 21:42282865-42282887 AGGCGGGGTCAGAGCGCCCGTGG - Intronic
1180154614 21:45971896-45971918 GGGCTGGGTGGGCGGGCCCCTGG + Intergenic
1180209416 21:46285923-46285945 CGGCGGGGACGGCGTGCCCGGGG + Intronic
1180631361 22:17232455-17232477 AGGCCGGTGCGGCGGGGGCGGGG - Intergenic
1180921649 22:19524461-19524483 GGGCCGGGGGGCCGGGCCCGGGG - Exonic
1180960687 22:19761049-19761071 CGGCGGCGGCGGCGGGCCCGGGG - Exonic
1181006666 22:20016785-20016807 AGGGCGGGAGGGCTGGCCCGGGG - Exonic
1181057908 22:20268485-20268507 CGGCCGGGGACGCGGGCCCGAGG + Exonic
1183924719 22:41197572-41197594 TGGCCGGGAAGGCGGGCGCGCGG - Intergenic
1184680758 22:46071243-46071265 CGCCCGGGGCGGCGTGCCCGCGG + Intronic
1184769092 22:46587589-46587611 AGGCCGGGGCGGGGGGCCAGTGG + Intronic
1184839323 22:47043337-47043359 GGGCCGGGGCGACGGGCACGAGG + Intronic
1185055488 22:48576580-48576602 AGGACCGGTCCGCGCGCCCGGGG - Intronic
1185088068 22:48751332-48751354 AGGCGGGGCCGGCAGGGCCGAGG + Intronic
1203254124 22_KI270733v1_random:130689-130711 CGGCCGTGTCGGCGGCCCGGCGG + Intergenic
1203262180 22_KI270733v1_random:175768-175790 CGGCCGTGTCGGCGGCCCGGCGG + Intergenic
950730087 3:14948577-14948599 GGGCCGGGTCGGCGGGGGCGGGG + Intronic
950940092 3:16884089-16884111 AGGCCGGGTCATCGGGCCGCGGG - Intronic
960556267 3:119034473-119034495 AGGCCGGGTCGGCGGGCCCGGGG - Intronic
966886391 3:184380002-184380024 CGGCCGGGGCGTCGGGCGCGGGG + Intronic
968650098 4:1757038-1757060 GGGCCGGGCCGGTGGGCCAGTGG + Intergenic
968907955 4:3463268-3463290 GGGCCAGGAGGGCGGGCCCGCGG - Intergenic
969417074 4:7067877-7067899 AGGCCGGGAAGGAGGCCCCGGGG + Intronic
969517260 4:7654648-7654670 AGGCCGGGTCGGCACCCACGGGG - Intronic
975342742 4:73259236-73259258 GGGCCGGGTCTGGGGCCCCGCGG + Intergenic
977941956 4:102868949-102868971 CGGGCGGGGCGGCGGGCCCTGGG - Intergenic
981315547 4:143336710-143336732 AGGGCGGGTGGGCGGGCGAGCGG + Intergenic
984888636 4:184473206-184473228 GAGCCGGGTCGGAGGGCACGGGG + Intronic
985774617 5:1834284-1834306 GGGCCGGGGCGGCAGGCACGAGG - Intergenic
986463655 5:7998664-7998686 AGGCCAGGTCGGCTGGCACAGGG + Intergenic
988073491 5:26324560-26324582 CGGCCGGCTCTGCCGGCCCGGGG + Intergenic
989169942 5:38464034-38464056 AGGCAGGGTCTGAGGGCCCCTGG - Exonic
990417658 5:55601527-55601549 AGGACTGGTTGGCAGGCCCGGGG + Intergenic
992549921 5:77850652-77850674 AGGCCGGGCCCGCGAGCCCGAGG - Intronic
999188511 5:149730428-149730450 CGGCTGGGGCTGCGGGCCCGGGG + Intronic
1002512749 5:179733358-179733380 GGGCCGGGGCGGCGGGCGCCGGG - Exonic
1002929188 6:1621531-1621553 AGGCCGGGTCCGCTTGGCCGCGG - Intergenic
1004216780 6:13711248-13711270 CGGCGGGGGCGGCGGGGCCGCGG + Exonic
1005472174 6:26172096-26172118 AGGCCGAGTCGGCGGGGACTGGG - Intergenic
1006375690 6:33670590-33670612 AGGCAGGGTGGGCGGGGCAGGGG + Intronic
1006694608 6:35920733-35920755 AGGCCGGGTCAGGGGGCGGGCGG + Intronic
1010703303 6:79077772-79077794 AGGCGGCGGCGGCGGGGCCGCGG - Intronic
1018020899 6:159761838-159761860 AGGCCGGGGCGCGGGGCGCGGGG - Exonic
1019056248 6:169225500-169225522 ACGCAGGGGCGGCTGGCCCGAGG + Intronic
1019287991 7:233182-233204 AGGACGCGTCGCCTGGCCCGGGG + Intronic
1019437120 7:1028085-1028107 AGCGCGGCTCGGCCGGCCCGGGG + Intronic
1019520709 7:1459513-1459535 AGGCGGGGCCGGCGGGGGCGGGG - Intergenic
1019663909 7:2241944-2241966 GGGCAGGGCCGGCGGGGCCGTGG - Intronic
1019735166 7:2646864-2646886 AGGCCAGGGCGGCGGCCCCCAGG - Exonic
1019965765 7:4497190-4497212 AGGCCGGCCCTGCGGGCCCCGGG - Intergenic
1020120575 7:5500948-5500970 TGGCCGGCTGGGCGGGCGCGCGG + Exonic
1022207574 7:28179713-28179735 GGGCCGGGGACGCGGGCCCGGGG - Intronic
1022285976 7:28956578-28956600 AGGCTGAGTCGGCGGGGCCCGGG - Exonic
1023703013 7:42911650-42911672 TCGCCGGGTGGGCGGGCCAGAGG + Intronic
1027001600 7:74658089-74658111 AGGCGGGGGCGGGGGGCGCGGGG - Intronic
1031051923 7:116953695-116953717 AGGCCTGGGAGCCGGGCCCGCGG + Intronic
1031531991 7:122886640-122886662 CCGCTGGGTCGGCGCGCCCGGGG - Intronic
1031899231 7:127392069-127392091 AGGGCGGGCCGGCGGGCGGGCGG + Intronic
1034147137 7:148883842-148883864 TGGCCGGGGCGCCGGGGCCGGGG - Intronic
1034412158 7:150947373-150947395 AGCCCGGGTCGGCGGCCCCGGGG - Exonic
1035153276 7:156892801-156892823 AGGCCGGGGCGGGAGGCGCGAGG + Intronic
1035264924 7:157685251-157685273 ACGCCGGGGCAGCGGGGCCGGGG - Intronic
1035733131 8:1866562-1866584 TGGCCGGGTCTGCGGCCCAGCGG - Exonic
1036786743 8:11692828-11692850 AGGCGGGGGCGGCCGGCCGGGGG + Intronic
1037903760 8:22703450-22703472 AGGGTGGGTCGGGGTGCCCGGGG + Intergenic
1037998035 8:23367801-23367823 AGGCGGGGTCGGGGGGCTTGAGG - Intronic
1038038013 8:23702669-23702691 AGGCAGGTGCGCCGGGCCCGGGG + Exonic
1039868911 8:41529121-41529143 CCGCCGGGTGGGCGGGCCCAAGG + Intergenic
1042591437 8:70402613-70402635 GGGCCGGGTCCCCGTGCCCGGGG + Intronic
1045459207 8:102412141-102412163 CTGGCGGGTCGGCGGGCGCGGGG - Intronic
1047259223 8:123241157-123241179 AGGCCGGGGCCGGGGCCCCGCGG + Intronic
1047961687 8:130016155-130016177 CGTCCGGGCCGGCGGGCGCGGGG - Intronic
1048553904 8:135457367-135457389 AGGGCGGGGCGGCGGGCGCGGGG + Intergenic
1048576039 8:135690672-135690694 TGCCGGGGCCGGCGGGCCCGCGG + Intergenic
1049508978 8:143018422-143018444 GGGCGGAGTCGGCGAGCCCGCGG - Intronic
1049800969 8:144517388-144517410 AGGCTGGGGCGGCGGGGCCTGGG + Intronic
1053048190 9:34937041-34937063 CGGACGGGGCGGCTGGCCCGGGG - Intergenic
1053162311 9:35821679-35821701 AGGCCTGCTCGGAGGGCCGGGGG + Intronic
1054835548 9:69672162-69672184 CAGCTGGGTCCGCGGGCCCGCGG + Exonic
1057488632 9:95506092-95506114 CGGCAGCGGCGGCGGGCCCGGGG + Intronic
1057546232 9:96021793-96021815 CGGCAGGGTCGGCGGGACTGGGG + Intergenic
1059107642 9:111525298-111525320 TGGCCGGGTCGCCGGCTCCGAGG + Intronic
1059145706 9:111897193-111897215 GGGCCGGTCCGGCGGGCCGGGGG + Exonic
1062336814 9:136074881-136074903 AGGCGGAGTCGGCAGGGCCGGGG + Intronic
1062341548 9:136095701-136095723 GGGCGGGGTAGGGGGGCCCGGGG - Intergenic
1062493688 9:136821739-136821761 AGGCCGGGCCGCCGGGCTGGAGG + Intronic
1062592486 9:137280572-137280594 AGCCAGGGCTGGCGGGCCCGGGG - Exonic
1062678881 9:137765667-137765689 AGGCTGGGGCGGCGGGGGCGGGG - Intronic
1203470525 Un_GL000220v1:113833-113855 CGGCCGTGTCGGCGGCCCGGCGG + Intergenic
1203478346 Un_GL000220v1:157805-157827 CGGCCGTGTCGGCGGCCCGGCGG + Intergenic
1186863390 X:13695074-13695096 AGGCCGGGTCCGGAGGCTCGAGG - Intronic
1189114275 X:38327290-38327312 AGGCCGGGAGGGAGGGTCCGCGG - Intronic
1189324958 X:40106396-40106418 AGGCGGGGACTCCGGGCCCGCGG - Intronic
1192473704 X:71420877-71420899 AGGCCGGGGAGGGGGCCCCGGGG - Intronic
1195308376 X:103607918-103607940 AGGGCGGGCGGGCGGGCGCGGGG - Intronic
1197746137 X:129932882-129932904 AGGCCGGGCCGGCGCGTCCCGGG + Intergenic
1198256121 X:134925743-134925765 AGGCTGGCTCCGCAGGCCCGGGG + Intergenic
1200143299 X:153912862-153912884 AGGCCGGCTTGGCTGGCCTGGGG - Intronic
1200163251 X:154019789-154019811 TGGCCGGGGGGCCGGGCCCGGGG - Exonic