ID: 960572169

View in Genome Browser
Species Human (GRCh38)
Location 3:119196047-119196069
Sequence ATGATGAATTTGTAGTTGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 243}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960572169 Original CRISPR ATGATGAATTTGTAGTTGGT AGG (reversed) Intronic
900973799 1:6005604-6005626 CTGGTGTATTTGTAGTTGGAAGG + Intronic
902061045 1:13643110-13643132 TTGAAGAAGTGGTAGTTGGTTGG + Intergenic
902722846 1:18315615-18315637 ATGATGGATTGGTAGATGGTAGG + Intronic
904231902 1:29081284-29081306 ATGATGAATTTGTCTTTTATGGG + Intronic
904281496 1:29423599-29423621 ATGTTGTATATGTTGTTGGTTGG + Intergenic
905717333 1:40162971-40162993 TTGATGAACTTACAGTTGGTGGG + Intronic
905735026 1:40318923-40318945 AAGAAGAATTTGAAGTTTGTTGG + Intergenic
905854861 1:41303105-41303127 TTGAAGAAGTGGTAGTTGGTTGG + Intergenic
906438454 1:45818029-45818051 TTGAAGAAGTGGTAGTTGGTTGG + Intronic
907630112 1:56072523-56072545 CTTATCAATTTATAGTTGGTGGG - Intergenic
908339881 1:63166320-63166342 ATGATGAATTTTTAGTTATTTGG + Intergenic
909247957 1:73312690-73312712 ATGATGATCTTGGAGTTGGGTGG + Intergenic
909299387 1:73992480-73992502 TTGAAGAAGTGGTAGTTGGTTGG - Intergenic
909559511 1:76994030-76994052 ATAATGACATTGTAGTTGTTTGG - Intronic
909956052 1:81780391-81780413 ATGATGAATCTGCAGCTTGTAGG - Intronic
910290503 1:85595984-85596006 ATGAGCAATTTGTACATGGTGGG + Intergenic
911099060 1:94079603-94079625 ATGATGAGCTTGTTATTGGTGGG - Intronic
911319589 1:96396388-96396410 ATGATGAATTTTTGGTGAGTGGG + Intergenic
911524678 1:98969974-98969996 ATGATGAATTTGAAATTGCAAGG - Intronic
912019516 1:105089452-105089474 TTGAAGAAGTGGTAGTTGGTTGG - Intergenic
915261625 1:154680922-154680944 ATGAGGAAATTAAAGTTGGTGGG + Intergenic
915738926 1:158103205-158103227 ATGGTGAATATGTAGTTTGAGGG + Intergenic
916208490 1:162338594-162338616 TTAACGACTTTGTAGTTGGTTGG - Intronic
916519586 1:165551839-165551861 TGGATGACTTTGTACTTGGTAGG - Intronic
916870545 1:168910012-168910034 TTGAAGAAGTGGTAGTTGGTTGG - Intergenic
918263361 1:182817460-182817482 ATGAAGAATTGGTTGTTGGTGGG - Intronic
918490983 1:185081318-185081340 TTGAAGAAGTGGTAGTTGGTTGG + Intronic
918762296 1:188426892-188426914 ATAATGAATTTGTAAGTGGTGGG + Intergenic
919026365 1:192176292-192176314 ATGATGTATTTGGAATTTGTGGG - Intronic
923354644 1:233142370-233142392 TAAATGAATTTGTAGTTGGAGGG - Intronic
1064330531 10:14389924-14389946 CTGAAGAAGTGGTAGTTGGTAGG - Intronic
1064572081 10:16704209-16704231 ATGATGATTCTCCAGTTGGTAGG - Intronic
1064749548 10:18512808-18512830 TTGAAGAAATGGTAGTTGGTTGG + Intronic
1067133303 10:43585713-43585735 ATGGTGAATTCTTAGTTGTTTGG + Intergenic
1067751678 10:48975883-48975905 ATAATGGATTGGTAGATGGTGGG + Intronic
1067916548 10:50406140-50406162 ATGGTGAATTTGTAGCTGAGAGG - Intronic
1068325977 10:55486929-55486951 ATGTTGAAGTTTTAGTAGGTAGG - Intronic
1068773879 10:60851054-60851076 AGCATAAATTTGTAGATGGTAGG - Intergenic
1071505261 10:86228114-86228136 TGGATGAATATGTAGGTGGTTGG + Intronic
1071859610 10:89658801-89658823 CTGAGGAATTTGTAGCTGGTTGG - Intergenic
1073352719 10:102831292-102831314 AGGGTGAATTTGCAGTTGGTTGG + Intronic
1073913430 10:108373876-108373898 ATATTGAATTTGTAGTTGACAGG + Intergenic
1078967673 11:16365466-16365488 ATGTTGTTTTTGTGGTTGGTGGG - Intronic
1083543199 11:63529202-63529224 TTGATGAATGAGTAGTTGGTGGG + Intergenic
1086073454 11:82824464-82824486 ATGATGTAATTGCAGCTGGTAGG - Exonic
1086942722 11:92815128-92815150 ATAATGAATTTGGAGTTTGGGGG + Intronic
1087315793 11:96600694-96600716 CAGAAGAATGTGTAGTTGGTAGG - Intergenic
1087355981 11:97095123-97095145 ATTATGTATTTGAAGTTGGAGGG - Intergenic
1087710899 11:101550188-101550210 ATGATGATTTTGTAATTGTTGGG - Intronic
1087785703 11:102352037-102352059 ATGGTGAATTAGTACTTGATGGG - Intronic
1089290386 11:117434259-117434281 ATGATGAATTAATGGTTGGTTGG - Intronic
1090214478 11:124949384-124949406 TTGAAGAAGTGGTAGTTGGTTGG + Intergenic
1091683587 12:2544742-2544764 TTGAAGAAGTGGTAGTTGGTTGG + Intronic
1093146960 12:15578071-15578093 AAGATGGATCTGTAGTTGTTGGG - Intronic
1093444732 12:19243629-19243651 AAGGAGAATTTGTAGATGGTGGG + Intronic
1093718295 12:22409077-22409099 ATGAAGAATTTGTATTTGCTTGG + Intronic
1093743068 12:22710189-22710211 AAGTTCAATTTGTGGTTGGTTGG + Intergenic
1093999998 12:25684644-25684666 TTGAAGAATTGGTAGTTGGTTGG + Intergenic
1095377535 12:41548126-41548148 ATGAATAATTTGGAGTTGGAGGG + Intronic
1095622948 12:44280394-44280416 ATGCTGAAATTGTAGCGGGTGGG - Intronic
1099815708 12:87644702-87644724 CTTATGAATTTGGAGTTGGCCGG - Intergenic
1100056818 12:90521968-90521990 ATGGTTACTTTGTAGTTTGTTGG - Intergenic
1104308161 12:127629072-127629094 ATGTTCAAATTGTAGTTGGAAGG + Intergenic
1106108700 13:26758941-26758963 ATGATGGAATTGTAGGTGGCGGG + Exonic
1107187641 13:37543399-37543421 TTGAAGAAGTGGTAGTTGGTTGG + Intergenic
1108807289 13:54174682-54174704 ATGAACAATTTTTAGTTAGTAGG - Intergenic
1110642759 13:77844867-77844889 AGGATACATTTGTAGATGGTTGG - Intergenic
1112589754 13:100752065-100752087 ATGCAGAATTTGGAGTTGATTGG + Intergenic
1113178394 13:107595501-107595523 ATGAAGCATGTGTAGATGGTGGG - Intronic
1113478641 13:110603999-110604021 TTGAAGAAATGGTAGTTGGTTGG + Intergenic
1113557004 13:111244971-111244993 TTGAAGAAATGGTAGTTGGTTGG + Intronic
1113780231 13:112972567-112972589 ATGATGAATGGGTAGATGGATGG + Intronic
1115663163 14:35517441-35517463 ATTATGAATTAGTATTTGGGAGG + Intergenic
1116225847 14:42151485-42151507 ATGATGAGTTTGTCCTTTGTAGG - Intergenic
1116603123 14:46953725-46953747 ATGAAGAAAGTGTAGTTAGTGGG + Intronic
1118071162 14:62248038-62248060 AGGAGGAATTTGTATCTGGTAGG + Intergenic
1118206606 14:63728637-63728659 ATTTTGAATTTGTAGGTGGCTGG - Intergenic
1119915727 14:78399652-78399674 CTGGTGAATTTGTGGTTAGTTGG + Intronic
1121822802 14:96984958-96984980 CTGATGAGTTTCTAGGTGGTTGG + Intergenic
1123889330 15:24759980-24760002 TTGAAGAAATGGTAGTTGGTTGG + Intergenic
1125294716 15:38190315-38190337 AATATGAATTTGTAGCTGGAAGG - Intergenic
1125404754 15:39340628-39340650 ATGAAAAATTTATAGTTAGTTGG + Intergenic
1125466553 15:39958796-39958818 ATGATCAATGTGTAGATGTTGGG - Intronic
1128386011 15:67149014-67149036 ATGATGAATTTGAAGAGTGTGGG + Intronic
1128477820 15:68012519-68012541 CTCATGAATTTGTTGTGGGTAGG - Intergenic
1130222517 15:82032498-82032520 AAGATGAAGTTGCAGGTGGTAGG - Intergenic
1131329926 15:91487513-91487535 TTGAAGAAGTGGTAGTTGGTTGG + Intergenic
1131652596 15:94417431-94417453 AAATTGAATTTGTAGTTGCTGGG + Intronic
1132269595 15:100512191-100512213 AGGATGAATTTGGAGTTGAGAGG - Intronic
1132368072 15:101272514-101272536 ATGGTTAATTGCTAGTTGGTAGG - Intronic
1133834716 16:9357353-9357375 ATGAAATATTTTTAGTTGGTAGG - Intergenic
1135870116 16:26141959-26141981 AAGATGAATTTCTAGTAGTTTGG - Intergenic
1138870263 16:60874768-60874790 TTGTTGAATTTGTGGTAGGTGGG + Intergenic
1139036034 16:62947738-62947760 AGGATGATTTTGGAGTTGGCTGG + Intergenic
1139363229 16:66416449-66416471 ATCATGATTTTGTTGTTGTTAGG - Intergenic
1139659709 16:68412189-68412211 ATGAGGAATGAGCAGTTGGTGGG + Intronic
1144095386 17:11895709-11895731 AGAATGGATTCGTAGTTGGTAGG - Intronic
1147431425 17:40373250-40373272 CTGAAGAATTTGGAGTTGGGGGG - Intergenic
1151105861 17:71616513-71616535 ATGATGCATTTATTGTTGGCAGG - Intergenic
1153170407 18:2310034-2310056 ATGATGATTTTGTGATTGCTAGG + Intergenic
1153284217 18:3443365-3443387 ATGAAGAAGTTGTAGTCTGTGGG - Intronic
1154461627 18:14595405-14595427 GAGATGAATTTATAGTTGGGAGG + Intergenic
1155453172 18:25984127-25984149 ATTCTGAATTTGGGGTTGGTGGG - Intergenic
1155777994 18:29792714-29792736 TTGAAGAAGTGGTAGTTGGTTGG + Intergenic
1156517348 18:37691912-37691934 GGCATGAATTTGTTGTTGGTAGG + Intergenic
1157551007 18:48581974-48581996 ATGATGGGTTTGGAGTTGGGTGG + Intronic
1157935770 18:51871442-51871464 AACATGTATTTGTAGTTGATAGG + Intergenic
1159757328 18:72381478-72381500 CTCATGAATGTGTAGTCGGTAGG - Intergenic
1159831902 18:73287267-73287289 ATGATGAATGCCTAGGTGGTTGG - Intergenic
1164718202 19:30409074-30409096 ATGATGGATTTGTGGGTGGATGG - Intronic
1165919082 19:39281516-39281538 TTGAAGAAGTGGTAGTTGGTTGG - Intergenic
1165990765 19:39811822-39811844 ATGATGAATCTATAATTGGTAGG + Intergenic
925841191 2:7994028-7994050 ACCCTGAATTTGTAGTTGGCCGG - Intergenic
926284749 2:11479949-11479971 CTAATGAATTCTTAGTTGGTAGG + Intergenic
926915334 2:17885948-17885970 GTGATCAATTTGTAGTTGTAGGG + Intronic
927389379 2:22576712-22576734 ATGGTGAATTTGTCATTAGTAGG + Intergenic
928192261 2:29182442-29182464 ATGATAATTTTGGAGTTGGAAGG + Exonic
928688729 2:33776597-33776619 ATGATGCATCTGGAATTGGTGGG - Intergenic
930360395 2:50370714-50370736 AAGATGAATTTATGGTTGGGAGG + Intronic
932388133 2:71357530-71357552 AAGGTGAATTTTTAGTTGGATGG + Intronic
932788040 2:74625524-74625546 AGGATGAATTTGGAGTTGAGAGG - Intronic
934896842 2:98126937-98126959 ATGGTTGATTTCTAGTTGGTTGG - Intronic
935281314 2:101520388-101520410 ATGATGCAATTGCAGCTGGTAGG - Intergenic
935440360 2:103087578-103087600 TTGAAGAAGTGGTAGTTGGTTGG + Intergenic
935806196 2:106750156-106750178 ATGATAAATTAGTAGTTTGGAGG - Intergenic
939570296 2:143832688-143832710 ATGAAGCATTTGTTGTGGGTGGG + Intergenic
939879029 2:147608985-147609007 ATGATGTATTTGTTGTGTGTAGG - Intergenic
941646092 2:168042971-168042993 ATGTTAAATATGTATTTGGTAGG + Intronic
941960582 2:171249553-171249575 ATGTGGAATTTTTAGTTGGGTGG - Intergenic
945275971 2:207988012-207988034 AATATGAATTTGTATTTGCTGGG - Intronic
946949130 2:224853261-224853283 ATGAAAAATTTGTAGGAGGTGGG + Intronic
947982418 2:234421680-234421702 ATAATGTATTTGTATTTAGTGGG + Intergenic
948022467 2:234747060-234747082 TTGAAGAAGTAGTAGTTGGTTGG - Intergenic
1169526083 20:6427334-6427356 TTGAAGAACTGGTAGTTGGTTGG + Intergenic
1171182662 20:23102388-23102410 ATGATGTTTTTGTAGTTTGCGGG + Intergenic
1173262583 20:41450148-41450170 TTAATGATTTTGTAGTTGTTGGG - Intronic
1173759925 20:45550374-45550396 ATGATGAATATGTATTTTGATGG + Intergenic
1176054830 20:63139389-63139411 ATGACGAATTTGGAGGAGGTTGG + Intergenic
1176788117 21:13284012-13284034 TTGAAGAAGTGGTAGTTGGTTGG + Intergenic
1177664117 21:24130470-24130492 AGGCTGAATTTGGAGCTGGTAGG - Intergenic
1177987258 21:27992216-27992238 TTGAAGAAGTGGTAGTTGGTTGG + Intergenic
1178035472 21:28577790-28577812 ATGATGAATTGGATGTGGGTAGG - Intergenic
1178788742 21:35678404-35678426 ATGATGAATGGGTGGTTGGATGG + Intronic
1179390243 21:40982407-40982429 GTGCAGAATTTGTTGTTGGTGGG - Intergenic
1183875722 22:40779011-40779033 ATGATACCTTTGTAGTTTGTTGG + Exonic
1184037338 22:41924998-41925020 ATGCCTAATTTGTAGTTGGGTGG - Intergenic
952294148 3:32046673-32046695 TGGATGAATTGGTGGTTGGTTGG - Intronic
952985801 3:38781542-38781564 TTGAAGAAGTGGTAGTTGGTTGG - Intronic
953990125 3:47477068-47477090 CTGAAGAATGTGTAGTGGGTCGG - Intronic
954750219 3:52809378-52809400 ATGATGAATAGGTAGCTGGGGGG - Intergenic
954806120 3:53221893-53221915 ATTATGAATTTGGGTTTGGTTGG - Intergenic
956686838 3:71837112-71837134 ATGAAGAATTCTTAGTTGGATGG + Intergenic
957237552 3:77614172-77614194 TAGATGAATTTGTAAGTGGTGGG + Intronic
958862864 3:99466305-99466327 CTCTTGAATTTGTAGTTGGTTGG - Intergenic
959831182 3:110864529-110864551 AAGATGAATATGTAGAAGGTAGG + Intergenic
959952163 3:112192280-112192302 ATGATGGAATTGTAGTTGCCAGG - Intronic
960336004 3:116418440-116418462 AACAAGAATTTGTAGCTGGTTGG - Intronic
960558993 3:119061565-119061587 AAGATGCATTTGTTGTTGGTTGG - Intronic
960572169 3:119196047-119196069 ATGATGAATTTGTAGTTGGTAGG - Intronic
962184003 3:133239144-133239166 ATGATGAATTTGTAAGGGGTGGG - Intronic
964483768 3:157166104-157166126 ATAATGCATTTATAGTAGGTTGG - Intergenic
964861932 3:161212342-161212364 ATGATGAATTGGCAATTGGAAGG + Intronic
965855357 3:173081472-173081494 ATTATGATTTTGTATTTGTTTGG - Intronic
966053488 3:175652383-175652405 ATATGGAATTTGTATTTGGTGGG - Intronic
966572986 3:181467873-181467895 AGGAACAATTTATAGTTGGTTGG - Intergenic
969572936 4:8020635-8020657 TTGGCGAATTTGCAGTTGGTTGG - Intronic
970402979 4:15735637-15735659 ATTATGAATTGGAAGTTGGTTGG - Intronic
971105341 4:23518131-23518153 TTGATGAATTAATGGTTGGTAGG - Intergenic
971704222 4:30018519-30018541 ATCAAGAATTTGAAGTTGGGAGG - Intergenic
971823024 4:31584262-31584284 ATAATTAATTTGTATGTGGTAGG - Intergenic
972226840 4:37023268-37023290 TTGAAGAAGTGGTAGTTGGTTGG - Intergenic
973059000 4:45695798-45695820 CTGAAGAAGTGGTAGTTGGTAGG - Intergenic
977258548 4:94768683-94768705 ATGATGATTTGGTATTTTGTAGG + Intronic
979018386 4:115464100-115464122 ATGCTGGATTTGTAGTCAGTTGG + Intergenic
982972982 4:162014486-162014508 ATGATGATGTTATAGTTAGTTGG + Intronic
983621694 4:169768663-169768685 AGCATGAATTTGTGGTAGGTAGG + Intergenic
988753492 5:34217847-34217869 ATGATTCGTTTGTAGATGGTTGG + Intergenic
990412614 5:55555987-55556009 ATAATGAATTTGTATTTTTTTGG - Intergenic
990627989 5:57635811-57635833 AGCATGAATTTGAATTTGGTGGG - Intergenic
990958151 5:61364274-61364296 ATTCTAAAATTGTAGTTGGTAGG + Intronic
991624883 5:68590394-68590416 TTGAAGAAGTGGTAGTTGGTTGG - Intergenic
992513416 5:77464770-77464792 ATGATGGAATTGTAGTTGTGTGG - Exonic
992678670 5:79131135-79131157 TTGATGAATTTCTAGGTGTTTGG + Exonic
993404156 5:87490050-87490072 ATTTTGAATTTGTTTTTGGTCGG + Intergenic
995380447 5:111526006-111526028 TTGAGGAAGTAGTAGTTGGTTGG + Intergenic
996447140 5:123568009-123568031 TTGAAGAAGTAGTAGTTGGTTGG + Intronic
999007701 5:148001037-148001059 ATGATGAATTGGTGGTGTGTTGG + Intergenic
999580557 5:153033787-153033809 ATAATGAATTTGTTGCAGGTGGG + Intergenic
1001735366 5:173994058-173994080 CTGAAGAAGTGGTAGTTGGTTGG + Intronic
1001860892 5:175054108-175054130 CTGATTAATTTGTTGTTGGAAGG + Intergenic
1002774065 6:314025-314047 ATGATGTGTTTGGAGTCGGTGGG + Intronic
1002916301 6:1530452-1530474 ATGCTTAATTGGTAGCTGGTTGG - Intergenic
1003243650 6:4366336-4366358 ATGATAAATTTGTAGCGGGTTGG + Intergenic
1003978260 6:11364740-11364762 ATGATAGATTTCTAGTTAGTAGG - Intronic
1004986073 6:21084458-21084480 TTGATGAATTTTTAGTTTTTAGG + Intronic
1005892443 6:30151010-30151032 ATGATGAATGTGTCATTAGTTGG + Intergenic
1008802173 6:55382183-55382205 ATGGTGAATTTGTAGTCCATTGG + Intronic
1010070150 6:71734552-71734574 ACCATGAATGTGTAGTTGCTAGG + Intergenic
1010562787 6:77371228-77371250 ATGAAGAATAAGTAGGTGGTAGG - Intergenic
1010674466 6:78725029-78725051 ATGATTATTTTGGAGTTTGTGGG - Intergenic
1011764654 6:90607023-90607045 ATTTTGAAATTGTAGTAGGTTGG + Intergenic
1012575213 6:100787358-100787380 ATGATTAATTTGTAATTTTTAGG - Intronic
1014353606 6:120375774-120375796 ATGATCAAATTGTCTTTGGTAGG - Intergenic
1014710197 6:124797501-124797523 TTGATGCATTTGTGCTTGGTTGG - Intronic
1014720135 6:124906613-124906635 ATGATGAATTATTTGATGGTAGG + Intergenic
1017466658 6:154700459-154700481 AAGAAGAATATGTAGTTTGTTGG - Intergenic
1022157007 7:27670860-27670882 AAGATGAATTGGAAGTGGGTTGG - Intergenic
1023003499 7:35838144-35838166 ATTATTATTTTGTTGTTGGTAGG + Intronic
1024442784 7:49440766-49440788 ATGATTAATTGGAAGTTGGTGGG + Intergenic
1026240354 7:68568809-68568831 TTGAAGAAGTGGTAGTTGGTTGG - Intergenic
1027527638 7:79290748-79290770 ATGATGACTTAATAGTTGTTTGG - Intronic
1028024273 7:85817120-85817142 AGGCTGGATTTGAAGTTGGTTGG - Intergenic
1030495429 7:110293063-110293085 TTGAAGAAGTGGTAGTTGGTTGG + Intergenic
1031150135 7:118044705-118044727 CCCATGAAGTTGTAGTTGGTTGG + Intergenic
1031583209 7:123502707-123502729 ATGTTGTATTTGTAGTTTGTTGG + Exonic
1031649720 7:124273303-124273325 TTGAAGAAGTGGTAGTTGGTTGG + Intergenic
1032984056 7:137317369-137317391 ATTATGATTTTGGAGGTGGTTGG - Intronic
1035452725 7:158988726-158988748 ATGATGAATGGATAGTTGGATGG - Intergenic
1035476359 7:159146509-159146531 ATGATAAATAGGTAGATGGTAGG - Intergenic
1037465965 8:19160903-19160925 ATGCTGAAGTTGTGGTTGTTAGG - Intergenic
1040697288 8:50015848-50015870 TTGAAGAAGTTGTAGTCGGTTGG + Intronic
1040905025 8:52459679-52459701 GACATGAATTTGTATTTGGTTGG - Intronic
1041069730 8:54115625-54115647 TTGAAGAAGTGGTAGTTGGTTGG + Intergenic
1041137015 8:54769562-54769584 ATGATGAATGTGTAATAGGATGG + Intergenic
1041276829 8:56169018-56169040 TTGAAGAATTTGTATTTGTTAGG - Intronic
1041745772 8:61207725-61207747 ATGATTATAATGTAGTTGGTTGG + Intronic
1041864484 8:62554405-62554427 ATTTTGAAGTTGTAGTTGTTTGG - Intronic
1042071471 8:64940352-64940374 ATGAAGAATGTGTAGTTTATGGG + Intergenic
1046224056 8:111253420-111253442 AAGATGAATTTGTGGTTGAGAGG + Intergenic
1047523211 8:125611674-125611696 CTGCTGAATTTGTAGTGGGATGG + Intergenic
1050703152 9:8364467-8364489 ATGAGGAAATTGTAGCTGATGGG + Intronic
1050912776 9:11094430-11094452 ATGATGAATTTCATGTTGGGAGG - Intergenic
1051234355 9:14982842-14982864 AGCATGAATTTGTGGTAGGTAGG - Intergenic
1051965331 9:22821576-22821598 CTGAAGAAGTGGTAGTTGGTTGG - Intergenic
1052545631 9:29874200-29874222 ATGTTGTTTTTGTAGTTGGCAGG + Intergenic
1052886592 9:33655056-33655078 TTGAAGAAGTGGTAGTTGGTTGG - Intergenic
1053791212 9:41687533-41687555 AGGTTGAATTTGTAGTTGTGAGG - Intergenic
1054153941 9:61627239-61627261 AGGTTGAATTTGTAGTTGTGAGG + Intergenic
1054179560 9:61899227-61899249 AGGTTGAATTTGTAGTTGTGAGG - Intergenic
1054473728 9:65558359-65558381 AGGTTGAATTTGTAGTTGTGAGG + Intergenic
1054657978 9:67681594-67681616 AGGTTGAATTTGTAGTTGTGAGG + Intergenic
1057109521 9:92454426-92454448 ATGATGAATTTCAAGATGTTGGG + Intronic
1059527040 9:115001673-115001695 ATAATGAATTTGAAGGAGGTAGG - Intergenic
1059679446 9:116572065-116572087 ATGTTGCATTTGTTGTTTGTAGG + Intronic
1059721664 9:116965798-116965820 ATGATGAATGGGTAGATGGATGG + Intronic
1187060812 X:15785529-15785551 AGGGTGAATTTGTATTTAGTGGG + Exonic
1187216780 X:17284685-17284707 ATGATGATTTTGAAGTGGGGAGG + Intergenic
1188128580 X:26401012-26401034 ATAATGAATTTGTATTCAGTAGG + Intergenic
1189464811 X:41270341-41270363 ATCAAGCATTTGAAGTTGGTCGG + Intergenic
1189595342 X:42558969-42558991 ATGATGAGTTGGTAGTTGAAGGG + Intergenic
1189595941 X:42565550-42565572 ATGATGAGTTGGTAGTTGAAGGG + Intergenic
1189958549 X:46302983-46303005 ATAATGTATTTGTAGATTGTGGG - Intergenic
1191794882 X:65010814-65010836 ATGATGAACTTTTTGTTGATAGG + Intronic
1191802528 X:65097169-65097191 TAGATGAATTTGTAATTAGTAGG - Intergenic
1194809042 X:98367766-98367788 ATTATGAGTTTGTGTTTGGTGGG - Intergenic
1195656477 X:107336308-107336330 AAGATGAGATAGTAGTTGGTGGG + Intergenic
1196046114 X:111258162-111258184 ATGCTGAATTTGGATGTGGTAGG - Intronic
1196289462 X:113922296-113922318 ATGTTGTATTTTTAGTTGATTGG + Intergenic
1196857396 X:119997047-119997069 ATGATTAATTTGTAGGTCATGGG - Intergenic
1196859234 X:120012015-120012037 ATGATGAATTTGTAGGTCATGGG - Intergenic
1197258661 X:124292309-124292331 ATGAGGAAGTTGTAATTGGAAGG - Intronic
1197985702 X:132264710-132264732 AGGGTAAATTTGTAGTTGGAGGG + Intergenic
1198063399 X:133070820-133070842 CTGATGAATTTCTACTTGTTAGG + Intronic
1198820766 X:140645810-140645832 GTGATGATTTTAAAGTTGGTGGG - Intergenic