ID: 960573006

View in Genome Browser
Species Human (GRCh38)
Location 3:119203913-119203935
Sequence TACCCAGGAGAACCCAAAAC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 214}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960573006_960573007 -9 Left 960573006 3:119203913-119203935 CCAGTTTTGGGTTCTCCTGGGTA 0: 1
1: 0
2: 2
3: 27
4: 214
Right 960573007 3:119203927-119203949 TCCTGGGTACCATGTTCTACTGG 0: 1
1: 0
2: 2
3: 14
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960573006 Original CRISPR TACCCAGGAGAACCCAAAAC TGG (reversed) Exonic
900303562 1:1990435-1990457 CACACAACAGAACCCAAAACGGG + Intronic
906440094 1:45834774-45834796 TACTCAGGAGAAAGCAAAGCAGG - Intronic
906971827 1:50523251-50523273 TACCCAAAAGAACTGAAAACAGG - Intronic
910342371 1:86202675-86202697 TCACCAGTAGAACCCAAATCTGG + Intergenic
910830574 1:91457099-91457121 CACCCAAGAGAACCCAAGAATGG + Intergenic
911063594 1:93768552-93768574 TAACTAGGAGAACTTAAAACCGG + Intronic
913259298 1:116984228-116984250 TAGGCAGAAGAACCCAAGACTGG - Intronic
913301901 1:117379976-117379998 TAACCAAGAGAACTGAAAACAGG - Intronic
916241314 1:162642654-162642676 AAACCAGGAGAAACCAAATCTGG - Intronic
918926843 1:190797450-190797472 CACCCAGGAGAACCAGACACTGG + Intergenic
920283772 1:204864350-204864372 TACCCAAAAGAACTGAAAACAGG - Intronic
921776794 1:219110968-219110990 TACCCATAATAACTCAAAACTGG + Intergenic
923476725 1:234340719-234340741 TACCCAGAAGAACTGAAAACAGG + Intergenic
1062790309 10:300164-300186 TACCCAGAAGAACTGAAACCAGG + Intronic
1068645255 10:59458991-59459013 CACCTAGGAGAAACAAAAACAGG - Intergenic
1070191761 10:74117851-74117873 CACCAAAAAGAACCCAAAACTGG - Intronic
1072038791 10:91588519-91588541 TAGCCAGGGAAACCCATAACTGG - Intergenic
1072206851 10:93212334-93212356 TACCAAGGAGAAGCCAAAGAAGG - Intergenic
1073433003 10:103499023-103499045 TACCCAGAAGAACCGAAAACAGG - Intronic
1074045633 10:109836095-109836117 TACCCAAGAGAACTGAAAACAGG + Intergenic
1074573703 10:114648867-114648889 TACACAGCAGAGCCCAAAAGAGG + Intronic
1076810802 10:132885496-132885518 TCCCCAGGAGAATTCAACACAGG - Intronic
1080132582 11:28814312-28814334 TACACAGGAGAATCCATAAAGGG - Intergenic
1080657332 11:34268178-34268200 AATCCAAGAGAACCCAAGACAGG - Intronic
1081702171 11:45158938-45158960 TCCCCGGGAGAAGCCAAGACAGG - Intronic
1083284204 11:61647472-61647494 AACCCAGGAGTTTCCAAAACTGG + Intergenic
1083840365 11:65301079-65301101 TACCCAAGAGAACTGAAAACAGG - Intronic
1084315939 11:68345655-68345677 TACCCAAAAGAACTGAAAACAGG - Intronic
1084870325 11:72094386-72094408 TCCACAGGAGAACCCAGCACAGG - Intronic
1093912928 12:24767917-24767939 TACCCCAGAGAAACAAAAACTGG - Intergenic
1093945252 12:25100396-25100418 TACCCAGAAGAATTGAAAACAGG + Intronic
1095121790 12:38427586-38427608 TGCCCAGCAGAACTCAAAACAGG - Intergenic
1095607734 12:44090327-44090349 AACCCTGGAGAATCCAAAAGTGG - Intronic
1101648697 12:106655214-106655236 CACCCTGGAGAGCCCAAAAATGG + Intronic
1101825902 12:108219757-108219779 TACCCAGGACAACCCCAAAGGGG + Intronic
1102706142 12:114882245-114882267 TACCCAAAAGAACTGAAAACAGG - Intergenic
1103788006 12:123447938-123447960 TACCCAGAAGAATTGAAAACAGG + Intergenic
1103934924 12:124470358-124470380 CACCCATGAGAACTGAAAACAGG + Intronic
1103995970 12:124830402-124830424 TACCCATAACAGCCCAAAACTGG + Intronic
1104433887 12:128740216-128740238 TACTCAAGAGAACTGAAAACAGG + Intergenic
1105834338 13:24195439-24195461 TACCCAAGAGAACTGAAAACAGG - Intronic
1106033354 13:26022209-26022231 TACAGAGGAGAAACGAAAACTGG + Exonic
1106461008 13:29968944-29968966 TCCCCAGGAGAACCAGAAAATGG + Intergenic
1107581996 13:41800258-41800280 TATCCAAGAGAAACAAAAACAGG - Intronic
1111025799 13:82521078-82521100 GACCCAAGAGACCCCAGAACTGG - Intergenic
1112876515 13:104047014-104047036 AACCCAGGAGAACATAAAACTGG + Intergenic
1114160413 14:20159593-20159615 TACCCAAGAGAATTGAAAACAGG + Intergenic
1114291245 14:21290157-21290179 TGCCCAGGAGAAATAAAAACAGG - Intronic
1117663228 14:58029858-58029880 TACTCACAAGAACCGAAAACAGG + Intronic
1118306006 14:64655993-64656015 TACCCAAGAGAACTGAAAGCAGG + Intergenic
1119981959 14:79091715-79091737 ACCCCAGGAGACCCCAAGACAGG + Intronic
1120229068 14:81823126-81823148 TTCTCTGGAGAACCCGAAACTGG + Intergenic
1121404397 14:93710444-93710466 TACCCAGGAGAGCCCAAACATGG + Intergenic
1121480038 14:94260044-94260066 TACCCAAGAGAAATGAAAACAGG - Intronic
1122952936 14:105055950-105055972 GACCCAGGAGAACGGAAAGCAGG - Exonic
1123204427 14:106698746-106698768 TACAAAGAAGAACCCAAAAAGGG + Intergenic
1123209433 14:106745217-106745239 TACAAAGAAGAACCCAAAAAGGG + Intergenic
1124182969 15:27495456-27495478 TATCCAAGAGAACTCAAATCAGG - Intronic
1127048877 15:55058735-55058757 TACCCAAAAGAACTGAAAACAGG - Intergenic
1129296783 15:74604231-74604253 TACCCAGGAGAAGCCACAGTGGG + Intronic
1129947729 15:79555531-79555553 TACCCAGAAGAATTAAAAACAGG - Intergenic
1132130259 15:99270759-99270781 TACCCAAAAGAACTGAAAACAGG - Intronic
1132624214 16:882585-882607 CACCCAGGGGAGCCCATAACAGG + Intronic
1132783565 16:1641979-1642001 TACCCATGAGGACCCACACCAGG - Intronic
1133160186 16:3906406-3906428 TACCCAGAAGAACCAAAAGCAGG + Intergenic
1133345727 16:5069186-5069208 CACCCAGGAGAATGAAAAACAGG - Intronic
1133398838 16:5469986-5470008 TACCCACAAGAACCAAAAACAGG - Intergenic
1133785904 16:8972959-8972981 TACCCAAGAGAACTGAAAACAGG + Intergenic
1133980316 16:10628432-10628454 TACCCAAAAGAACAGAAAACAGG + Intronic
1135511986 16:23093683-23093705 TACCCAAAAGAACTGAAAACAGG + Intronic
1138515148 16:57531799-57531821 TTGCCAGGAGAAGCCAGAACAGG - Intronic
1139911578 16:70400512-70400534 CAGCCAGGAGACCCCAAAAGTGG - Exonic
1140890202 16:79278650-79278672 TACCCACGAAACCCCAAACCCGG - Intergenic
1141017063 16:80460633-80460655 TTCCCAGGAGAAAGCAAACCTGG + Intergenic
1141648769 16:85381442-85381464 TACCCAGAAGAAGGGAAAACAGG - Intergenic
1141904648 16:87016100-87016122 TACCCAAGAGAAATAAAAACAGG + Intergenic
1143985494 17:10909870-10909892 CACTCATGAGAACCCCAAACTGG - Intergenic
1144037181 17:11377559-11377581 TAGCCAGGAGAGCTTAAAACAGG - Intronic
1144591194 17:16525297-16525319 TACCCAAGAGAATTGAAAACAGG + Intergenic
1146525734 17:33565568-33565590 TTACCAAGAGAACCCAGAACTGG + Intronic
1148370432 17:47095707-47095729 TACCCAAGAGAACTGAAAAGAGG + Intergenic
1149013883 17:51886066-51886088 TACTCAGGAGGACAAAAAACTGG + Intronic
1149300333 17:55299569-55299591 TCCCAAGGAGAACACAAAGCAGG + Intronic
1152701134 17:81820201-81820223 GACCCAGGTGAGCCCAAATCAGG + Intergenic
1152772927 17:82181202-82181224 TACACAGGAGAAGCCAACACCGG + Intronic
1153798338 18:8646195-8646217 TACCCAAAAGAACCGAAAACAGG + Intergenic
1153836270 18:8966960-8966982 TACCCAAGAGAACTGAAAGCAGG + Intergenic
1156612061 18:38736485-38736507 CACCCTGGAGAGCCCAACACTGG - Intergenic
1157578223 18:48758159-48758181 GACCATCGAGAACCCAAAACTGG + Exonic
1161160440 19:2758639-2758661 TATCCAAGAGAAACGAAAACAGG + Intronic
1161224593 19:3137272-3137294 TATCTAGGAGAAAACAAAACAGG + Intronic
1161667229 19:5584662-5584684 TACACAGGAGAATGGAAAACAGG + Intergenic
1163238671 19:16044945-16044967 TACCCAAAAGAACTGAAAACAGG + Intergenic
1163325830 19:16602496-16602518 TACCCAAAAGAACCGAAAGCAGG + Intronic
1163361357 19:16848238-16848260 TACCCAAAAGAACTGAAAACAGG - Intronic
1165477883 19:36042280-36042302 TACCCAAAAGAACACAAAACAGG + Intronic
1167813741 19:51859332-51859354 TACCCATGAGAATTGAAAACAGG - Intronic
927807062 2:26157363-26157385 TACCCAGAAGAACTGAAAACAGG + Intergenic
928926999 2:36590132-36590154 TACACAGGAGACCCCAAGAAAGG + Intronic
929761675 2:44812240-44812262 TACCCAAAAGAACAGAAAACAGG - Intergenic
933656638 2:84894101-84894123 TACCCAGGAGAAATCAGACCAGG + Intronic
935677470 2:105608423-105608445 TACCGAGGAGACCTCAAATCAGG + Intergenic
936083878 2:109453311-109453333 TACACAGTAGAACTCAAATCTGG + Intronic
938761861 2:134433376-134433398 TACGCAGGAGAAACGAAAACAGG - Intronic
938821541 2:134965390-134965412 AATCCAGGAGTGCCCAAAACGGG - Intronic
938859067 2:135347580-135347602 TACCCAAGAGAACTGAAAACAGG - Intronic
939251578 2:139687564-139687586 TACCCAAGAGAATTTAAAACTGG - Intergenic
941088690 2:161148010-161148032 TACCCAAAAGAACTGAAAACAGG - Intronic
941372014 2:164677327-164677349 TACCCAAGAGAAACCAAAGTAGG - Intronic
941743919 2:169066161-169066183 AGCCCAGAACAACCCAAAACAGG + Intronic
944998231 2:205318972-205318994 TACTGAGGAGAACACAAAAATGG - Intronic
947860053 2:233352370-233352392 TTCCCAGGAAAACGCAAAAACGG - Intergenic
948114042 2:235480459-235480481 TACCCAGAAGAATCAAAAGCAGG + Intergenic
948470883 2:238177807-238177829 TACCCAAAAGAACTCAAAGCAGG - Intronic
948503742 2:238413567-238413589 CACCCAGAAGAACTGAAAACAGG - Intergenic
948691688 2:239709130-239709152 TACCCAAGAGAAAGGAAAACAGG - Intergenic
1170657243 20:18299484-18299506 TTCCCAGGAGAAGACAAAAAAGG + Intronic
1171561858 20:26134206-26134228 AAGCCAGAAGATCCCAAAACAGG + Intergenic
1172059702 20:32178294-32178316 TACCCAGAAGAACTGAAATCAGG - Intergenic
1172865879 20:38096898-38096920 TACCCAACAGAACTGAAAACAGG - Intronic
1173782604 20:45769093-45769115 TACCCAAAAGAACTAAAAACAGG - Intronic
1177788582 21:25697444-25697466 TATCCAGCAAAACCCAGAACTGG - Intronic
1177824751 21:26069664-26069686 TACCCAGGAGAATCTAAAAGAGG - Intronic
1180003293 21:45004875-45004897 TACTCAGGACAACTGAAAACGGG - Intergenic
1180964624 22:19780602-19780624 TACCCAAGAGAACTGAAAGCAGG - Intronic
1181065781 22:20305293-20305315 TACCCAGGAGACCCCAAGCGAGG - Intergenic
1184281061 22:43437815-43437837 TACCCAGGGGAGCCCAGATCTGG - Intronic
1184738763 22:46414787-46414809 TACCCAAAAGAACTGAAAACAGG + Intronic
950051890 3:9997888-9997910 TACCCTAAAGAACCGAAAACAGG - Intronic
950616407 3:14163257-14163279 TACCCAAAAGAACAGAAAACAGG + Intronic
950867631 3:16201847-16201869 TACCCAGGAAAACTGAAACCTGG + Intronic
951375222 3:21906584-21906606 AACCCAGGGAAACCAAAAACAGG - Intronic
953950181 3:47183550-47183572 TACACAGGAGAAAACAAAACAGG + Intergenic
954391100 3:50268283-50268305 TACCCAGGAGACCCAAGACCTGG - Intronic
954741963 3:52759750-52759772 TACCCAAAAGAACGGAAAACAGG + Intronic
954889841 3:53915394-53915416 TACCCAAAAGAACTGAAAACAGG - Intergenic
955199041 3:56833078-56833100 TACCCAAAAGAACTGAAAACAGG - Intronic
956568616 3:70668736-70668758 TACCCAAGAGAAATAAAAACAGG + Intergenic
958152995 3:89715565-89715587 TACCCAGAAGAACTGAAAGCAGG - Intergenic
958736376 3:98014216-98014238 TAACCAGCAGCACCCAGAACTGG - Intronic
960573006 3:119203913-119203935 TACCCAGGAGAACCCAAAACTGG - Exonic
961137475 3:124525408-124525430 CACCCAGCAGAACTCAACACAGG - Intronic
962957136 3:140276546-140276568 CACACAGGAGAACACAAAATAGG + Intronic
967279810 3:187811033-187811055 AACCCAGGAGAGCCAAAAAGTGG + Intergenic
969170788 4:5361305-5361327 TACCCAGAAGAACTGAAAGCAGG - Intronic
969691710 4:8707487-8707509 TGCCCAGGAGGACCCAGAGCTGG + Intergenic
969762006 4:9193325-9193347 TACCTAGGAGCACCCAAGATAGG + Intergenic
970373122 4:15428838-15428860 TAACCAGGAAAAGCCAAAACGGG - Intronic
970466241 4:16325905-16325927 TACCCTGGAGAACCCCACAAAGG + Intergenic
970583144 4:17491717-17491739 AGCCCAGGAGAACCCAAAACTGG + Intronic
975747674 4:77490795-77490817 TACCCAGGACAGCCTGAAACAGG - Intergenic
979821682 4:125181769-125181791 TACTCATAATAACCCAAAACTGG + Intergenic
983695337 4:170521649-170521671 TACCAGTGAGAACGCAAAACAGG + Intergenic
985753124 5:1694453-1694475 AACCCAAGTGAACCCAAAGCAGG - Intergenic
986227571 5:5829802-5829824 TACCCAAGAGAATTGAAAACAGG - Intergenic
986275704 5:6273519-6273541 TACACAGGAAAACCCAAAGTAGG + Intergenic
986616513 5:9623022-9623044 CACCCAAGAGAACTGAAAACAGG - Intergenic
986914819 5:12606685-12606707 TACCCAGAATAACCAAAAGCAGG + Intergenic
988633890 5:32960586-32960608 GAACCAGGACAACCCAAAGCTGG + Intergenic
993145654 5:84090495-84090517 AACCCAGGGGAACACATAACGGG - Intronic
993928392 5:93901913-93901935 TACTCAGGATAACAAAAAACAGG + Intronic
994080110 5:95699106-95699128 TACCCAGCAGAACCTCAACCTGG - Intergenic
994132803 5:96249918-96249940 TACCCATGAGAAGCCGGAACTGG + Intergenic
994677910 5:102848245-102848267 TAATCAGGAGAAAGCAAAACCGG - Intronic
995646619 5:114320251-114320273 TACCCTGTAGAACCAAAAAAAGG - Intergenic
996401431 5:123067547-123067569 TACCCAGAAGAACAAAAAACAGG - Intergenic
997079318 5:130719541-130719563 GACATAGGAGAACCCAAAAATGG + Intergenic
999126064 5:149246955-149246977 TACCCAGAAGAATTAAAAACAGG + Intronic
999584729 5:153077403-153077425 AACCCAGCATAACCCAAAACAGG - Intergenic
1000662861 5:163957362-163957384 TAAAGAAGAGAACCCAAAACTGG - Intergenic
1001450832 5:171823127-171823149 TACCCTGGACTAACCAAAACTGG - Intergenic
1001578628 5:172782714-172782736 TACCCAAGAGAAATGAAAACAGG + Intergenic
1003064109 6:2888339-2888361 TACCCAAGAGAATGCAAAATAGG + Exonic
1003348865 6:5296910-5296932 TACCCAGAAGAACTAAAAGCAGG - Intronic
1006256151 6:32834143-32834165 TACCCAAAAGAACCAAAAGCAGG + Intronic
1010028946 6:71252649-71252671 TACCCAGCAGAAGTAAAAACAGG + Intergenic
1010157407 6:72810945-72810967 TACCAAGGAGAACCAGACACAGG - Intronic
1011425766 6:87227931-87227953 TACCCAGAAGAACTGAAAGCAGG - Intronic
1013402405 6:109811700-109811722 TACCCTGAAGAACACAAAGCAGG + Intronic
1014535935 6:122612778-122612800 TACCCAAGAGAAATGAAAACGGG - Intronic
1016568005 6:145479743-145479765 TACCCAGAAGAATTGAAAACAGG - Intergenic
1016864641 6:148753663-148753685 TACCCATAAGAACAGAAAACAGG - Intronic
1019614266 7:1951923-1951945 TGCCCAGAAGAACCAAAAGCAGG - Intronic
1021976708 7:26018276-26018298 GACCCAGGAGAAGCCAAAGCTGG + Intergenic
1023178237 7:37454429-37454451 TACCCAGCAAAACTCGAAACAGG - Intergenic
1023615063 7:42011416-42011438 TACCCAAAAGAACTGAAAACAGG + Intronic
1024519217 7:50288821-50288843 TACCCAAAAGAATTCAAAACAGG + Intergenic
1025237137 7:57242321-57242343 TACCCTGAAGAACTGAAAACAGG - Intergenic
1028541580 7:91948263-91948285 TACCCAAGAGAAATGAAAACAGG - Intronic
1030275630 7:107718608-107718630 TATTCATGAGAGCCCAAAACTGG - Intergenic
1031438388 7:121761828-121761850 TACCCAAAAGAACTGAAAACAGG + Intergenic
1031561036 7:123238631-123238653 TACTCAGAATAACCAAAAACTGG - Intergenic
1032421301 7:131782143-131782165 TACCCAGGAGCACCCTTGACAGG + Intergenic
1034539830 7:151750264-151750286 TACCCAAGAGAACTGCAAACGGG + Intronic
1034850616 7:154489972-154489994 TACACAGGACAACCCAAAGAAGG + Intronic
1036109222 8:5879066-5879088 TACACAGAAGAACCTAAAAAGGG - Intergenic
1036138121 8:6180912-6180934 CATCCAGGAGAACCAGAAACTGG + Intergenic
1037834274 8:22207083-22207105 TCCCCAGGAGACCCCAAGTCTGG + Intronic
1038189681 8:25308548-25308570 AACCCAAGAGTACACAAAACTGG - Intronic
1038898570 8:31815579-31815601 TACCCATAAGAACCGAAAGCAGG - Intronic
1039147133 8:34460806-34460828 AACCCAGGAGAACCCAACTGGGG + Intergenic
1040322929 8:46327580-46327602 TACCCAGGAGGAGCCAGCACTGG + Intergenic
1040429663 8:47326931-47326953 TATCCAAGAGAACTGAAAACAGG - Intronic
1040515153 8:48128481-48128503 TACCCAGAAGAAGTGAAAACAGG - Intergenic
1042119044 8:65464526-65464548 TACCAAAGAGAACAGAAAACAGG - Intergenic
1042811052 8:72825382-72825404 TACCCAAAAGAACTGAAAACAGG - Intronic
1042864688 8:73346839-73346861 TACCCAAAAGAACTGAAAACAGG + Intergenic
1042892219 8:73625218-73625240 TACCCAAGAGAAATGAAAACTGG + Intronic
1044077369 8:87839427-87839449 TACCCAGGAGAATTGAAAGCAGG + Intergenic
1044816922 8:96122973-96122995 TACCCAAGAGAACTGAAATCAGG - Intergenic
1045043964 8:98256802-98256824 TATCCAAAAGAACTCAAAACAGG + Intronic
1045431504 8:102119076-102119098 TACCCAGAAGAACTGAAAACAGG + Intronic
1045562555 8:103279863-103279885 TACCCTGGGGACCACAAAACTGG + Intergenic
1046679722 8:117155336-117155358 TATCCATGAAAATCCAAAACAGG - Intronic
1047803743 8:128336963-128336985 TACCCAGAAGAAGTGAAAACAGG - Intergenic
1048349542 8:133605028-133605050 TACTCAAAAGAACCAAAAACAGG + Intergenic
1050698201 9:8303088-8303110 TACCCAGAAGAACTAAAAGCAGG - Intergenic
1051798523 9:20904244-20904266 TACCCAAAAGAACTGAAAACAGG - Intronic
1053026911 9:34737525-34737547 TACCCAAGAGAACTGAAAACGGG - Intergenic
1053377614 9:37621323-37621345 CACCCAGAGGAACTCAAAACAGG + Intronic
1053426760 9:38015217-38015239 GAACCAGGAGAAGCCACAACAGG + Intronic
1055370811 9:75596955-75596977 TACCCAGTAGAAACAAAAATAGG + Intergenic
1055840486 9:80497221-80497243 AACCCAGGAGAAGCCACCACTGG + Intergenic
1057254569 9:93534492-93534514 GACACAGGAGAACACAAAACAGG + Intronic
1059226433 9:112677360-112677382 TACCCAGAAGAACTGAAAGCAGG - Intergenic
1059546888 9:115185068-115185090 TATCCATAATAACCCAAAACTGG - Intronic
1060333714 9:122701166-122701188 TACTCAGAGGAACCGAAAACAGG - Intergenic
1061549140 9:131323012-131323034 ACACCAAGAGAACCCAAAACAGG - Intergenic
1061978161 9:134083509-134083531 CACCCAAAAGAACCGAAAACGGG + Intergenic
1185535362 X:857193-857215 TACCCAGGAAAAGCAAAAACTGG + Intergenic
1185944489 X:4359569-4359591 TACCCAGAAGAATTAAAAACAGG + Intergenic
1186839682 X:13472853-13472875 TACCCAAGAGAATGGAAAACAGG + Intergenic
1186902467 X:14071880-14071902 TACCCAAGAGAACTGAAAAAAGG - Intergenic
1187740168 X:22347098-22347120 TACCCAAAAGAACTGAAAACAGG - Intergenic
1188071475 X:25723608-25723630 TATCCAAAAGAACTCAAAACAGG - Intergenic
1188330887 X:28870218-28870240 TACCCAGAAGAACTGACAACAGG - Intronic
1192856778 X:75020304-75020326 TACCCAGGTGAGCTGAAAACAGG - Intergenic
1195646646 X:107238283-107238305 TACCCAAGAGCACTGAAAACAGG - Intronic
1196967194 X:121069283-121069305 TACCCAAAAGAACTGAAAACAGG - Intergenic
1197764197 X:130049134-130049156 TACCCAAAAGAACTAAAAACAGG - Intronic
1197940512 X:131783839-131783861 TATCCAGCAGAAGCCAAAAGTGG - Intergenic
1198788479 X:140316558-140316580 TACCCAGGAGAATAGAAAGCAGG + Intergenic
1199767466 X:150951791-150951813 TACCCAAAAGAACTGAAAACAGG - Intergenic
1200928923 Y:8679440-8679462 TCTCCAGCAGAACCCAAAAACGG - Intergenic