ID: 960582783

View in Genome Browser
Species Human (GRCh38)
Location 3:119294799-119294821
Sequence ACCGGCTGCCCCGCGGCTCT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 89}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960582783_960582790 7 Left 960582783 3:119294799-119294821 CCCAGAGCCGCGGGGCAGCCGGT 0: 1
1: 0
2: 0
3: 6
4: 89
Right 960582790 3:119294829-119294851 CCCGGGAGCCCATCTTACAGCGG 0: 1
1: 0
2: 0
3: 8
4: 95
960582783_960582795 21 Left 960582783 3:119294799-119294821 CCCAGAGCCGCGGGGCAGCCGGT 0: 1
1: 0
2: 0
3: 6
4: 89
Right 960582795 3:119294843-119294865 TTACAGCGGTGCCAAGCAGAGGG 0: 1
1: 0
2: 0
3: 3
4: 73
960582783_960582794 20 Left 960582783 3:119294799-119294821 CCCAGAGCCGCGGGGCAGCCGGT 0: 1
1: 0
2: 0
3: 6
4: 89
Right 960582794 3:119294842-119294864 CTTACAGCGGTGCCAAGCAGAGG 0: 1
1: 0
2: 0
3: 7
4: 77
960582783_960582796 22 Left 960582783 3:119294799-119294821 CCCAGAGCCGCGGGGCAGCCGGT 0: 1
1: 0
2: 0
3: 6
4: 89
Right 960582796 3:119294844-119294866 TACAGCGGTGCCAAGCAGAGGGG 0: 1
1: 0
2: 0
3: 8
4: 115
960582783_960582787 -10 Left 960582783 3:119294799-119294821 CCCAGAGCCGCGGGGCAGCCGGT 0: 1
1: 0
2: 0
3: 6
4: 89
Right 960582787 3:119294812-119294834 GGCAGCCGGTGATCTAGCCCGGG 0: 1
1: 0
2: 0
3: 7
4: 89
960582783_960582797 25 Left 960582783 3:119294799-119294821 CCCAGAGCCGCGGGGCAGCCGGT 0: 1
1: 0
2: 0
3: 6
4: 89
Right 960582797 3:119294847-119294869 AGCGGTGCCAAGCAGAGGGGCGG 0: 1
1: 0
2: 2
3: 14
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960582783 Original CRISPR ACCGGCTGCCCCGCGGCTCT GGG (reversed) Exonic