ID: 960574014

View in Genome Browser
Species Human (GRCh38)
Location 3:119211613-119211635
Sequence CGGGAGACAGAAGTAGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 342
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 316}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960574006_960574014 23 Left 960574006 3:119211567-119211589 CCACAAGGAGGTCACAAATGAGA 0: 1
1: 0
2: 0
3: 18
4: 235
Right 960574014 3:119211613-119211635 CGGGAGACAGAAGTAGTGGAGGG 0: 1
1: 0
2: 1
3: 24
4: 316

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960574014 Original CRISPR CGGGAGACAGAAGTAGTGGA GGG Intergenic
900630192 1:3631009-3631031 CTGGAGACAGAGGCAGTGGTCGG - Exonic
900930424 1:5733680-5733702 CGGGAGACAGAAGCTGTGCGTGG - Intergenic
902580487 1:17404613-17404635 CGGGAGGCTGAGGTAGTGGGAGG + Intergenic
903075130 1:20758752-20758774 CGGGAGGCTGAAGCAGCGGAAGG - Intronic
904182961 1:28679877-28679899 CGGGAGGCAGAGGTTGTGGTGGG - Intronic
904950827 1:34237345-34237367 TTGGAGATAGAAGTAGTCGAAGG + Intergenic
905149640 1:35917750-35917772 AGGGAGACAGAAGGAGGGGATGG - Intronic
905233612 1:36530479-36530501 CGGGAGGCAGAACCTGTGGAGGG + Intergenic
905491119 1:38344550-38344572 AGGGAGGCTGAAGTAGGGGACGG + Intergenic
906617170 1:47241367-47241389 AGGGACACAGGAGTAGAGGAAGG - Intergenic
907113639 1:51949790-51949812 CGTGCGACAGAAGCAGTGGTGGG - Intronic
907414834 1:54307124-54307146 CGGAAGGCAGAAGAAGTAGAGGG - Intronic
907506075 1:54919145-54919167 CGGCAAACAGCAGTGGTGGACGG + Intergenic
907602277 1:55783545-55783567 CGGCAAACAGCAGTGGTGGATGG + Intergenic
908717659 1:67087517-67087539 CAGCAAACAGAAGTGGTGGACGG - Intergenic
908723227 1:67148228-67148250 CGGCAATCAGCAGTAGTGGACGG + Intronic
909905323 1:81187040-81187062 CGGGAGGCGGAAGTTGTGGTGGG + Intergenic
910365207 1:86457906-86457928 AGAGAGACAAAAGTAGGGGATGG + Intergenic
912413720 1:109494391-109494413 GGGGAGACAGAAACAGTGGAGGG + Intronic
912487884 1:110043470-110043492 CTGGAGCAAGAAGTAGTTGATGG + Intronic
915247541 1:154567477-154567499 CGGGAGACAGGAGGAGTGTCCGG - Intergenic
916210510 1:162356305-162356327 AGGGAGACAGAAGGAAAGGAGGG + Intronic
917147943 1:171912597-171912619 AGGGAGACAAAAGAAGAGGAAGG + Intronic
919698340 1:200603939-200603961 CTGTAGACAGAATTTGTGGAAGG - Exonic
919942971 1:202301017-202301039 AGGGAGGCAGAAGTATGGGAGGG + Intronic
920043451 1:203118508-203118530 CGGGATAAAGAGGTAGTGGATGG - Intronic
920639855 1:207741518-207741540 CGGCAAACAGCAGTGGTGGACGG + Intergenic
921262137 1:213393994-213394016 CCGAAGACAGATGTAATGGAAGG + Intergenic
922876304 1:228942512-228942534 CGGCAAACAGCAGTGGTGGACGG - Intergenic
922877767 1:228953890-228953912 CGGCAAACAGCAGTGGTGGATGG - Intergenic
924125624 1:240847618-240847640 AGTGAGACAGAAGTTGGGGAGGG - Intronic
1063452506 10:6160178-6160200 AGGGAGGCAGAAGCAGAGGATGG + Intronic
1063908260 10:10802802-10802824 AGGGAGACAGAAGTGGAGGTGGG - Intergenic
1064622660 10:17230350-17230372 CGGGAGAAGGAAGGAGGGGAAGG + Intronic
1064639344 10:17399674-17399696 TGGGAGGCAGAGGTAGGGGAGGG + Intronic
1065009740 10:21410558-21410580 GGGGAGCCAGAAGTGGGGGATGG + Intergenic
1065222798 10:23513377-23513399 AGGCAAACAGCAGTAGTGGACGG + Intergenic
1066246839 10:33591964-33591986 CGGCAGACAGCAGTGGTGGACGG + Intergenic
1068791298 10:61034052-61034074 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068792074 10:61039517-61039539 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1071326730 10:84525734-84525756 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1071331542 10:84565570-84565592 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1071599399 10:86950264-86950286 CGGGAGGCAGAGGTTGTGGTGGG + Intronic
1072710605 10:97713669-97713691 CTGGAGACAGAAGGCGAGGAGGG + Intronic
1072806988 10:98429937-98429959 TGGGAGGCAGAAGGGGTGGAGGG - Intronic
1074453032 10:113574872-113574894 AGGGAGAAAGAAAAAGTGGAAGG - Intronic
1076330841 10:129665125-129665147 TGGGTGACTGAAGGAGTGGATGG - Intronic
1076424293 10:130356594-130356616 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1079275333 11:19030326-19030348 AGTGATACAGAAGTAGGGGATGG + Intergenic
1079356380 11:19733455-19733477 CGGGAGACCGAAACAGTGGAAGG + Intronic
1083069549 11:59962538-59962560 TGGGAGAAAGGAGGAGTGGAGGG + Intergenic
1083872739 11:65499667-65499689 TGGAAGACAGAAGTACGGGAAGG + Intergenic
1084878722 11:72154300-72154322 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1084938859 11:72601663-72601685 CAGGAGACACAAGAAGAGGAAGG + Intronic
1085115734 11:73929980-73930002 CGGGAGGCAGAGGTTGTGGTGGG + Intergenic
1085696007 11:78705267-78705289 GGGGAGACAGAGTCAGTGGAGGG + Intronic
1088505402 11:110522295-110522317 AGGGAGACAGGAGGAGAGGAGGG - Intergenic
1088993093 11:114971522-114971544 GGGGAGACAGTAGTGGTAGACGG - Intergenic
1091974918 12:4816782-4816804 CGGTAAACAAAAGAAGTGGACGG + Intronic
1095893114 12:47253062-47253084 TGGCAGACAGCAGTGGTGGATGG + Intergenic
1096351238 12:50902861-50902883 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1096729700 12:53598515-53598537 CAGGAGACAGAAGTAGGGGAAGG + Intronic
1097706323 12:62872210-62872232 CAAGAGACAGAAGTACTGCAGGG + Intronic
1097840840 12:64319958-64319980 CGGCAAACAGGAGTGGTGGACGG - Intronic
1098230897 12:68370842-68370864 TGGGTGACTGAAGGAGTGGAAGG - Intergenic
1099128254 12:78793965-78793987 CGGAAGAGAGTAGTACTGGATGG - Intergenic
1099574578 12:84362846-84362868 CGGGAGACAGTAGCTGTTGATGG - Intergenic
1101242016 12:102848344-102848366 CAGGAGACTGAAGAGGTGGAGGG + Intronic
1101762433 12:107669905-107669927 GGGGAGAAAGAAGTATTGGGTGG + Intergenic
1101791669 12:107933412-107933434 GAGGAGACAGAAGGAGGGGAAGG - Intergenic
1104330794 12:127842874-127842896 TGGGACACAGAAGGAGAGGAAGG + Intergenic
1105614460 13:21999742-21999764 CTGGAGACAGAAGCTGTGGCTGG + Intergenic
1108827331 13:54429656-54429678 CTGGAGACAGAGATAGTGAAAGG - Intergenic
1109680720 13:65748471-65748493 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1111690368 13:91556077-91556099 CAGGGGTCAGAAGTGGTGGAAGG - Intronic
1111820395 13:93206892-93206914 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1112429840 13:99341853-99341875 GGAGAGAAAGAAGTAGGGGATGG + Intronic
1115315032 14:32016355-32016377 TGGGAGGTAGAAGTAGGGGATGG + Intronic
1115853850 14:37609085-37609107 TGGGAGACAGAAAAAGTGGGAGG - Intronic
1117202661 14:53408391-53408413 AGGGAGGCAGGAGTAGGGGAGGG - Intergenic
1117202668 14:53408410-53408432 AGGGAGGCAGGAGTAGGGGAGGG - Intergenic
1119089946 14:71772217-71772239 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1120227971 14:81811900-81811922 CAGGAGACAGAAGGAGTGAGGGG + Intergenic
1120312751 14:82851505-82851527 TGGGAGACAGAAGAACAGGAAGG + Intergenic
1122180478 14:99950797-99950819 CGTCAGCCAGAAGTAGGGGAGGG + Intergenic
1122914866 14:104854226-104854248 CGGCAGTCAGGAGCAGTGGAGGG + Intergenic
1125625792 15:41108024-41108046 CGGGAGGCAGAGGTTGTGGTGGG + Intronic
1125929979 15:43593634-43593656 CGGGAGACCGAAGAGGTGGCTGG + Intronic
1125943147 15:43693466-43693488 CGGGAGACCGAAGAGGTGGCTGG + Intronic
1126293208 15:47105993-47106015 CTGGAGACATAAATAGAGGAAGG - Intergenic
1126340789 15:47639001-47639023 CAGGAGACAGACATAGTGCACGG - Intronic
1129664828 15:77573715-77573737 CAGGAGCCAGAAGTGGAGGATGG + Intergenic
1129776379 15:78239329-78239351 CGGCAAACAGCAGTGGTGGACGG + Intronic
1131673844 15:94651138-94651160 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1133448790 16:5886033-5886055 CGGGAGAAAGAGGGAGTGAAGGG - Intergenic
1134038145 16:11047869-11047891 CAGGAGAGAGAATTAGTGCAAGG + Intronic
1134091848 16:11395765-11395787 AGGGAGACAGAGGAGGTGGATGG + Intronic
1135265814 16:21024553-21024575 AGGGAGACAGCAGGAGGGGAAGG + Intronic
1136409406 16:30067374-30067396 CAGGAGACAGAATGGGTGGAGGG + Intronic
1136911678 16:34149189-34149211 CGGGAGGCAGAGGTTGTGGTGGG - Intergenic
1137492488 16:48944580-48944602 GGGGAGGGAGAAGTAGAGGAGGG - Intergenic
1142735935 17:1899597-1899619 CAGGAAACAGAAGTGGGGGAGGG - Intronic
1143423175 17:6812137-6812159 CAGGAGACAGAAAGAGTGCAGGG - Intronic
1146064022 17:29621488-29621510 CGGGAGGGAGGAGGAGTGGAGGG + Intronic
1146185996 17:30724590-30724612 CGGGAGTCAGAGGTGTTGGAGGG + Intergenic
1146488343 17:33262007-33262029 CTGGAGACAGGAGTAATGAAGGG + Intronic
1147397757 17:40158005-40158027 TGGGTGACAGAGGCAGTGGAAGG + Intronic
1147444561 17:40466926-40466948 CAGGAGTGAGAAGTAGGGGAGGG - Intergenic
1148395001 17:47300781-47300803 TGGGAAGCAGAAGTGGTGGATGG - Intronic
1148826730 17:50399327-50399349 CAGCAAACAGCAGTAGTGGACGG + Intergenic
1148906493 17:50915598-50915620 TGGGAGGCAGAAGTTGTGGTGGG - Intergenic
1149152963 17:53592039-53592061 TGGGAGGCTGAAGTAGTGGGTGG - Intergenic
1149243112 17:54673775-54673797 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1149368348 17:55967893-55967915 CGGGAGGCAGAGGTTGTGGTGGG - Intergenic
1150227574 17:63532189-63532211 AGGGAGACAGAAGGAATGGTGGG - Intronic
1150975987 17:70087631-70087653 CGGGAGGCAGAGGTTGTGGTGGG + Intronic
1151677399 17:75605728-75605750 TGGGAGACAGAAGGGCTGGACGG + Intergenic
1152630634 17:81409332-81409354 TGGGAGACAGAAGTGGGGGTGGG + Intronic
1153402050 18:4692000-4692022 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1155231678 18:23780370-23780392 AGAGAGACAGAAGTGCTGGAAGG + Intronic
1156089120 18:33443356-33443378 AGGGAGACAGATGGAGAGGAAGG - Intergenic
1157259332 18:46165103-46165125 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1157422695 18:47559611-47559633 GGGGAGACAGGAGAAGGGGAAGG - Intergenic
1157958632 18:52127075-52127097 TAGGAGACAGAAGAAGTAGAAGG + Intergenic
1158152293 18:54386967-54386989 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1162972781 19:14191141-14191163 CGGGAGTCAGAGGTGTTGGAGGG - Intronic
1163044327 19:14628052-14628074 CGGGAGGCAGATGTCGTGGTGGG + Intronic
1163376434 19:16935403-16935425 AGGGAGAAGGAAGTAGGGGATGG - Intronic
1166035884 19:40168167-40168189 CGGGAGACAGAAGTTGCAGTGGG + Intergenic
1168015305 19:53568169-53568191 CGGGAGGCAGAGGTTGTGGTAGG + Intronic
1168147019 19:54425248-54425270 CGGCAAACAGCAGTGGTGGACGG + Intronic
925683561 2:6448387-6448409 GGGAAAAGAGAAGTAGTGGAGGG + Intergenic
925857415 2:8143323-8143345 AGGGAGACAGAAGCAGAGGCGGG + Intergenic
927665068 2:25026229-25026251 TGGAAGACAGAAATACTGGAGGG + Intergenic
927921014 2:26971506-26971528 CGGGGAGTAGAAGTAGTGGAGGG + Intronic
928635062 2:33236909-33236931 CCGAAGACAGAAGAATTGGAAGG + Intronic
929311534 2:40431571-40431593 GGGGAAACTGAAGTAGAGGAAGG + Intronic
929542353 2:42832094-42832116 CGGCAAACAGCAGTGGTGGACGG - Intergenic
930381532 2:50635779-50635801 GGGGAGTTAGAAGTAGTTGAAGG + Intronic
930740072 2:54823300-54823322 CGGGAGGCAGAACTAGGCGAGGG + Intronic
931038980 2:58275750-58275772 CGGCAAACAGCAGTGGTGGACGG - Intergenic
931191262 2:60002592-60002614 CTGCAGACAGAAGAAGTGGCAGG - Intergenic
931284445 2:60820396-60820418 AGAGAGACAGAAGCAGGGGATGG + Intergenic
932917171 2:75872053-75872075 CGGCAAACAGCAGTGGTGGATGG - Intergenic
933177823 2:79195693-79195715 TGTGTGTCAGAAGTAGTGGATGG - Intronic
934747198 2:96767173-96767195 TGGGAGACAGAAGTGCTGCAAGG - Intronic
936664220 2:114575879-114575901 CTGGAGGCAGAATAAGTGGAGGG - Intronic
937187138 2:120054938-120054960 CGGGAGGCAGAGGTCGTGGTGGG - Intronic
937269411 2:120638584-120638606 CGGGAGCCGGAAGAAGTGGGAGG + Intergenic
939134088 2:138273520-138273542 CGGCAAACAGCAGTGGTGGACGG + Intergenic
939798575 2:146678924-146678946 CTGGAGACAGACGTACTGCAGGG - Intergenic
940647452 2:156406563-156406585 GGAGAGAGAGAAGTAGGGGAGGG - Intergenic
940918197 2:159281133-159281155 TGGGAGACAGAAGGAGGGGGAGG + Intronic
940986739 2:160058616-160058638 GGGGAGAAAGAAGAAGGGGATGG - Intronic
941891094 2:170582635-170582657 AGGAAGAAAGAAGTAGAGGAAGG - Intronic
942442611 2:176051876-176051898 GGTAAGACAGAGGTAGTGGAGGG + Intergenic
942672272 2:178388738-178388760 CTGGAGACAGAAGTATGGGAGGG - Intronic
943259751 2:185643926-185643948 CTGGAGACAAGAGTAGAGGATGG + Intergenic
946274876 2:218623754-218623776 CGGGAGGCAGAGGTTGTGGTGGG - Intronic
947861443 2:233361238-233361260 CAGGAGCCAGAAGTATTGGAAGG + Intronic
1170357355 20:15507273-15507295 AGGGAGACAGAAGGAAAGGAGGG - Intronic
1171393062 20:24813849-24813871 CGGGTGAGAGACCTAGTGGAGGG - Intergenic
1171500797 20:25591493-25591515 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1171536162 20:25892577-25892599 CTGGAGACAGAAATAGAGGAAGG + Intergenic
1171804936 20:29668581-29668603 CTGGAGACATAAATAGAGGAAGG - Intergenic
1171839123 20:30187847-30187869 CTGGAGACATAAATAGAGGAAGG + Intergenic
1171907002 20:30907523-30907545 CGGGAGGCAGAGGTTGTGGTGGG - Intergenic
1172947191 20:38698744-38698766 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1173741692 20:45406558-45406580 CGGGAGGCGGAAGTGGGGGAGGG - Intronic
1175866549 20:62180819-62180841 CAGGAGACAGAGGTTGTGGTGGG + Exonic
1177359363 21:20048656-20048678 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1177541673 21:22500975-22500997 CTGGAGAAAGCAGTAGTGCATGG - Intergenic
1177600075 21:23299366-23299388 CGTGGGACAGAAGGAGTGGAGGG - Intergenic
1177895730 21:26854808-26854830 CGGCAAACAGCAGTGGTGGAAGG - Intergenic
1177896702 21:26861644-26861666 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1178420820 21:32441952-32441974 GGGGAGAGAGAGGTAGTGGAGGG + Intronic
1179311085 21:40196689-40196711 CAGGAGACAGAAATAGAGGGAGG - Intronic
1179873632 21:44256388-44256410 CGAGAGACAGTAGGTGTGGAGGG + Intronic
1179897526 21:44370978-44371000 CGGGAGACAGACCTAAGGGAGGG - Intronic
1180340412 22:11613523-11613545 CGGGAGGCAGAGGTTGTGGTGGG - Intergenic
1181069384 22:20323073-20323095 CGGGAGACAGACGGAGTGAGCGG - Intergenic
1181307914 22:21927436-21927458 TGGGAGACAGAAGCAGAGAAAGG - Intronic
1181387899 22:22558344-22558366 AGGGAGACAGAAGGGGGGGAGGG + Intronic
1183371002 22:37432386-37432408 AGGGAGACTGAAGTGGGGGAGGG - Intergenic
1184078542 22:42200699-42200721 CGGGAGTCAGAAGGATTGGATGG - Intronic
1184453188 22:44594888-44594910 GGGGGGACAGCAGGAGTGGAGGG + Intergenic
950363184 3:12464218-12464240 TGGAAGACAGAAATAGTGGGAGG - Intergenic
951326078 3:21303135-21303157 CGGAAAACAGCAGTGGTGGATGG + Intergenic
954444134 3:50537579-50537601 CAGGAGACAGAATGACTGGAAGG - Intergenic
956578187 3:70779417-70779439 CAGGACGCAGAAGTAGTGTACGG - Intergenic
958424501 3:93965270-93965292 CGGCAAACAGCAGTTGTGGACGG - Intronic
960006990 3:112790777-112790799 CGGCAAACAGCAGTGGTGGATGG + Intronic
960574014 3:119211613-119211635 CGGGAGACAGAAGTAGTGGAGGG + Intergenic
961457530 3:127031548-127031570 CGGGAGCCAGCAGAAGTGGCAGG - Intronic
961701216 3:128746177-128746199 TGGGAGAGAGAAATAATGGAGGG - Intronic
964661409 3:159124176-159124198 AGGAAGAAAGAAGAAGTGGAAGG - Intronic
966833406 3:184030495-184030517 CGGGAGGCAGAGGTTGTGGTGGG + Intergenic
968223600 3:196957915-196957937 AAGGAGATAGAAATAGTGGAAGG + Intronic
968589856 4:1451962-1451984 CAGGAGACATAAGTGGGGGAGGG - Intergenic
968638031 4:1692567-1692589 CGGGAGACAGAGGTTGTAGTGGG + Intergenic
968901570 4:3434568-3434590 CGGGACACAGCAGTGCTGGAGGG - Intronic
969162615 4:5274794-5274816 CGGCAAACAGCAGTGGTGGACGG - Intronic
969352548 4:6606149-6606171 GGGGAGACAGAAAAAGAGGAGGG + Intronic
972766775 4:42158571-42158593 CGGCAAACAGCAGTGGTGGACGG + Intergenic
975313230 4:72926028-72926050 CGGCAAACAGCAGTGGTGGACGG + Intergenic
975798383 4:78032977-78032999 TGGGAGACAGGAGTTGTGGTAGG + Intergenic
976219799 4:82747097-82747119 GGGGAGCCAGAAGCAGGGGATGG - Intronic
977251317 4:94692625-94692647 CGGCAAACAGCAGTGGTGGACGG - Intergenic
978161332 4:105552011-105552033 CAGCAGGCAGAAGAAGTGGAGGG - Intergenic
978772702 4:112473834-112473856 CAGGAGACAGAAGGAGTGAGGGG - Intergenic
980625711 4:135372297-135372319 CGGCAAACAGCAGTGGTGGATGG - Intergenic
980763762 4:137271057-137271079 CAGGATACAGAAGTTCTGGAGGG - Intergenic
982534117 4:156587029-156587051 AGGGAGACAGAAGTAGAGCAAGG - Intergenic
983255365 4:165394120-165394142 GGGGAAACAGAAATAATGGATGG + Intronic
983667444 4:170196968-170196990 CGGCAAACAGCAGTGGTGGATGG + Intergenic
983734456 4:171040862-171040884 CGGGAGAGGGAAGTGGTGGGTGG + Intergenic
984138977 4:175978255-175978277 CAGGAGAGAGAAGTAATAGAAGG + Intronic
985547448 5:516988-517010 TGGGAGAGTGAAGGAGTGGAGGG - Intronic
986354895 5:6914100-6914122 CGGGTGACAGAGGCTGTGGAGGG + Intergenic
988404758 5:30810025-30810047 AGGGAGACAGAAGTTGTGCTGGG - Intergenic
988521321 5:31947864-31947886 AGAGAGAGAGAAGTAGGGGAGGG + Intronic
988740545 5:34064672-34064694 CGGCAAACAGCAGTGGTGGATGG + Intronic
988957400 5:36332981-36333003 CGGCAAACAGCAGTGGTGGATGG + Intergenic
990408272 5:55513900-55513922 TGGGAGACAGATGTTGTGTAGGG + Intronic
991271662 5:64790649-64790671 GGGGAGGTAGAAGTAGTAGAAGG - Intronic
992293493 5:75304574-75304596 CGGCAAACAGCAGTGGTGGATGG - Intergenic
995023564 5:107393897-107393919 GGGGAAACAGAAGAAGTGGTGGG + Intronic
995192652 5:109334559-109334581 AGCCAGACAGAAGTAGTTGATGG - Intergenic
995359012 5:111271927-111271949 CGGGAGAGAAAAGTGTTGGAGGG - Intronic
995801064 5:115995522-115995544 CAGGAGACTGAAGTACTGAAAGG + Intronic
997658425 5:135572412-135572434 CTGGAGACAGAAGAGGTGGTTGG + Intronic
998881801 5:146652694-146652716 GTTGAGACAGAAGTAGTGAAGGG + Intronic
999147497 5:149405959-149405981 TGGGAGACAGGAGCAGGGGAAGG + Intergenic
1000594869 5:163203113-163203135 CAGGTTAAAGAAGTAGTGGAGGG + Intergenic
1000631398 5:163595042-163595064 CTGGAAAGAGAAGTTGTGGAGGG - Intergenic
1001315684 5:170639688-170639710 GGGGAGACAGGAGGAGAGGAAGG - Intronic
1002088852 5:176792858-176792880 GGGGAGGCAGAAGGAGAGGAGGG - Intergenic
1002644961 5:180648633-180648655 CGGGCGGCAGAGGGAGTGGATGG - Intronic
1002657945 5:180767848-180767870 TGGGAGACGGAAGTTGTGGTAGG - Intergenic
1005317285 6:24615866-24615888 CGTGAGAGAGAAGTAGAGAAGGG - Intronic
1005324148 6:24682705-24682727 CGGCAAACAGCAGTGGTGGATGG + Intronic
1006191501 6:32212538-32212560 CTGGAGGCACAAGCAGTGGAAGG + Exonic
1008099655 6:47377381-47377403 GGGGAGTCAGAAGCAGGGGATGG + Intergenic
1008120570 6:47611755-47611777 CTGGGGACAGAAGGAGTGGAAGG - Intronic
1008201629 6:48598199-48598221 CGGGAGCCAGAAATAGAGGAGGG - Intergenic
1008582777 6:52921518-52921540 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1008761049 6:54851544-54851566 CGGGAGGCAGAGGTTGTGGTGGG - Intronic
1011751802 6:90461513-90461535 CAGGAGAGAAAAGTAGTGGGAGG + Intergenic
1012410167 6:98947776-98947798 CGGGAGGGAGAAGTAAAGGAAGG + Intronic
1013021753 6:106228254-106228276 CGGCAAACAGCAGTGGTGGATGG - Intronic
1014050440 6:116946641-116946663 AGAGAGACAGAGGTAGTGGATGG + Intergenic
1014208910 6:118687752-118687774 CGGCAAACAGCAGTGGTGGACGG - Intronic
1015454053 6:133405096-133405118 CAGGAGCCTGAAGGAGTGGATGG - Intronic
1015793362 6:136986380-136986402 ATGGAGACAGAATTAGTGGGTGG - Intergenic
1016293431 6:142548765-142548787 CAGGAGACAGAAGGAGTGCAGGG - Intergenic
1016646273 6:146412069-146412091 AGGGAGGCAGAAGGAGGGGATGG - Intronic
1016700708 6:147050754-147050776 GGGGAGAAAGAAGGAGAGGAAGG - Intergenic
1018101888 6:160447387-160447409 AGGGAAACAGAAGTGCTGGAGGG - Intronic
1018133767 6:160757822-160757844 AGGGAAACAGAAGTGCTGGAGGG + Intergenic
1018167874 6:161116345-161116367 TGGGAGACAGAAGTATTGCTGGG + Intronic
1018526015 6:164710579-164710601 GGGGAGCCAGAAGTGGGGGATGG + Intergenic
1018632360 6:165832242-165832264 TGGGAGACAGAAGTGGTGGTGGG + Intronic
1018810498 6:167294905-167294927 GAGGAGACAGAAGCAGTGGGGGG - Intronic
1019564200 7:1671497-1671519 CTGGGGACAGAAGCTGTGGAGGG + Intergenic
1019963184 7:4478414-4478436 GGGAAGACAGAAGTAGCTGATGG - Intergenic
1021885344 7:25131953-25131975 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1022117652 7:27276465-27276487 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1022855481 7:34309826-34309848 GGGGAGCCAGAAGTGGGGGATGG + Intergenic
1022989913 7:35696639-35696661 CGGCAGACAGCAGTGGTGGACGG - Intergenic
1023085054 7:36562078-36562100 AGGGAAATAGAAATAGTGGAAGG - Intronic
1024396910 7:48879961-48879983 GGGAAGACAGAAGTTCTGGAAGG - Intergenic
1024588492 7:50860912-50860934 CTGGAGACAGAAGCGGTGTAAGG + Intergenic
1025287636 7:57679285-57679307 CTGGAGACATAAATAGAGGAAGG + Intergenic
1028013983 7:85684105-85684127 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1028260558 7:88658994-88659016 CTGGAGGCAGAAGTGGTGGAAGG + Intergenic
1028587731 7:92468311-92468333 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1028993385 7:97074790-97074812 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1030193320 7:106830915-106830937 GTGGAGACCGAAGGAGTGGACGG - Intergenic
1030513609 7:110515482-110515504 GGGGAGCCAGAAGTGGGGGATGG + Intergenic
1030791028 7:113729333-113729355 CAGGAGGCAGAAGTGGGGGAAGG - Intergenic
1031250879 7:119378956-119378978 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1031299569 7:120047464-120047486 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1031598637 7:123676370-123676392 CGGGAGACAGAAGGAGGGAATGG + Intergenic
1031897238 7:127364645-127364667 AGGGAGACAGAAGCTGGGGAGGG + Intronic
1032810061 7:135404887-135404909 CTGAAGACAGATGTAGTGGATGG - Intronic
1032901957 7:136320483-136320505 TGGGATACAGCAGTAGTGGTGGG + Intergenic
1034248764 7:149671695-149671717 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1034249490 7:149676815-149676837 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1034650848 7:152688867-152688889 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1034965015 7:155385412-155385434 CGGCAAACAGCAGTGGTGGACGG + Intronic
1035089608 7:156296555-156296577 TGGGATACAGAAACAGTGGAAGG - Intergenic
1036329439 8:7808441-7808463 TTGGATACATAAGTAGTGGAAGG + Intergenic
1039448942 8:37655701-37655723 CAGGAGAAAGAAGTAGTTTATGG + Intergenic
1039454249 8:37697119-37697141 TGGGAGACAGAAGCAGGGGGAGG - Intronic
1039604321 8:38868084-38868106 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1039829615 8:41202394-41202416 GGAGAGACAGAGGCAGTGGAGGG + Intergenic
1041094313 8:54333748-54333770 AGGGAGACAGATGTACTCGAGGG + Intergenic
1041234495 8:55785724-55785746 CAGGCGACAGAAGAAGAGGAAGG + Exonic
1041770956 8:61471967-61471989 TGGGATGCAGAAGGAGTGGATGG - Intronic
1042874322 8:73427000-73427022 CGGGAGGCAGAGGTTGTGGTGGG - Intronic
1043350931 8:79360248-79360270 GGGGAGTCAGAAGTGGGGGATGG + Intergenic
1043351539 8:79367159-79367181 TGGGAGACAGAAGTAGAAGAAGG + Intergenic
1044915668 8:97110620-97110642 GAGGACACAGAAGTAGGGGATGG - Intronic
1045788640 8:105955560-105955582 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1046059043 8:109114464-109114486 GGGAAGACAGAAGGAATGGAAGG + Intronic
1047450219 8:124958754-124958776 CGGGAGACTGAGGTAGGAGATGG - Intergenic
1048482213 8:134808979-134809001 GAGGTGACAGAAGTAGGGGAAGG - Intergenic
1049228909 8:141472089-141472111 CAGGAGGCAGAAGTGCTGGAAGG - Intergenic
1049629378 8:143644420-143644442 TTGAAGACAGTAGTAGTGGATGG + Intronic
1050549155 9:6734366-6734388 CGGGAGGCAGAGGTTGTGGTGGG - Intronic
1050704753 9:8384599-8384621 CGGGAGACAGAGGTTGTGGTGGG - Intronic
1053073303 9:35113758-35113780 GGGGAGAAAGAAATTGTGGAGGG - Intronic
1054771837 9:69090600-69090622 CGGGAAAGGGATGTAGTGGAGGG - Intronic
1055234739 9:74107143-74107165 ATGGAGACAGAAGTAGTTAACGG - Intergenic
1055789844 9:79911963-79911985 CGGTAAACAGCAGTGGTGGACGG + Intergenic
1056539600 9:87559913-87559935 GGGGAGACAAAAGAAGCGGATGG - Intronic
1056898359 9:90573357-90573379 CTGGAGACAGAGGTTGTGAATGG - Intergenic
1057828200 9:98387140-98387162 AGGAAGACAGAAGTAGGGGGAGG + Intronic
1058079869 9:100690413-100690435 GGAGAGACAGAAGCAGTGGCTGG - Intergenic
1058170961 9:101680736-101680758 CTGGAGACAGAAGGAATAGAAGG - Intronic
1058394093 9:104529806-104529828 TTAGAGAGAGAAGTAGTGGAAGG - Intergenic
1058947843 9:109875500-109875522 GGGGACACAGAAGGAGAGGATGG + Intronic
1062151033 9:135019137-135019159 CGGGAGACAGATGAAGAGTAGGG + Intergenic
1187133454 X:16525146-16525168 CAGGAGAGAGAAGAAGTGAAGGG + Intergenic
1189751258 X:44225271-44225293 CAGGAAACAGAAGTAGGGAATGG - Intronic
1190157585 X:48006355-48006377 AGGGAGACAGTAGGAGTGAATGG + Intronic
1190173355 X:48129240-48129262 AGGGAGACAGTAGGAGTGAATGG + Intergenic
1191167488 X:57405562-57405584 CGGCAAACAGCAGTGGTGGATGG + Intronic
1192607661 X:72536111-72536133 TGGGCCACAGAAGTAGTGAATGG - Intronic
1195237734 X:102918158-102918180 TGGGACACAGAAGTAGGGGTTGG + Intergenic
1195259091 X:103115404-103115426 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1196287281 X:113897473-113897495 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1196996465 X:121389106-121389128 CAGGAGACAGAACAAGTGGCAGG + Intergenic
1197545332 X:127816606-127816628 CGGGAAATGGCAGTAGTGGACGG + Intergenic
1197999720 X:132420349-132420371 CGGCAAACAGCAGTGGTGGATGG + Intronic
1198040841 X:132850590-132850612 GGGGAGACAGAAGAAAGGGATGG + Intronic
1198253909 X:134908456-134908478 AGGGAAACAGAAGGAGGGGAGGG - Intronic
1199302202 X:146226246-146226268 CGGGTCACAGAAGTACTGGATGG - Intergenic
1200021819 X:153218299-153218321 CGAGAGACAGGGGTAGTGGGTGG + Intergenic
1201071418 Y:10150373-10150395 CGGGAGAAGGGATTAGTGGAGGG + Intergenic
1201294948 Y:12454469-12454491 AGGGAGACAGAAGGAGGGGGAGG + Intergenic
1201421473 Y:13804542-13804564 CAGCAAACAGCAGTAGTGGAGGG - Intergenic