ID: 960559802

View in Genome Browser
Species Human (GRCh38)
Location 3:119071692-119071714
Sequence ATGTATCTCTGGCATGATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 143}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960559802_960559805 12 Left 960559802 3:119071692-119071714 CCATCATCATGCCAGAGATACAT 0: 1
1: 0
2: 0
3: 11
4: 143
Right 960559805 3:119071727-119071749 TTTAGCTTTATAGTAAGTTTTGG 0: 2
1: 1
2: 18
3: 99
4: 522

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960559802 Original CRISPR ATGTATCTCTGGCATGATGA TGG (reversed) Intronic
901052938 1:6434690-6434712 ATGTATGGCTGACGTGATGACGG - Intronic
901505061 1:9679573-9679595 CTGTTTCTCAGGCATGAAGAAGG + Intronic
909000489 1:70211813-70211835 ATGTACCTCTAGAATGATGATGG - Intronic
909446367 1:75753454-75753476 ATGTAGTTCTGGCAACATGAAGG - Intronic
909865296 1:80661157-80661179 ATGACTCTCTGCCATGATGTGGG + Intergenic
910022934 1:82614827-82614849 ATGTATTTCTTTCTTGATGATGG - Intergenic
913094183 1:115500876-115500898 ATGTATATTTGGCATGATTCCGG + Intergenic
913456342 1:119035521-119035543 ATTAATATCTGACATGATGAAGG + Intronic
914312210 1:146476768-146476790 ATAGATCTCTGGCAAGATAAAGG - Intergenic
914502140 1:148256568-148256590 ATAGATCTCTGGCAAGATAAAGG + Intergenic
918861847 1:189838007-189838029 ATGAATATATAGCATGATGAAGG + Intergenic
921379282 1:214507238-214507260 GTGTATCTCTGGCATGTTGCAGG + Intronic
924449720 1:244166542-244166564 ATGTTTCTCTTCCTTGATGACGG - Intergenic
1063360875 10:5456868-5456890 ATGTGGCTCTGGCATGCAGATGG + Exonic
1067192218 10:44081332-44081354 ATGTATGTCTGGCAAGTTCAAGG + Intergenic
1071742723 10:88379080-88379102 ATTTTGCTCTGGCATTATGATGG + Intronic
1071765260 10:88657273-88657295 ATGTATTTGTGAAATGATGATGG + Intergenic
1073085905 10:100888616-100888638 ATGTCTGTCTGGCAGGATGGTGG + Intergenic
1076005733 10:126947201-126947223 GTTTACCTCTGCCATGATGATGG + Intronic
1077981108 11:7301829-7301851 ATGCATTTCTGGCATTATGGTGG - Intronic
1080086948 11:28294381-28294403 ATGTATCCCTGTGATGAAGACGG + Intronic
1080898629 11:36466916-36466938 GTGTATCTCTGGCCAGCTGAGGG - Intergenic
1081152832 11:39652884-39652906 ATGGATCTTTTGCATGATGCTGG + Intergenic
1081551131 11:44113642-44113664 ATGTAACTCTGAGATGATGGTGG + Intronic
1085861668 11:80243084-80243106 ATGTGTGAGTGGCATGATGATGG - Intergenic
1086918494 11:92558537-92558559 ATTTGTCTCTGGCATGAAGCAGG + Intronic
1087423425 11:97962258-97962280 ATTTATTTCTGGCATCTTGACGG + Intergenic
1087691350 11:101324111-101324133 ATGTAGCTATGGCATGAGGTAGG + Intergenic
1088950935 11:114569175-114569197 TGGTATCTGGGGCATGATGAAGG + Intergenic
1090921408 11:131209313-131209335 ATGTCTCACTGCCATGAAGAAGG + Intergenic
1092551102 12:9501103-9501125 ATCTATCTGTGGAATGATTAAGG - Intergenic
1094520714 12:31185276-31185298 ATTTATCTGTGGAATGATTAAGG + Intergenic
1098775738 12:74613034-74613056 ATATATCTCTGGAAATATGAAGG - Intergenic
1101106160 12:101442778-101442800 ATGTATCACTGGCATAAAAACGG - Intergenic
1103798726 12:123523325-123523347 ATGTTTCTCTGGCAGGGTTATGG + Intronic
1104137362 12:125953214-125953236 ATTTTTCTCTGTCATCATGATGG + Intergenic
1108419712 13:50235541-50235563 ATGTATGGGTGGCATGTTGAAGG + Intronic
1110063623 13:71072144-71072166 AGGGATCTCTGGGAAGATGAAGG - Intergenic
1117381456 14:55167880-55167902 ATGTAACTCTGGGATAAAGAGGG - Intronic
1118149911 14:63178573-63178595 GTGAATCTCTGGCATGCCGAGGG + Intergenic
1119504590 14:75161587-75161609 TTGTATCTTTAGCAAGATGATGG - Intronic
1119629801 14:76219189-76219211 GTGTAACTCTGCCAAGATGAGGG + Intronic
1120763671 14:88308676-88308698 TTGTGTCTCTCCCATGATGATGG - Intronic
1121615651 14:95311822-95311844 CTGTATCCCTGGAATGAAGAAGG - Intronic
1126340420 15:47635143-47635165 ATGTATCCCTGACATGTGGAAGG - Intronic
1131573771 15:93566012-93566034 GTGTATCTGTGGCATGGTGCAGG - Intergenic
1139191501 16:64868601-64868623 ATGTATGTCTGCCATGGAGAAGG + Intergenic
1140288259 16:73625470-73625492 ATGGATATCTTGCAGGATGACGG - Intergenic
1141659344 16:85433534-85433556 CTGTATCTCTGACCAGATGAAGG + Intergenic
1144468787 17:15518444-15518466 AGGTATTGCTGGCATGCTGATGG - Intronic
1146098650 17:29957289-29957311 TTGCATCCCTGGCATGATGAGGG + Intronic
1146247391 17:31300873-31300895 ATGCATCTCTGTAATTATGAGGG + Intronic
1148209510 17:45799796-45799818 CTGTCTCGCTGGGATGATGAGGG + Intronic
1148895107 17:50835035-50835057 ATGTGTCTCTGGAATGATTTGGG + Intronic
1149044138 17:52224879-52224901 ATGTATCTCAGCCAGGAGGAGGG - Intergenic
1150560452 17:66289809-66289831 ATGTTAATCTGGAATGATGAGGG + Intergenic
1154051565 18:10964708-10964730 GTGTTTCTCTGGATTGATGATGG - Intronic
1155540707 18:26865137-26865159 ACATATCTCTGGCCTTATGAGGG + Intronic
1156198474 18:34803157-34803179 ATGTGACTCTGTCATGAAGAAGG - Intronic
1158149223 18:54348417-54348439 ATGTATCTGTGGAATAATGAAGG - Intronic
1168368094 19:55806752-55806774 AAGTATGTATGGCATGATCATGG - Intronic
925607042 2:5669976-5669998 ACAAATCTCTGGCATGATGGTGG + Intergenic
925935596 2:8755842-8755864 ATGTGTCACAGGCATGAGGATGG - Intronic
926522847 2:13938199-13938221 CTGTATCACTGCCATGTTGAAGG + Intergenic
933582907 2:84147535-84147557 AGACATCCCTGGCATGATGATGG + Intergenic
935128981 2:100247338-100247360 ATGTGGCCCTGGAATGATGAAGG + Intergenic
935400837 2:102658314-102658336 ATGTTCCTCTGGCATGAACAGGG - Intronic
939247377 2:139643662-139643684 ATTTATCACTGGCAAGATTATGG + Intergenic
941517793 2:166501204-166501226 ATTTTTCTCTGCCATGCTGAAGG - Intergenic
942764464 2:179437836-179437858 ATATATGTATGGCATGATGCTGG - Intergenic
942764470 2:179437930-179437952 ATATATATATGGCATGATGCTGG - Intergenic
944622967 2:201537644-201537666 ATGAATCTCTGGGAAGATGGGGG + Intronic
945546667 2:211162367-211162389 ATATATTTCTGACATGCTGAGGG - Intergenic
945718819 2:213392189-213392211 ATGTCACCCTGGCATGATAATGG + Intronic
946545379 2:220736157-220736179 ATCTATTTCTGGCATTATGGTGG - Intergenic
1170635103 20:18097352-18097374 ACTCATCTGTGGCATGATGATGG - Intergenic
1172131524 20:32659258-32659280 ATGTAATCCTGGCTTGATGAAGG + Intergenic
1172284106 20:33729045-33729067 ATGAATCTCTCCCATGATCATGG - Intergenic
1172651858 20:36508767-36508789 ATGTCTCTCTGCCATGAGGTGGG + Intronic
1172925786 20:38533671-38533693 ATGTATATCTGACATGTTCAAGG - Intronic
1173871427 20:46344429-46344451 TGGTATCTCTAGCATGAGGAGGG - Intergenic
1177060698 21:16370266-16370288 TTATCTCTTTGGCATGATGAAGG + Intergenic
1178451320 21:32704159-32704181 ATGTCTCTCAGGACTGATGAAGG + Intronic
1180617538 22:17138223-17138245 ATGCAGCTCTGGCTTGCTGAGGG + Exonic
1184575425 22:45360931-45360953 TTGTGTGTCTGCCATGATGATGG - Intronic
951823890 3:26845635-26845657 ATGTATGTCTGGCATGTTCCAGG + Intergenic
952935576 3:38395970-38395992 ATATGTTTCTGGCATAATGAAGG - Intronic
954403290 3:50330698-50330720 ATGTAGTTCAGGCATGCTGAAGG + Exonic
955572276 3:60320972-60320994 TTGTAGCTCTGCCATTATGATGG - Intronic
956987032 3:74712524-74712546 ATGTATCTGTGGCATGGAGTGGG - Intergenic
956989658 3:74748675-74748697 ATTTTTCTCTGGCAAGATGAAGG - Intergenic
957413544 3:79871453-79871475 CTCTCTCTCTGGCATGATAACGG - Intergenic
957813554 3:85260475-85260497 ACAAATGTCTGGCATGATGATGG + Intronic
959382987 3:105664944-105664966 ACTTAATTCTGGCATGATGATGG + Intronic
960559802 3:119071692-119071714 ATGTATCTCTGGCATGATGATGG - Intronic
961906224 3:130265347-130265369 CTGTATCCCTAGCATGATAATGG + Intergenic
962436612 3:135372764-135372786 ATGTTTCTCTGGTATGGCGAAGG + Intergenic
965671978 3:171156988-171157010 ATGTATCTCTAGCATGTCGTAGG - Intronic
965800154 3:172484181-172484203 ATGTATCTCTGTGTTGAGGAGGG + Intergenic
971524106 4:27594297-27594319 ATGTGTTTTTGACATGATGAAGG - Intergenic
972042158 4:34616273-34616295 CAGTATTTCTGGAATGATGAAGG + Intergenic
972778311 4:42264083-42264105 ATGTATCTTAGCCATGATCAAGG + Intergenic
976218193 4:82734185-82734207 ATGTGGCACTGGCTTGATGAAGG + Intronic
976972778 4:91127987-91128009 ATGTATTTCTGGCATGCTCAGGG + Intronic
980720045 4:136683620-136683642 AAATATATCTGGCATGATAATGG - Intergenic
982871842 4:160589527-160589549 AGGTTTCTCTGGAGTGATGATGG + Intergenic
984809929 4:183786479-183786501 ATGTATTTCGGGCAAGATGGCGG + Intergenic
987562654 5:19543660-19543682 CTGTAATTCTGGCATGGTGATGG - Intronic
993063743 5:83073663-83073685 ATATATCTCTGGGATGTAGAAGG + Intronic
993285121 5:85985915-85985937 ATGTATGTCTGTCTTTATGACGG + Intergenic
994010303 5:94894614-94894636 ATGTGTCTCTGGAAGGAGGAGGG + Intronic
995341277 5:111063400-111063422 ATATCTATCTGACATGATGAGGG - Intergenic
996142650 5:119930958-119930980 TTGTCTCTCTGGCATGATTTTGG + Intergenic
996568788 5:124910003-124910025 ATGTATCTCTGGGAAGGAGAGGG + Intergenic
998892531 5:146761844-146761866 ATGTTTCCCTGGCTTGATGAGGG + Intronic
999279335 5:150354709-150354731 ATTTATGTGTGGCATGATGGAGG - Intergenic
999362940 5:151001304-151001326 GTGTATATCTGGCTTAATGAAGG - Intergenic
1001950917 5:175815901-175815923 ATGTGTGTCAGGCATGATGCTGG - Intronic
1003235578 6:4292701-4292723 ATGTTTCTCAGGTATGTTGAGGG - Intergenic
1004966409 6:20856717-20856739 ATCTGTCTCTGGGATGATGTTGG + Intronic
1010881243 6:81175677-81175699 ATGTTCTTCTGTCATGATGAAGG + Intergenic
1012521981 6:100132392-100132414 GTGTTTCTGTGGCAGGATGAGGG + Intergenic
1014952884 6:127579169-127579191 ATTAATCTCTGGCATGTTTATGG - Intronic
1018805629 6:167257410-167257432 ATGTATGTCTGCCATTGTGATGG + Intergenic
1020967726 7:14893206-14893228 ATGTATTGCTGGAGTGATGAGGG - Intronic
1026638037 7:72101364-72101386 ATGTATCTCTGAAATAATGATGG + Intronic
1027812523 7:82922830-82922852 ATGTCTCTCTAGCAGTATGATGG - Intronic
1028852177 7:95550135-95550157 ATTTATCTCTTCCATGATGATGG + Intergenic
1031278014 7:119756579-119756601 CTGAAACTCTGGCATAATGAGGG - Intergenic
1031436045 7:121733131-121733153 AGTTATCCCTGCCATGATGATGG + Intergenic
1031457969 7:122007708-122007730 AAGTATCTGTAGCATGATCATGG + Intronic
1031871500 7:127093030-127093052 AGGTGTCTGTGGCATGCTGAGGG - Intronic
1033714038 7:143981215-143981237 ATGTTTCTCTGGCATTGTGTGGG + Intergenic
1033771120 7:144553475-144553497 ATGTTTCTCTGGATTGAGGATGG - Intronic
1034905283 7:154939333-154939355 TTGTATCTCTGGCAATATGGTGG - Intronic
1035615623 8:999182-999204 AAGTATCTCTGGCGTGAGGAGGG - Intergenic
1038447128 8:27611904-27611926 TTGTCTCTCTGGCATGACAAAGG - Intronic
1039087456 8:33794074-33794096 AGGTATTTATGGCATCATGACGG + Intergenic
1039229484 8:35427522-35427544 TTGTCTCTCAGGCCTGATGATGG - Intronic
1041653542 8:60325485-60325507 GTGTATTTCTGGCTTGAAGAGGG + Intergenic
1042343095 8:67700915-67700937 ATGTGTTTCTGGCATAAAGAAGG - Intronic
1044162532 8:88936901-88936923 ATGTATTTATGGCATTATGAAGG - Intergenic
1044723458 8:95172581-95172603 ATGTATGGATGTCATGATGAGGG - Intergenic
1046591334 8:116210740-116210762 ATTTCTCTCTGGCATGCTGTTGG + Intergenic
1047433749 8:124817020-124817042 ATGTATCCCTTAAATGATGAGGG + Intergenic
1052239665 9:26255900-26255922 TTGTATCTGGGGCCTGATGAGGG - Intergenic
1052308523 9:27038617-27038639 ATGCTTCTCTGACATGATCAAGG + Intronic
1054873760 9:70074218-70074240 ATGTATTTCAGGCAAGAAGATGG + Intronic
1054933634 9:70663712-70663734 ATTTATCTCTGGTATTAGGATGG + Intronic
1186103564 X:6182119-6182141 CTGTGTCTCAGGCATGTTGAAGG - Intronic
1186194812 X:7099771-7099793 GTGTATCTTTGGCTTGATCATGG - Intronic
1186971315 X:14847828-14847850 ATGAAACTCTGGCAAGATCAAGG + Intronic
1187404104 X:18986843-18986865 AAGTCTCTGTGGCAGGATGATGG - Intergenic
1190378056 X:49810150-49810172 ATGTGTCTTTGGCATGCTAATGG - Intergenic
1201547598 Y:15182737-15182759 CTGTATCCTTGGCATGATTAAGG + Intergenic