ID: 960576309

View in Genome Browser
Species Human (GRCh38)
Location 3:119233246-119233268
Sequence CCCACTCTGTAGAATGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 266}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960576309_960576319 17 Left 960576309 3:119233246-119233268 CCTCCCTCATTCTACAGAGTGGG 0: 1
1: 0
2: 1
3: 29
4: 266
Right 960576319 3:119233286-119233308 ACCCAAGGCACGGGGTACATGGG 0: 1
1: 0
2: 0
3: 3
4: 71
960576309_960576314 7 Left 960576309 3:119233246-119233268 CCTCCCTCATTCTACAGAGTGGG 0: 1
1: 0
2: 1
3: 29
4: 266
Right 960576314 3:119233276-119233298 TTAAAAACCTACCCAAGGCACGG 0: 1
1: 0
2: 5
3: 68
4: 942
960576309_960576316 9 Left 960576309 3:119233246-119233268 CCTCCCTCATTCTACAGAGTGGG 0: 1
1: 0
2: 1
3: 29
4: 266
Right 960576316 3:119233278-119233300 AAAAACCTACCCAAGGCACGGGG 0: 1
1: 0
2: 0
3: 11
4: 96
960576309_960576318 16 Left 960576309 3:119233246-119233268 CCTCCCTCATTCTACAGAGTGGG 0: 1
1: 0
2: 1
3: 29
4: 266
Right 960576318 3:119233285-119233307 TACCCAAGGCACGGGGTACATGG 0: 1
1: 0
2: 0
3: 5
4: 83
960576309_960576315 8 Left 960576309 3:119233246-119233268 CCTCCCTCATTCTACAGAGTGGG 0: 1
1: 0
2: 1
3: 29
4: 266
Right 960576315 3:119233277-119233299 TAAAAACCTACCCAAGGCACGGG 0: 1
1: 0
2: 1
3: 11
4: 130
960576309_960576313 2 Left 960576309 3:119233246-119233268 CCTCCCTCATTCTACAGAGTGGG 0: 1
1: 0
2: 1
3: 29
4: 266
Right 960576313 3:119233271-119233293 GAGATTTAAAAACCTACCCAAGG 0: 1
1: 0
2: 2
3: 56
4: 396

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960576309 Original CRISPR CCCACTCTGTAGAATGAGGG AGG (reversed) Intronic
900324493 1:2101642-2101664 CCCTTCCTGGAGAATGAGGGTGG + Intronic
900426649 1:2583401-2583423 TCCACTCAGTAGCATGAAGGTGG - Intergenic
901798634 1:11694416-11694438 ATCACTCTGGAAAATGAGGGTGG + Intronic
902575860 1:17377084-17377106 GCCACTCTGGAGATTGAGGTGGG - Intronic
903230363 1:21918621-21918643 CCTCCTCTATAGAATGAGGGTGG - Intronic
904421976 1:30399936-30399958 CCCACTCTTGAAACTGAGGGTGG - Intergenic
904520383 1:31090648-31090670 GCCACTCTGTAGAATGATTGGGG + Intergenic
905562427 1:38938127-38938149 GCCACTCTGGAGGTTGAGGGAGG - Intronic
905862285 1:41359795-41359817 CCCACCCTGGGGAATGAGGAGGG + Intergenic
907159387 1:52359659-52359681 CCCTATCTATAAAATGAGGGTGG + Intronic
907393557 1:54174400-54174422 CCTACTATGTAGAAGGAGGATGG - Exonic
907394646 1:54180687-54180709 CCTAATCTCTAGAATGAGGGTGG - Intronic
907481779 1:54749918-54749940 CCCACTCTGTAAACTGAGTCAGG + Intergenic
907701390 1:56791627-56791649 TTCAGTGTGTAGAATGAGGGAGG + Intronic
907738554 1:57140327-57140349 CCTCATCTGTAGAATGAGGGAGG - Intronic
908272393 1:62434759-62434781 GCCACTCGGGAGGATGAGGGAGG - Intergenic
908563903 1:65334823-65334845 CCCATGCTGTAAAATGATGGTGG + Intronic
909248295 1:73318748-73318770 CCCATTTTGTAGACTGAGGAAGG + Intergenic
909415438 1:75401046-75401068 GCCAGTGAGTAGAATGAGGGTGG - Intronic
909990476 1:82217218-82217240 GCCACTCTGGAGACTGAGGCAGG + Intergenic
910862944 1:91760893-91760915 CACACTATGGAGAATGAAGGAGG + Intronic
915296170 1:154923411-154923433 CCAACTCTGATGAATGTGGGAGG - Intergenic
915364690 1:155308425-155308447 CCTCATCTGTTGAATGAGGGTGG - Intergenic
915930584 1:160058332-160058354 CCTACTCTCTACAATGAGAGGGG + Intronic
919690700 1:200526246-200526268 GCTACTCTGGAGAATGAGGCAGG - Intergenic
919851326 1:201674926-201674948 CCTACTCTGGAGACTGAGGCAGG + Intronic
919971832 1:202585481-202585503 CCCTGTCTGTAAAATGAGGTTGG + Exonic
920866893 1:209760425-209760447 CCCTCTCTGGACAAGGAGGGTGG + Intronic
921327896 1:214005889-214005911 AATATTCTGTAGAATGAGGGAGG - Intronic
921387379 1:214584334-214584356 CACAGTCTGTAGATTGAGGTTGG + Intergenic
922182275 1:223244605-223244627 TCCAATCTGTAGCATCAGGGTGG - Intronic
923475853 1:234330495-234330517 CCTACTCTGGAGGCTGAGGGAGG - Intergenic
1063001361 10:1926738-1926760 GCCACTCAGAAGAATGAGGTGGG + Intergenic
1063747361 10:8899713-8899735 GCTACTCTGTAGGATGAGGCAGG - Intergenic
1066110273 10:32189380-32189402 GCTACTCTGTAGACAGAGGGAGG + Intergenic
1067185708 10:44025344-44025366 GCCCCTCTGTAGAATGAGGATGG + Intergenic
1067473094 10:46550016-46550038 TCTACTCTGTGGCATGAGGGAGG - Exonic
1068714458 10:60172993-60173015 CCCATTCTGTAGAAGGAAGATGG + Exonic
1068974681 10:62995756-62995778 CTCACTCTATAGAATTTGGGGGG - Intergenic
1069971564 10:72174816-72174838 CCTCCTCTGTAAAATAAGGGAGG + Intronic
1071908424 10:90201690-90201712 CCCAATCTGTTAAATGAGGCCGG + Intergenic
1074526194 10:114265478-114265500 CCTCCTCTGTAAAATAAGGGAGG - Intronic
1075545779 10:123353378-123353400 TCCCATCTGTAAAATGAGGGTGG + Intergenic
1075801218 10:125154758-125154780 CCAACTCTGTAGCTTAAGGGAGG - Intronic
1075989651 10:126824557-126824579 CCCATAATGTAGAATCAGGGTGG - Intergenic
1076755450 10:132568643-132568665 GCCACTCAGGAGACTGAGGGAGG + Intronic
1077258999 11:1605391-1605413 TCCACTCTGTGGTCTGAGGGTGG - Intergenic
1080975907 11:37340048-37340070 ACCATTCTGTGGAATGAGGTAGG - Intergenic
1081354583 11:42096501-42096523 CCTCCTCTGTAAAATGAGGTGGG + Intergenic
1083641725 11:64149309-64149331 CCTCCTCTGCAAAATGAGGGTGG - Intronic
1083955849 11:65982401-65982423 ACCACTCTGTAGGATGAATGGGG - Intergenic
1084802542 11:71554636-71554658 CCCACTCTGTGGTCTGAGGGTGG + Intronic
1084840846 11:71845950-71845972 CTAACTCTGAAGAATGATGGTGG + Intergenic
1086400136 11:86454601-86454623 CCCAATCTGTAAAATGAGGATGG - Intronic
1086435392 11:86775077-86775099 CCCACTCTGAAGAATGGAGTGGG + Intergenic
1087064220 11:94012030-94012052 CCCACTCTGCAGCATGAAGCAGG + Intergenic
1087776576 11:102262046-102262068 CTCACTCTGTAGCATGAGTTTGG - Intergenic
1088812486 11:113400941-113400963 CCCCCTCTGGAGATGGAGGGAGG + Intergenic
1090512396 11:127389517-127389539 CCCAAGCTGTAAAATGAGAGTGG - Intergenic
1096290262 12:50336282-50336304 CCTCTTCTGTAGAATGAGGATGG - Intronic
1096844158 12:54396227-54396249 CCTTTTCAGTAGAATGAGGGTGG + Exonic
1098762791 12:74446269-74446291 CCTACTCTGTAGGCTGAGGCAGG + Intergenic
1099669089 12:85667982-85668004 CCCACACTGGAAAGTGAGGGAGG + Intergenic
1101456928 12:104842615-104842637 CCCCCTCTGTAAAATGGGAGAGG - Intronic
1101913858 12:108881002-108881024 CCCAGCCTCCAGAATGAGGGCGG + Intronic
1102171412 12:110845464-110845486 CCCCATCTGTAAAATGAGGATGG + Intergenic
1103140749 12:118545953-118545975 TCCACTCTGCAGAAGGAGGTGGG + Intergenic
1103292670 12:119859926-119859948 GCTACTCTGGAGAATGAGGTGGG - Intronic
1104865156 12:131949459-131949481 CCCACTCGGGAGACTGAGGCAGG + Intergenic
1106060229 13:26283494-26283516 GCTACTCTGGAGACTGAGGGAGG + Intronic
1107811058 13:44200069-44200091 CCTCCTCTGTAGAATGTGAGTGG - Intergenic
1111066437 13:83099324-83099346 GCCACTCTGGAGATTGAGGCAGG + Intergenic
1111232646 13:85363551-85363573 CCCAATCAGTAGGATGTGGGTGG + Intergenic
1111235283 13:85400847-85400869 CTCTGTCTGTAGAATGTGGGTGG + Intergenic
1114408581 14:22479255-22479277 CCTCCTCTGTAGAATGGGGGAGG + Intergenic
1114444970 14:22781406-22781428 GGCAGTCAGTAGAATGAGGGTGG - Intronic
1114967392 14:27980080-27980102 GCCATTATGTAGAATTAGGGAGG + Intergenic
1116689888 14:48091952-48091974 CCTACTCTGGAGGATGAGGTGGG + Intergenic
1116834127 14:49752636-49752658 ACAACTCTGTAGAATGGTGGGGG - Exonic
1117409482 14:55438402-55438424 GCCACTCTGTGGGTTGAGGGTGG - Intronic
1117653546 14:57931080-57931102 CTTCCTCTGTAAAATGAGGGAGG - Intronic
1118849018 14:69570790-69570812 GCCACTTGGTAGAATGAGGGAGG + Exonic
1119174590 14:72559849-72559871 CCCATTCTGTAGAAAGGGGAAGG + Intronic
1119996950 14:79263587-79263609 TCTCCTCTGTAAAATGAGGGAGG + Intronic
1120164864 14:81186836-81186858 CCTACTCAGGAGGATGAGGGTGG + Intronic
1124409146 15:29421326-29421348 CCCACTCTGGAGGATGAGGAAGG + Intronic
1125600640 15:40913777-40913799 CCCACTGTGTAGATAGAGGAAGG + Intergenic
1125732385 15:41900509-41900531 CCCCATCTGTAGAATGGGGAGGG - Exonic
1126062014 15:44791987-44792009 CCCACTCTGTACAGGGAGAGTGG + Intergenic
1126181961 15:45794021-45794043 CCCTCTGTGCAGAAGGAGGGAGG + Intergenic
1126997712 15:54463245-54463267 GCCAATCAGTAGAATGTGGGCGG + Intronic
1128357613 15:66939247-66939269 CCTACTCCATAAAATGAGGGAGG + Intergenic
1128752716 15:70160727-70160749 TCCCCTCTGTAAAATGAGGGTGG + Intergenic
1128890646 15:71328920-71328942 CCTGATCTGTAGAATGAGGCTGG + Intronic
1129618777 15:77123559-77123581 CCCACTGTGTAGAATGGTGAAGG + Intronic
1130743409 15:86625228-86625250 CCCAATCTGTAAAATGAAGGTGG + Intronic
1132783540 16:1641887-1641909 CCCACTCTGGAGCCTGGGGGGGG + Intronic
1133463981 16:6012202-6012224 CCTCATCTGTAGAATGAGGATGG + Intergenic
1133921675 16:10159129-10159151 CCTCCTCTCTACAATGAGGGTGG + Intronic
1134540083 16:15056679-15056701 GCCACTCTGTAGGCTGAGGCGGG + Intronic
1135051794 16:19199278-19199300 CCTCCTGTGTAGAATGAAGGAGG - Intronic
1135422915 16:22316774-22316796 CCCCTCCTGTAGCATGAGGGTGG + Intronic
1137337818 16:47568046-47568068 CCGACTTTGTAGAATGAGTGAGG + Intronic
1137536143 16:49327711-49327733 GCCACTCTGCAGAAAGAAGGTGG - Intergenic
1137620759 16:49875386-49875408 GCTACTCTGGAGACTGAGGGAGG - Intergenic
1137904019 16:52300607-52300629 CCTTCTCTATAAAATGAGGGAGG + Intergenic
1140115590 16:72038627-72038649 TCCAATGTGTAGAATGAGGCTGG - Intergenic
1140236128 16:73160556-73160578 CCCTCTATGTAGATGGAGGGAGG - Intergenic
1140479458 16:75254507-75254529 CCCAGTCTGGAGGATGGGGGTGG + Intronic
1140696874 16:77543421-77543443 CCCTGTCTGTAGAAGGAGGAAGG + Intergenic
1141983763 16:87566208-87566230 CCTCCTCTGTAAAATGAGGGTGG + Intergenic
1142644220 17:1301655-1301677 ACAAGTCTGTAGAAGGAGGGAGG + Intergenic
1142884861 17:2906117-2906139 CACACTCTGTGGAGTGAGTGAGG + Intronic
1144372764 17:14607784-14607806 CCAACTCTGTTGGATGAAGGAGG + Intergenic
1144745683 17:17612642-17612664 CACTCTCTGCAGAATGAGAGTGG - Intergenic
1145377071 17:22360622-22360644 GCTACTCTGGAGAATGAGGCAGG - Intergenic
1147896422 17:43754780-43754802 TCCACTTTGTAAAATGAGGGTGG - Exonic
1148893884 17:50828613-50828635 GACACTCCGTAGAATGTGGGTGG - Intergenic
1150598097 17:66624688-66624710 GCTACTCTGGAGACTGAGGGAGG + Intronic
1152486035 17:80593928-80593950 CACACTCTTTAGAATCACGGAGG - Intronic
1154056223 18:11015214-11015236 CCCACACTGAGGAATGAGGGGGG - Intronic
1154306667 18:13235593-13235615 ACCACTATTTAGAATGTGGGGGG - Intronic
1157595657 18:48862189-48862211 CCCTCTCTGTGGCATGAGGAAGG + Intronic
1158872983 18:61706856-61706878 CCTACTCTGAAGACTGAAGGTGG - Intergenic
1159820926 18:73142769-73142791 GCCACTCTGGAGACTGAGGTGGG - Intergenic
1160986831 19:1843071-1843093 CCCACTCTGTGGTAGGAGTGTGG + Intronic
1163384723 19:16992561-16992583 GCCACTCTGGAGACTGAGGCAGG - Intronic
1163451334 19:17379138-17379160 CCCACCCTGTGGAGTCAGGGTGG + Intergenic
1163791037 19:19306209-19306231 CCCCATCTGTAAAATCAGGGTGG - Intronic
1163978306 19:20873846-20873868 CCCACTGTGATGAATGAGTGGGG - Intergenic
1164210443 19:23093530-23093552 CCCACCCCCAAGAATGAGGGGGG - Intronic
1164883026 19:31752024-31752046 CCCTCTCTGGATAATGTGGGTGG - Intergenic
1167443243 19:49522191-49522213 CCTACTCTGGAGACTGAGGCAGG - Intronic
1168187563 19:54709656-54709678 TTCACTCTGTACAAGGAGGGGGG + Intergenic
925309229 2:2870465-2870487 CCCTCTGTGTAAAATGAGGAGGG - Intergenic
926810918 2:16754835-16754857 CCCACTTTGAAGGATGAGGGGGG - Intergenic
928216691 2:29367411-29367433 GCTAATCTGTAAAATGAGGGAGG + Intronic
930585125 2:53259324-53259346 ACCAATCTGTAGGATGTGGGTGG - Intergenic
931691046 2:64835181-64835203 CCCACTCTGGAGCATGGGGTGGG + Intergenic
937215501 2:120310262-120310284 CCTCATCTGTAAAATGAGGGGGG + Intergenic
937250255 2:120519361-120519383 CCCACTGGGGAGAATGAAGGAGG - Intergenic
942468261 2:176231531-176231553 CCCACTCTCTTTAATGAGGTGGG - Intergenic
943569370 2:189555055-189555077 GCCACTCGGGAGACTGAGGGAGG + Intergenic
944413040 2:199460162-199460184 CCCACTCTTTTGACTGGGGGTGG - Intronic
945062612 2:205922501-205922523 CTCACTCTGTTGAGTGAGGCTGG + Intergenic
945694474 2:213085685-213085707 CATAATCTGTAGAATGAAGGAGG + Intronic
945861282 2:215125323-215125345 CTAACTCTGAAGAATGATGGTGG + Intronic
946163824 2:217851774-217851796 CTCTCCCTGTAGGATGAGGGAGG + Intronic
1168740360 20:185026-185048 CCTACTTTGTAGAATGAGTTAGG - Intergenic
1168826588 20:818447-818469 CCTCATCTGTAGAATGAGTGAGG + Intergenic
1169136058 20:3198290-3198312 CCTACTCGGGAGAATGAGGCAGG + Intronic
1169150973 20:3289098-3289120 GCTACTTTGTAGAATGAGGTGGG + Intronic
1171004564 20:21451703-21451725 CCTACTGTATAGAGTGAGGGAGG + Intergenic
1172259879 20:33554362-33554384 CCCACTCAGGAGACTGAGGCAGG - Intronic
1173014647 20:39214279-39214301 CCCAGTCTGGACAAGGAGGGAGG + Intergenic
1173141939 20:40492206-40492228 CCCACTCTGTAAAATGAAGGTGG + Intergenic
1173852836 20:46229548-46229570 CCCATTTTGTGAAATGAGGGTGG + Intronic
1174173654 20:48631938-48631960 CACCCTCTGTAGAATGAAGCCGG + Intronic
1174181264 20:48676467-48676489 CCCACTCTGTAGGTGGAAGGAGG - Intronic
1174516804 20:51098862-51098884 CACATTCTGTAGAATGATGGAGG + Intergenic
1175071066 20:56334340-56334362 CCTACTCAGTAGACTGAGGCAGG + Intergenic
1177433676 21:21023410-21023432 GCCACTCTGTAGGCTGAGGCGGG + Intronic
1178934631 21:36850824-36850846 TCCTCGCTGTAGATTGAGGGTGG - Intronic
1179000183 21:37450441-37450463 CCCCCTCTGTAAAGTGAGGTGGG + Intronic
1180151533 21:45950679-45950701 GCCACTCTGGAGAAGGAGGGTGG - Intergenic
1182185237 22:28394726-28394748 CCCAGTCTCCATAATGAGGGTGG + Intronic
1182228476 22:28818478-28818500 CTCACTTTGTACAATGAGGTAGG + Intergenic
1182924197 22:34107385-34107407 ACTACTCTGGAGACTGAGGGAGG - Intergenic
949293474 3:2493449-2493471 CCAGCCCTGTAAAATGAGGGAGG - Intronic
949541290 3:5034158-5034180 CCCACTCTGGAGGCTGAGGTGGG + Intergenic
949807279 3:7969623-7969645 CCTCCTCTGTAAAATGAAGGTGG - Intergenic
950091682 3:10300187-10300209 TCCCCACTGTAGAATCAGGGTGG - Intronic
950128697 3:10527328-10527350 CCTACCCTGTAAAATGGGGGTGG - Intronic
950312545 3:11971311-11971333 CCTACTCTGGAGACTGAGGCTGG + Intergenic
952897032 3:38084682-38084704 CCCAGGCTGTAGACTCAGGGCGG - Intronic
952928929 3:38344895-38344917 CTCACTCTGTAAAATGAAGATGG + Intergenic
953435487 3:42874310-42874332 CTCACTCTGTAGGATGCAGGCGG + Exonic
954995112 3:54874253-54874275 CCCACTCTGCAGGATGAGTTAGG + Intronic
956756839 3:72396937-72396959 GCTACTCTGGAGACTGAGGGAGG - Intronic
957723574 3:84035302-84035324 CTCACCCTGTAGAATGAGTTAGG - Intergenic
958772160 3:98437887-98437909 CCCACTCTGAACAAGGAGGCAGG + Intergenic
959918901 3:111849280-111849302 CCTACTCTGGAGACTGAGGCAGG - Intronic
960202332 3:114852373-114852395 GCCACTCGGTAGACTGAGGCAGG - Intronic
960576309 3:119233246-119233268 CCCACTCTGTAGAATGAGGGAGG - Intronic
960940333 3:122929046-122929068 CCCACTCTGTGGCCTGGGGGAGG + Exonic
961485144 3:127210910-127210932 CCCCCTCTGTGGAATGGGGAGGG - Intergenic
966526375 3:180923835-180923857 CCCACTCAGGAGACTGAGCGGGG - Intronic
968648202 4:1750166-1750188 CCCACTCTGCAGAGAGAGGAGGG + Intergenic
969547850 4:7843667-7843689 AACACTCTGCAGAATGAGGATGG - Intronic
969781944 4:9411944-9411966 CTAACTCTGAAGAATGATGGTGG + Intergenic
970902779 4:21178927-21178949 GCCACTCAGTAGGATGAGGTGGG - Intronic
972530449 4:39956782-39956804 CCCACTCTGGAGGCTGAGGCAGG - Intronic
976217242 4:82726961-82726983 CCCACTCTGCAGGATGAGCTTGG - Intronic
978134465 4:105240549-105240571 CACACTGTGTAGAAGGATGGAGG + Intronic
979883099 4:125987382-125987404 CCCACACTGAACACTGAGGGTGG - Intergenic
981415528 4:144488399-144488421 CACACTCTGTAGAAGGGTGGGGG + Intergenic
983640412 4:169939997-169940019 ACCACTCAGTCGAGTGAGGGAGG - Intergenic
985810496 5:2080035-2080057 TACACTCTGGAGAATGAGGCTGG + Intergenic
985976028 5:3419783-3419805 CTCACTCTCTGGAATGCGGGTGG + Intergenic
986006688 5:3674113-3674135 CCAGCTCTGTAGAAAGAGGGTGG - Intergenic
986428723 5:7660350-7660372 CCTTCTCTGAAGAATGAGAGAGG + Intronic
987304123 5:16621766-16621788 GTCATTCTCTAGAATGAGGGAGG + Intergenic
988839060 5:35065594-35065616 GCCACTCTGTTGAATGAAGCAGG - Exonic
989577165 5:42999233-42999255 GCTACTCTGTAGGCTGAGGGGGG + Intergenic
991235754 5:64395004-64395026 CCAACACTGTAGAATAAGGTTGG - Intergenic
992219797 5:74560589-74560611 TCCAGTCTATAGAATGAGAGTGG + Intergenic
992277906 5:75140090-75140112 GCTACTCTGGAGACTGAGGGAGG + Intronic
992438828 5:76780581-76780603 GCTACTCTGGAGAATGAGGTGGG + Intergenic
993394691 5:87370548-87370570 GCCACTGGGTAGAATGAGGCAGG + Intronic
995213412 5:109567489-109567511 CCCAGTCTGTGGACTGAGGGTGG - Intergenic
997319426 5:132965037-132965059 CCTACTCTGGAGACTGAGGTGGG + Intergenic
998028804 5:138845468-138845490 CACATGCTATAGAATGAGGGTGG + Intronic
999242798 5:150137344-150137366 CCCTGTCTGTACAGTGAGGGAGG + Intronic
999268554 5:150282953-150282975 CCGACTCTGTAGAGTAAGGGAGG - Intronic
1001219901 5:169891622-169891644 CCCCATCTCTATAATGAGGGGGG - Intronic
1001219977 5:169892243-169892265 CCCCATCTCTATAATGAGGGGGG - Intronic
1001793567 5:174482935-174482957 CTCTCTCTGTAGAACGGGGGTGG - Intergenic
1004159800 6:13203568-13203590 CCCACTCTGTGGAAAGAGAGTGG - Intronic
1004523142 6:16381173-16381195 GCTACTCGGGAGAATGAGGGAGG + Intronic
1004839826 6:19570177-19570199 GCCATTCTTTAGAATGAGGTTGG - Intergenic
1007147764 6:39653798-39653820 CCAACTCTGTAGGATGCCGGTGG + Intronic
1007296228 6:40823469-40823491 CCCATTCTGTAGGTTGAGGAGGG - Intergenic
1007548246 6:42710013-42710035 CCCAGCCTGCAGACTGAGGGTGG - Intronic
1008833384 6:55797192-55797214 CCCATTCTGTAGAATGTTAGAGG + Intronic
1008947693 6:57116851-57116873 GCTACTCTGTAGGATGAGGTGGG + Intronic
1009333819 6:62459874-62459896 CCTACTCTGGAGGCTGAGGGAGG - Intergenic
1009568899 6:65354703-65354725 CCTACTCTGGAGACTGAGGCAGG + Intronic
1012405636 6:98893987-98894009 CCCACTCAGGAGACTGAGGTGGG - Intronic
1013550559 6:111203608-111203630 GCCACTCTGGAGGCTGAGGGAGG + Intronic
1015657286 6:135533108-135533130 CCAAGGCTGTAGAATGAGTGAGG - Intergenic
1015680987 6:135808222-135808244 CCCACTCTGTAGATTTAGGAAGG + Intergenic
1016216812 6:141614018-141614040 GCCTCTCTGTATGATGAGGGTGG + Intergenic
1017943795 6:159077293-159077315 CCCACTCTGCAGTATGTGGGAGG + Intergenic
1019536509 7:1532116-1532138 CCCACCCTGGAGAATCAGAGGGG - Intronic
1019659076 7:2213764-2213786 GCCACCCTGGAGCATGAGGGAGG + Intronic
1019974590 7:4570540-4570562 CCTACTCTGGAGACTGAGGTGGG + Intergenic
1023154153 7:37231253-37231275 CCTAATCGGTTGAATGAGGGGGG - Intronic
1023821714 7:43984312-43984334 CCCTATCTGTAAAATGAGGATGG - Intergenic
1028515123 7:91669910-91669932 AACACTGTGTAAAATGAGGGGGG - Intergenic
1029426777 7:100499892-100499914 CCCACTCGGGAGACTGAGGTGGG - Intergenic
1029749976 7:102537731-102537753 CCCTATCTGTAAAATGAGGATGG - Intergenic
1029767926 7:102636837-102636859 CCCTATCTGTAAAATGAGGATGG - Intronic
1030680602 7:112430121-112430143 CTCCCTCTGTGGAATGAGAGTGG - Intronic
1031322908 7:120355433-120355455 GCCACTCTGGAGACTGAGGCAGG + Intronic
1033598361 7:142871984-142872006 TCCACCCTGTGGAATGCGGGAGG + Exonic
1035463789 7:159062795-159062817 ACCAATCAGTAGGATGAGGGTGG - Intronic
1035847666 8:2882662-2882684 CCCACTCAGCAGAAGGAGGATGG - Intergenic
1036555128 8:9852856-9852878 GCCACTCAGGAGAATGAGGTGGG + Intergenic
1036641468 8:10586778-10586800 CCCTCCCTGTAGGCTGAGGGAGG - Intergenic
1036837547 8:12088160-12088182 CTAACTCTGAAGAATGATGGTGG + Intergenic
1036859341 8:12334408-12334430 CTAACTCTGAAGAATGATGGTGG + Intergenic
1037185577 8:16058501-16058523 GCCACTCTGAAGGATGAGGGAGG + Intergenic
1037215355 8:16445060-16445082 CCCATTTTGTAGAATGAAAGTGG - Intronic
1038682654 8:29683719-29683741 CACTCTCTATAGAATGGGGGAGG + Intergenic
1038693053 8:29780682-29780704 CCCCATCTGTAAAATGAAGGTGG + Intergenic
1040747772 8:50666462-50666484 CACACACTGAAGTATGAGGGTGG + Intronic
1041131659 8:54708466-54708488 CCTACTCTGGAGATTGAGGCAGG - Intergenic
1042777966 8:72455819-72455841 CTCACTTTGTAGAATGAGTTAGG + Intergenic
1045178366 8:99752093-99752115 CCCACTCAGGAGACTGAGAGAGG + Intronic
1045570449 8:103363579-103363601 TGCACTCTGGAGAATGTGGGTGG - Intergenic
1048304053 8:133271229-133271251 CCCACTTGCTAGACTGAGGGAGG - Intronic
1049008220 8:139871043-139871065 CCCTCTCTGTAAAACAAGGGTGG + Intronic
1050015659 9:1231109-1231131 CCCTCTGTGTGGGATGAGGGTGG + Intergenic
1050056158 9:1657518-1657540 CTGACTTTGTAGAATGAGTGAGG + Intergenic
1050484827 9:6123102-6123124 GCCACTCTGGAGGATGAGGTGGG + Intergenic
1050625682 9:7501536-7501558 CTCACCCTGTAGACTGTGGGAGG - Intergenic
1052977657 9:34423298-34423320 CCCACTCTGGGGAATTAGGGAGG + Intronic
1053188599 9:36039853-36039875 CCCACACTGTAGAAAGAGCTAGG + Intronic
1053198658 9:36138005-36138027 CCCTGTCTGTACAATGAGGGTGG + Intronic
1053598672 9:39588538-39588560 CCCACTCTGAAATATCAGGGTGG + Intergenic
1054778055 9:69140436-69140458 CCCACTCTGTAGCATGAATTGGG - Intronic
1055446695 9:76391070-76391092 ACCATTCTGTTGAATGAGGAAGG - Intronic
1055779992 9:79810637-79810659 CCTACTCAGAAGAATGAGGTGGG - Intergenic
1056071103 9:82987793-82987815 TCTAATCTGTAAAATGAGGGAGG - Intronic
1058428812 9:104900049-104900071 CCCATTGTGCAGACTGAGGGGGG - Intronic
1058812742 9:108657031-108657053 CCCACTCTGTAGATTCTAGGGGG - Intergenic
1058907438 9:109493352-109493374 CCCCCTCTGTAAAATGGGGCTGG + Intronic
1059423347 9:114206135-114206157 CTCTCTTTGTAGAATGGGGGTGG - Intronic
1060393794 9:123301306-123301328 GCCACTCTGGAGACTGAGGCTGG + Intergenic
1060560758 9:124540685-124540707 CCTACTCTGGAGACTGAGGCAGG + Intronic
1061049335 9:128185404-128185426 CCTCATCTGTAAAATGAGGGGGG - Intronic
1061697397 9:132387292-132387314 CCCTGTCTGTAGATTGGGGGGGG - Intronic
1062404563 9:136389149-136389171 TCCACTGTGTGGACTGAGGGTGG - Intronic
1062508245 9:136889393-136889415 CCTACTCTGGAGGATGAGGCAGG - Intronic
1187471557 X:19574269-19574291 CCCATTCTGAAGAATAAGTGGGG - Intronic
1188137192 X:26504846-26504868 CCCACTCTGGGGAGTGGGGGCGG - Intergenic
1191207680 X:57851718-57851740 CACACTCTGGGGAATGTGGGGGG + Intergenic
1193127619 X:77886067-77886089 GCCACTCAGGAGGATGAGGGAGG - Intronic
1193556453 X:82960173-82960195 CACACTCAGTGGAATTAGGGAGG + Intergenic
1196303005 X:114068109-114068131 CCTACTCTGGAGGATGAGGTAGG - Intergenic
1199709576 X:150459606-150459628 CCTCATCTGTACAATGAGGGTGG + Intronic
1199963943 X:152802635-152802657 CCCACTCGGGAGGATGAGGCAGG - Intergenic
1200301463 X:154980853-154980875 CCCACTCTGGAGGCTGAGGTGGG + Intronic
1200419886 Y:2953602-2953624 CCCACTCAGTAGGCTGAGGGAGG + Intronic
1201245998 Y:12004310-12004332 ACTACTCTGTAGACTGAGGTAGG + Intergenic
1202375353 Y:24230244-24230266 GCTACTCAGGAGAATGAGGGAGG + Intergenic
1202495427 Y:25439876-25439898 GCTACTCAGGAGAATGAGGGAGG - Intergenic