ID: 960571365

View in Genome Browser
Species Human (GRCh38)
Location 3:119188175-119188197
Sequence CCCCTTTGGCTTCTCTGTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 139}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960571365_960571370 -10 Left 960571365 3:119188175-119188197 CCAGTACAGAGAAGCCAAAGGGG 0: 1
1: 0
2: 0
3: 18
4: 139
Right 960571370 3:119188188-119188210 GCCAAAGGGGAGACACCTGGGGG 0: 1
1: 0
2: 0
3: 13
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960571365 Original CRISPR CCCCTTTGGCTTCTCTGTAC TGG (reversed) Intronic
900529954 1:3148285-3148307 CACCTGTGGCTGCTCTGTCCTGG - Intronic
901881169 1:12194597-12194619 CCACCTTGGCTTCTCTCTGCAGG - Exonic
902894205 1:19467716-19467738 GCCCTCTGGCCTCTCTGCACTGG - Intronic
904707797 1:32404587-32404609 TCCCTCTGGCTTCTGTGTAAGGG + Intergenic
904786566 1:32987433-32987455 CCCCAGTGGCTTCTCTGCACAGG - Intergenic
905527932 1:38653462-38653484 CACCTGGGGCTTCTCTGTACAGG - Intergenic
906015992 1:42580126-42580148 CCTCATTGGCTTCTCTGTCAAGG - Intronic
910379639 1:86612667-86612689 CACCATTTGCTTCTCTGTAAAGG + Intergenic
911425297 1:97703111-97703133 TCCCTTTGCCTGCTCTGTTCTGG + Intronic
914256511 1:145964383-145964405 CTCCTTTGGCCTCTCTGTAGGGG + Exonic
914992023 1:152507062-152507084 CTCCCTTTGCTTCTCTGTGCTGG - Intergenic
915969891 1:160347134-160347156 CCCCTCTTGTTTCTCTGTACTGG - Intronic
917581414 1:176381917-176381939 CCCCATTGGCTTCAGTGTAAGGG + Intergenic
923505732 1:234604988-234605010 AACCTGTGGTTTCTCTGTACTGG - Exonic
1063420130 10:5906015-5906037 CCTGTTTGGGTTCTCTCTACAGG + Exonic
1064073442 10:12249559-12249581 CTCCTTTTTCTTCTTTGTACAGG + Exonic
1064280945 10:13951091-13951113 CACCCTTGGCTTCTCTCTCCCGG - Intronic
1067088706 10:43255828-43255850 CACCCTTGGCTTCTCTGGGCTGG + Intronic
1067529964 10:47063158-47063180 CCCCTTTGCCTTCCCTGCGCTGG + Intergenic
1067983688 10:51116866-51116888 ACCCTTTGGCATCTCTGTGCAGG + Intronic
1068845108 10:61663041-61663063 CCCCTTTCCCTTCCCGGTACCGG + Exonic
1069942231 10:71963989-71964011 CCCCCTTGGCTTCTCCGTGCCGG - Intergenic
1071467851 10:85957486-85957508 CCCCTTTGGCTTCTGTAAATGGG + Intronic
1072566537 10:96621219-96621241 CCCCTGTAGCCTCTCTGTGCGGG + Intronic
1072944687 10:99799102-99799124 CCCCGTGGCCTTCTCTGTACAGG - Intronic
1075344572 10:121672880-121672902 CTCCTTTGTCTTCTCTTCACTGG - Intergenic
1075960801 10:126566569-126566591 ACCCTTTGCCTTCTCTTTGCCGG - Intronic
1078894517 11:15586133-15586155 CCCCTTTGACTTCTATGGGCGGG - Intergenic
1082584469 11:54918342-54918364 CCCCTTAAGCATCTCTGTAGTGG + Intergenic
1082735361 11:56849285-56849307 CCACTTTGGCTTTTCAGTTCAGG - Intergenic
1084092607 11:66888490-66888512 TCCCTTTGCCTCCTCTGTGCTGG - Intronic
1085151143 11:74253736-74253758 CTCCTTTCCCTTCCCTGTACTGG + Exonic
1086959967 11:92971529-92971551 TCCCTTTTGCTTCCCTGTGCTGG - Intronic
1088787158 11:113192624-113192646 CCTCTTTGCCTGCTCTGTCCCGG - Intronic
1089584599 11:119502433-119502455 CCCGTTGGGCTTCCCTGTACTGG + Intergenic
1090587839 11:128233585-128233607 ACCTTTGGGCTTCTCTGTCCGGG + Intergenic
1092166523 12:6346085-6346107 CTCCTTTGGCTCCTCAGAACAGG + Intergenic
1092217638 12:6694209-6694231 CCCTTTTGTCTTGTCTGTCCTGG - Exonic
1101199683 12:102421496-102421518 ACCCTTTGGCTTCTCTCTTGTGG + Intronic
1104450038 12:128861513-128861535 CCCCTTGGGCTTCCCTGCTCTGG - Intronic
1105895626 13:24715238-24715260 TCACTTTGGCTTCTGTGTAGAGG + Intergenic
1108017791 13:46094573-46094595 CCCGCCTGGCTTCTCTATACAGG - Intronic
1110117849 13:71842325-71842347 CCACTTTGGCTTCCCAGTGCTGG - Intronic
1110242180 13:73281604-73281626 CCTCTTTGGCCTGTCTGAACAGG - Intergenic
1113081557 13:106525746-106525768 CCACCTGGGCTTCTCTCTACAGG + Intronic
1113549915 13:111184811-111184833 CCCCGTGGGCTTCACTGTGCGGG + Intronic
1113955463 13:114098081-114098103 CCACTTGGGCCTCTCTGTGCTGG - Intronic
1117856182 14:60036443-60036465 GCCCTTTGGCTTCTCTGGTCTGG - Intronic
1122972323 14:105157381-105157403 CCCCCTCTGCTTGTCTGTACTGG - Intronic
1123060487 14:105592158-105592180 CCCCTTTGCCATCTCTGTCTCGG - Intergenic
1123068053 14:105628051-105628073 CCCCTGTGGCTGCTCTGCCCTGG + Intergenic
1123084965 14:105713129-105713151 CCCCTTTGCCATCTCTGTCTCGG - Intergenic
1125368826 15:38948110-38948132 CCCCTGTGGCTTCTCTTTTGTGG + Intergenic
1128732853 15:70032906-70032928 CCCCTGTGGCATCTCTGGATAGG - Intergenic
1129600752 15:76996772-76996794 CTCCATTGGCTTCTCTGGGCTGG - Intronic
1132611163 16:816981-817003 TCCTCTTGGCTTCTCTGCACAGG + Intergenic
1133382611 16:5344018-5344040 CCTCTTATGCTTCTCTGTGCTGG + Intergenic
1134010267 16:10846871-10846893 CCCCTGTGGTTTCTCTGTCTTGG + Intergenic
1134484894 16:14649919-14649941 GCCCTTGGGCATCTCTTTACAGG + Exonic
1136414849 16:30096596-30096618 TCCCGTTGGCTCCACTGTACCGG + Intronic
1137978856 16:53053345-53053367 AACCTTTGGACTCTCTGTACTGG - Intergenic
1138348217 16:56332736-56332758 GCCCTCTGGCCTCTCTGTGCTGG - Intronic
1139144724 16:64309531-64309553 CCCCTTTGGCTGCTGTGAATAGG - Intergenic
1139187379 16:64822862-64822884 CCCATTTGAGTCCTCTGTACAGG + Intergenic
1139344558 16:66294140-66294162 CCCCTCTGGCTCCTCTCTGCAGG - Intergenic
1143252369 17:5533039-5533061 CCCCTATGGCTGCACTGTAAGGG + Intronic
1146690413 17:34871136-34871158 CCCCTTTGTTTTCTCTGTTTTGG + Intergenic
1148680726 17:49472153-49472175 CTCCTGAGCCTTCTCTGTACTGG + Intronic
1150454226 17:65294158-65294180 TCCCTTTTGCTTCTGTGTTCAGG + Intergenic
1152122903 17:78429516-78429538 CCCCTTTGGCTTCTCTCACAAGG + Intronic
1153795493 18:8618186-8618208 CTCCTTGTGCTTCTGTGTACAGG + Intronic
1155163827 18:23216943-23216965 CTCATTTTGCTTCTCTGTCCAGG - Intronic
1156821834 18:41382462-41382484 GACCTTTGGCTTCTCTTTAGTGG - Intergenic
1158425178 18:57333755-57333777 CCATCTTGGCTTCTCAGTACAGG - Intergenic
1159042613 18:63339194-63339216 CCCCTTTGACTCCTCAGTGCTGG + Intronic
1161317701 19:3625860-3625882 CCATTTTGGTTTCTCTGTACTGG + Intronic
1162144835 19:8607295-8607317 CATCTTTGGATTCTCTGCACTGG + Intronic
1162704623 19:12546166-12546188 CACCTTTGGCTTCTTTCTGCTGG - Intronic
1162791439 19:13065116-13065138 CCCCTTCGGCCCCTCTGTGCTGG + Intronic
1167205015 19:48095557-48095579 CCACGCTGGCTTCTCTGCACTGG - Exonic
929870855 2:45758065-45758087 ACCCTCAGCCTTCTCTGTACTGG - Intronic
930737509 2:54794536-54794558 CCCCTCTGGCTTCTGTAAACTGG + Intronic
931180173 2:59891643-59891665 CCCCTCTGGGCTCTGTGTACTGG - Intergenic
935067783 2:99665796-99665818 CCCCTCTGGCTTCTCTTCTCAGG - Intronic
936900310 2:117474468-117474490 CAGCTTTTGCTTCTCTGTAAAGG - Intergenic
941005733 2:160245114-160245136 CCACTCTGGCTTCTGTGTGCTGG - Intronic
941036653 2:160576057-160576079 CTTCTGTGGCTTCTCTGTGCTGG + Intergenic
942982244 2:182096247-182096269 CCTTTTTGGCTTCTGGGTACAGG + Intronic
948895650 2:240925702-240925724 GCCCTGTGGGTTCTCTGTCCAGG + Exonic
1174695943 20:52558966-52558988 CCTCTTTGTCTTTTGTGTACTGG + Intergenic
1175332947 20:58177370-58177392 CCCCACTGGCATCTCTGAACTGG + Intergenic
1175339406 20:58218674-58218696 CCCCCTTGGCATCTCTGTCGTGG + Exonic
1175672180 20:60913345-60913367 TCCCTTTGGCTTCTTTCTACTGG - Intergenic
1175818164 20:61894405-61894427 ACCCTTTCCCTTCTCTGTGCAGG - Intronic
1176038427 20:63051692-63051714 CCTCTGTGGCCTCTCTGTCCTGG - Intergenic
1179243658 21:39612332-39612354 GCCCTCTGACTTCTCTGTGCCGG + Exonic
1180194999 21:46188590-46188612 CCCCGTCGGCTTCTCGGTGCTGG - Exonic
1180799606 22:18625671-18625693 CCCCTTTTGCTTGCCTGGACTGG + Intergenic
1181222110 22:21369595-21369617 CCCCTTTTGCTTGCCTGGACTGG - Intergenic
1182359835 22:29739960-29739982 CCCCTTAAGCTTCTCTGTCCAGG - Intronic
1183723320 22:39574744-39574766 CCCCTTTGGGTTCTCAGTGGGGG - Intronic
950271639 3:11620704-11620726 CCCCTTGGCCATCTCTGTCCTGG + Intronic
950413242 3:12852833-12852855 CCCCTTTGGCTCCTCTTGGCTGG - Intronic
954950740 3:54470360-54470382 CACCATTTGCTTCTCTGTAAAGG - Intronic
956482246 3:69684847-69684869 CCTCTGTGGCTGCTCTGTAAGGG + Intergenic
956587585 3:70881020-70881042 CCCTCTTGGCTTCTCTTTTCTGG - Intergenic
960571365 3:119188175-119188197 CCCCTTTGGCTTCTCTGTACTGG - Intronic
962553331 3:136519300-136519322 AACCTTTGGCTTCTCTGTAGGGG - Intronic
965692311 3:171370887-171370909 CGCCTTTGGCCTGTCTCTACTGG + Intronic
965919890 3:173900066-173900088 CCCTTTTGTCCTCTCTGTTCTGG - Intronic
967702815 3:192613678-192613700 CACCTTTGACTTCTCTTAACTGG - Intronic
968622534 4:1610354-1610376 CCCCTTGGGCTCCCCTGCACGGG - Intergenic
969970827 4:11046463-11046485 CCACATTTGCTTCTCTGTAAAGG + Intergenic
970037401 4:11753293-11753315 CAACTTTGGCCTCACTGTACAGG - Intergenic
970082337 4:12301800-12301822 CCACTTGGGCTTCAGTGTACAGG - Intergenic
970096754 4:12472195-12472217 CACCTTTGGCTTCCCTGGGCTGG + Intergenic
970450240 4:16159048-16159070 CCCCTTTGGCCTCTTTTTAGAGG - Intergenic
974391938 4:61281936-61281958 CCCATTTTGTTTCTCTGTACTGG + Intronic
976852683 4:89566795-89566817 CCACTTAGGCTTGTCTGTAAAGG + Intergenic
981722631 4:147816711-147816733 GCATTATGGCTTCTCTGTACAGG - Intronic
982042670 4:151410398-151410420 CTCCCTTGGCTTCTCTGGAAGGG + Intronic
982304328 4:153914049-153914071 CCCCTTTCTCATTTCTGTACAGG + Intergenic
983740189 4:171121297-171121319 CCACTTTGGCTTCTAAGTGCTGG + Intergenic
987457532 5:18165542-18165564 CCCCTTTGGGGACTCTGTATGGG + Intergenic
987981720 5:25094571-25094593 CCCATTTGGATTCCCTGTACTGG - Intergenic
990861509 5:60332865-60332887 ACCCTTTGACTTCTCTGTTAGGG - Intronic
997719564 5:136066740-136066762 CTCATTTGACTTCTCTGGACAGG - Intergenic
1003233620 6:4276354-4276376 CCACTTTTGCTTCTCTGCATGGG + Intergenic
1005873512 6:29994739-29994761 CTCCCTGGGCTTCTCAGTACAGG - Intergenic
1006037134 6:31222763-31222785 CTCCCTGGGCTTCTCAGTACAGG + Intergenic
1011670053 6:89674589-89674611 TCCCATGGGTTTCTCTGTACAGG - Exonic
1011735536 6:90306839-90306861 CCTCCTTGGCCTCTCAGTACTGG + Intergenic
1020371298 7:7434791-7434813 GCCACTTGGCTTTTCTGTACTGG + Intronic
1020609254 7:10374466-10374488 CAGCTTTTGCTTATCTGTACAGG - Intergenic
1026833952 7:73625822-73625844 CCCCTTGGGCCTCTCTGTGCAGG - Intergenic
1030650297 7:112110098-112110120 GCCCTTTGGCTTCTCTGAGAGGG - Intronic
1034954208 7:155323982-155324004 ACCCTTTGTCTTTTATGTACAGG + Intergenic
1039503231 8:38032875-38032897 CCATTTTGGCTTCTCTGCCCTGG - Intronic
1041081922 8:54222299-54222321 CCCCTTTGAGTTCTGTGGACAGG - Intergenic
1043766926 8:84147186-84147208 TCTCTTTGGTTTCTCTGTTCAGG - Intergenic
1047566438 8:126048701-126048723 TCTCTGTGGCTTCTCTGTAAAGG + Intergenic
1048594814 8:135855135-135855157 CCGATTTGCCTTCTCTGTCCTGG - Intergenic
1049308886 8:141922923-141922945 CTCCCATGGCTTCTCTATACTGG + Intergenic
1052400963 9:27999227-27999249 CCCTCTTGGCTTCTCTGTCTTGG - Intronic
1056499175 9:87190878-87190900 ACCCTGGGGCTTCTCTGTCCTGG - Intergenic
1057392464 9:94651202-94651224 GCCCTTTGGCTTCTCCTGACTGG + Intergenic
1059431452 9:114252853-114252875 CTCCTTTGTCTTCTCTGTCTTGG + Intronic
1060404812 9:123367967-123367989 CCCCCTTTCCTTCTCTGTCCTGG - Intronic
1186834542 X:13424702-13424724 CCCTTTAGGCTAGTCTGTACAGG - Intergenic
1188107729 X:26163959-26163981 CCCCTCTGGTTTCTCAGTAAAGG + Intergenic
1188111117 X:26197181-26197203 CCCCTCTGGTTTCTCAGTAAAGG + Intergenic
1188200424 X:27288997-27289019 CCCCATTGGGTTCACTGTTCCGG - Intergenic
1189705127 X:43751970-43751992 TCCCTTTGGCCTGTCTGAACTGG - Intergenic
1190939489 X:55026744-55026766 CCCCTTTCTCTTCTCTGTCTTGG - Intronic
1190941973 X:55051021-55051043 CCGCTTTTGCTTGTCTGTAAAGG + Intergenic
1196501470 X:116388263-116388285 TGCCCTTGGTTTCTCTGTACAGG + Intergenic
1198810139 X:140527175-140527197 CCCCTTTGCCTTCTCTGAAATGG - Intergenic
1199445277 X:147912700-147912722 CTCCTTTGGCTTCTCTTTTCCGG + Intronic