ID: 960584268

View in Genome Browser
Species Human (GRCh38)
Location 3:119306225-119306247
Sequence TTGGACTCCTTGAGACAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 3, 3: 14, 4: 179}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960584268 Original CRISPR TTGGACTCCTTGAGACAAAA TGG Intronic
902948734 1:19863916-19863938 TTGGGCTTCTTTAAACAAAAGGG - Intergenic
903835730 1:26202236-26202258 CTGAACTCCTGGAGAGAAAAAGG + Intronic
904961590 1:34337492-34337514 TTGGATTCCTTGAAACAACAAGG - Intergenic
906935257 1:50208998-50209020 TTTGAATCCTTGGGAGAAAAAGG + Intergenic
907212102 1:52832703-52832725 CTGGACTCCTTGGGAAAAACAGG - Intergenic
908104370 1:60826115-60826137 TTGGATTGCTTGAAACACAAAGG - Intergenic
912526106 1:110283991-110284013 TTGGTTTCCTTGGGATAAAATGG + Intergenic
912526323 1:110286012-110286034 TTGGTTTCCTTGGGATAAAATGG - Intergenic
916997267 1:170314536-170314558 TTAGACTCATTGAGTCAAACAGG + Intergenic
917279399 1:173366633-173366655 TTGGACTGTTTGAAACACAAAGG + Intergenic
917293692 1:173496302-173496324 CTGGACTCCTTGGGAAAAATAGG + Intergenic
918296674 1:183163569-183163591 TGAGACTCCTTGATACAAAAGGG + Intergenic
918490314 1:185074534-185074556 TTGGAATCCCTGAGTCATAAGGG - Intronic
921336388 1:214091319-214091341 TTGGTCTCCTAAAGACAACAGGG - Intergenic
921535697 1:216346286-216346308 TGGGACTCCTTGGGAAAAAAAGG + Intronic
924483303 1:244455754-244455776 TGGGACTCCTTGGGAAAAACAGG + Intronic
1066101711 10:32123401-32123423 TTGGACTCCATGAGACACACAGG + Intergenic
1067286010 10:44908133-44908155 TTGGACTCCTTAAGATGCAATGG + Intergenic
1069238435 10:66107634-66107656 TTGAACTCCTTGTGGGAAAAAGG - Intronic
1070830327 10:79414131-79414153 TTTGTCTCCTTGAGACAAGGTGG - Intronic
1072022679 10:91418963-91418985 TTGGACTCATTGAGACTAAAGGG + Intronic
1077655966 11:4018929-4018951 TTGCACTCCTGAAGGCAAAATGG + Intronic
1078499825 11:11860366-11860388 TTAGACTCCTTAAGTCAAAGTGG - Intronic
1078724134 11:13913439-13913461 CTGGTCTCCTTGAGAGAAATTGG - Intergenic
1080432674 11:32213103-32213125 TTGCAATTTTTGAGACAAAAAGG - Intergenic
1080810677 11:35701295-35701317 TGGGACTCCTTGGGAAAAACAGG - Intronic
1082055001 11:47807132-47807154 TTAGACTCCCTGTGAGAAAAGGG + Exonic
1082834527 11:57641854-57641876 TAGGCCTCCTTGAGAAAAAAAGG + Intergenic
1083001541 11:59296851-59296873 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1083448591 11:62727359-62727381 TTGGGCTCCGTGAGCCGAAAGGG - Exonic
1088930545 11:114347155-114347177 CTGGACTCCTTGGGTCAATAGGG - Intergenic
1089645070 11:119873645-119873667 TTGGATTTCTTGATACCAAAAGG - Intergenic
1090810258 11:130233634-130233656 TTGACCTTCTTGAGACAAGAGGG - Exonic
1092128120 12:6089554-6089576 TTTGTCTCCTGGAGACAAAGGGG - Intronic
1093043598 12:14414992-14415014 GTGGACTGCTTGAGCCTAAAGGG - Intronic
1094239899 12:28210568-28210590 TGGGACTCCTTGGGAAAAACAGG - Intronic
1094741607 12:33296160-33296182 ATGGACTCCTTGAGAAATACAGG + Intergenic
1097254313 12:57660820-57660842 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1098618297 12:72557496-72557518 GTTTACTCCTTGAGACATAAAGG - Intronic
1098663875 12:73135428-73135450 TCAGAGTCCTTGAAACAAAAGGG - Intergenic
1101511158 12:105393632-105393654 TTGGACTCCTTGCTACAGAAAGG - Intronic
1103193385 12:119021448-119021470 TAGGACTCCTTGAGTCAGATAGG + Intronic
1110530618 13:76593127-76593149 TTGACCTTCTTGAGACAAGAGGG + Intergenic
1114274341 14:21128794-21128816 TTGGATTGCTTGAAACACAAAGG + Intergenic
1114727325 14:24953034-24953056 CTGGCCTCCTTTAGACAAAAAGG - Intronic
1118840371 14:69505482-69505504 GTGGTCTCTTTGAGACAACATGG + Intronic
1121960678 14:98256524-98256546 ATGGACTCTTTGTGGCAAAAAGG + Intergenic
1123170873 14:106371736-106371758 CTGGACTCATGGAGAAAAAAAGG - Intergenic
1126383927 15:48074789-48074811 TAGGATGCCTTGAGACACAATGG + Intergenic
1127228328 15:56959607-56959629 TTAGACTCTTTGAGAAAAAAAGG - Intronic
1128516600 15:68345815-68345837 TTGGACTCCTGGGGACAGGATGG + Intronic
1128861156 15:71073827-71073849 TTGAACTCCTTGAGTTAATAAGG - Intergenic
1133364462 16:5199785-5199807 ATGGACTCCTTGAGAATTAAAGG - Intergenic
1133879215 16:9764569-9764591 TTGGACTCATTGAGAGTAAGAGG + Exonic
1134422227 16:14104604-14104626 TTGGATTCCTTATGACAAATGGG - Intronic
1134464725 16:14464958-14464980 GTTGACTCCTTCAGGCAAAAGGG + Intronic
1138884307 16:61056398-61056420 TTGAACACCTTAAAACAAAATGG + Intergenic
1140407304 16:74719297-74719319 CTGGGGTCCTTGAGTCAAAATGG + Intronic
1140841486 16:78843526-78843548 TTTGACTCTTTGACACAGAATGG + Intronic
1145893124 17:28432787-28432809 ATGGACTATATGAGACAAAAGGG + Intergenic
1146558741 17:33849792-33849814 TTGGACTCCTGAAGGCAACAGGG + Intronic
1154959861 18:21297412-21297434 TTGGGCGCCTTGAGGGAAAAGGG + Intronic
1155918491 18:31579095-31579117 TTGGACATGTTGAGATAAAAAGG - Intergenic
1159426244 18:68290877-68290899 TTGTAATCCTAGAGAAAAAATGG + Intergenic
1159509407 18:69377231-69377253 TTGGAGCCCTTGAGAGAAACAGG + Intergenic
1160274149 18:77414646-77414668 TTGTAATCCTGGAAACAAAAAGG - Intergenic
1164824435 19:31274036-31274058 TTGGACTCCTCTTGAGAAAAAGG + Intergenic
1166402564 19:42494204-42494226 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1168027610 19:53654353-53654375 TGGGACTCCTTGGGAAAAACAGG + Intergenic
925536292 2:4921349-4921371 GTGGTCTCCTTGGGTCAAAATGG - Intergenic
932154773 2:69406438-69406460 ATGGAAACTTTGAGACAAAAAGG + Intronic
938177966 2:129153467-129153489 CTAGACACCTTGAGCCAAAAGGG - Intergenic
941347915 2:164392332-164392354 TTTGACTCTTTGTGATAAAATGG + Intergenic
941639588 2:167972750-167972772 TGGGACTCCTTGGGAAAAACAGG + Intronic
941668472 2:168264811-168264833 TTGGAGTCTTCAAGACAAAATGG - Intergenic
943515373 2:188879558-188879580 GTGGACTCCTTGAGAAAATGAGG + Intergenic
944780334 2:203010948-203010970 GTAGACTCCTAGAGACAATACGG + Intronic
945806440 2:214495729-214495751 TTGGATTTCTTTAGAAAAAATGG - Intronic
946520696 2:220461227-220461249 CTGGACGTCTTGAAACAAAATGG + Intergenic
1170354415 20:15476757-15476779 TTGGAATCCTGCAGATAAAATGG + Intronic
1170659824 20:18326461-18326483 TTTGACTCCTGGATGCAAAAAGG + Intergenic
1171204987 20:23272168-23272190 GTGGAGTCCTTCAGACACAATGG - Intergenic
1171442156 20:25173829-25173851 TGGAACTCCTTGAGAAAAATAGG - Intergenic
1173047526 20:39526774-39526796 TTGGACTCTTTGAGAATAACAGG + Intergenic
1173052089 20:39573209-39573231 GTGGACTCCATCATACAAAATGG + Intergenic
1173263595 20:41458744-41458766 TAGGACTTCTGGAAACAAAATGG - Intronic
1174682428 20:52421660-52421682 CTGTAGTCCTTGAGTCAAAAAGG - Intergenic
1174815040 20:53680062-53680084 TTGGAAGCCTTCAGTCAAAAAGG - Intergenic
1175209911 20:57347430-57347452 TTTGCCTCCTAGAAACAAAAAGG - Intergenic
1175640355 20:60624354-60624376 TTGGACTCTTTGAAATACAAGGG + Intergenic
1180245931 21:46547244-46547266 TTGGATTCCTTAAGAAAATAAGG + Intronic
1182429159 22:30289951-30289973 TTGAAGTCCTTGAGACAGAAGGG + Intronic
1184630314 22:45772856-45772878 TTGAAGTCCCTGATACAAAATGG + Intronic
949381380 3:3449547-3449569 TAGAATTCCTTAAGACAAAAAGG + Intergenic
949962827 3:9328420-9328442 CTGGACTCCTTGGGAAAAACAGG - Intronic
950102019 3:10363308-10363330 TTGGAGCCCTGGAGATAAAAAGG - Intronic
950605716 3:14078215-14078237 CTGGACTCCTTGGGAAAAACAGG - Intronic
951851512 3:27146416-27146438 TTGGACAACTGGAGAAAAAAAGG + Intronic
952817581 3:37458992-37459014 TAGGACTCCTTCTGGCAAAAAGG - Intronic
959048425 3:101500172-101500194 TTAGACTGCTTCAGAGAAAAGGG + Intronic
960584268 3:119306225-119306247 TTGGACTCCTTGAGACAAAATGG + Intronic
961429468 3:126871141-126871163 TTGTTCTCCTTGATAGAAAATGG + Intronic
961595805 3:128015332-128015354 TGGGACTCCTTGGGAAAAACAGG + Intergenic
963837679 3:150073596-150073618 TTTGACTTCTTGAGACAGGAAGG + Intergenic
965588456 3:170340511-170340533 CTGGACTCCTTGGGAAAAACAGG - Intergenic
967353697 3:188544109-188544131 TTGGACTCCTTGAGAAATGGAGG - Intronic
967789621 3:193533289-193533311 TTGAACTCATTGAGAGAAATTGG - Intronic
968963118 4:3755525-3755547 ATGGACTCCTAGAGCCTAAAAGG - Intergenic
969420078 4:7088923-7088945 CTGGACTCCTTGAGAAAAACAGG - Intergenic
970102746 4:12543969-12543991 CTGGACACATTCAGACAAAATGG + Intergenic
970359575 4:15295328-15295350 TTTGACTCTTGGAAACAAAATGG - Intergenic
971179992 4:24320988-24321010 TGGGACTCGGTGAGAGAAAACGG - Intergenic
972344848 4:38184097-38184119 TTTGATTCCTTGAGATGAAAAGG + Intergenic
972818986 4:42677212-42677234 CTGGACTCCTTGGGAAAAATGGG + Intergenic
972857689 4:43127169-43127191 ATGCATTCCTTGAGAGAAAAAGG + Intergenic
972928887 4:44047053-44047075 TTGGACTTTTTGTAACAAAAGGG + Intergenic
973054331 4:45635807-45635829 TTGGATTGCTTGAAACACAAAGG + Intergenic
973802165 4:54489452-54489474 TTGGACTCTCAGATACAAAATGG + Intergenic
974169650 4:58250210-58250232 CTGGACTCCTTGAGAGACAGGGG - Intergenic
974399604 4:61387048-61387070 TTGGCCGCCTTGAGAAATAAAGG + Intronic
979021418 4:115503904-115503926 TTGGGCTCCTGAAGAGAAAAAGG - Intergenic
979456533 4:120931586-120931608 TTGCACTTATTGAAACAAAATGG + Intergenic
980295921 4:130917130-130917152 TTGGATTACTGGAGACAAACTGG - Intergenic
981036246 4:140172185-140172207 TGGGATTCTTTGAGATAAAAAGG + Intergenic
982493916 4:156065922-156065944 TTAGACTACATGAAACAAAATGG - Intergenic
982864221 4:160489884-160489906 TTGGACTCCTTGTGAAAAACAGG + Intergenic
985891806 5:2721733-2721755 TTCAAGTCCATGAGACAAAATGG - Intergenic
986532472 5:8753195-8753217 TTGGTATCCTTGAGATAACAGGG - Intergenic
987648117 5:20702685-20702707 TTATACTTCTTGAGATAAAAAGG + Intergenic
989470007 5:41805350-41805372 TTTGCCTTCTTGAAACAAAATGG - Intronic
990123788 5:52488644-52488666 TTGGCCTGCTTGAGAAATAAAGG - Intergenic
991307673 5:65197144-65197166 TTGGACACCTTGAGAAAAGGAGG + Exonic
991695764 5:69269607-69269629 TTTGACTCCTTGACAAAAATGGG + Intronic
992125359 5:73634111-73634133 ATGGATACCTTGAGACTAAAAGG - Intronic
993297925 5:86167491-86167513 TTGGCCACCTTGAAACTAAAAGG - Intergenic
998571385 5:143261788-143261810 TTGGACTCTTTGCCACAAAGAGG + Intergenic
1002389835 5:178901016-178901038 GTGTACTACTTAAGACAAAAAGG - Intronic
1004970114 6:20900523-20900545 ATGGGCTACTTGAGAGAAAAAGG + Intronic
1008481448 6:51990073-51990095 TTGGACTAAATGAGAAAAAAAGG - Intronic
1010823727 6:80447614-80447636 ATGGATTCCTTGGGACAAAAGGG - Intergenic
1011796859 6:90965020-90965042 TTGAACTCATGGAGACAGAAAGG - Intergenic
1012068930 6:94586810-94586832 TTGTACTCATTGACTCAAAATGG + Intergenic
1012318295 6:97808513-97808535 CTGGACTACTTCACACAAAATGG + Intergenic
1013431125 6:110055576-110055598 ATGGACTCCTGGAGACAGAGAGG + Intergenic
1014840313 6:126211768-126211790 TTGGATTACTTGAAACACAAAGG - Intergenic
1015377524 6:132527684-132527706 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1016854464 6:148652668-148652690 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1017404752 6:154107209-154107231 CTGGACTCCTTGGGAAAAACAGG - Intronic
1022650091 7:32266665-32266687 TTGGACTTCTTCAGACAGAATGG + Intronic
1022806721 7:33829985-33830007 TTAAACTCCTTAAAACAAAAGGG + Intergenic
1022844045 7:34192038-34192060 TTAGACTCCTGGAGAAAAAGAGG - Intergenic
1024151158 7:46572469-46572491 TCGAACTTCTTGAGATAAAAAGG - Intergenic
1024436970 7:49368266-49368288 TTGGAAGACTTGAGACTAAACGG + Intergenic
1025768865 7:64484654-64484676 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1027559704 7:79713014-79713036 TTGGATTCTGTGAGACAAGATGG + Intergenic
1029811058 7:103049652-103049674 TGGGACTCCTTGGGAAAAACAGG - Intronic
1030157941 7:106475794-106475816 GTGGACTCAGTGAGACAAATTGG - Intergenic
1034020756 7:147639754-147639776 CTAGACTTCTTGAGACAAACAGG - Intronic
1034177339 7:149110617-149110639 TTGAATTCCTTGTGACATAAGGG - Intronic
1036644907 8:10607011-10607033 CTGGAGTCCTTGAGCCCAAAGGG + Exonic
1037865608 8:22440614-22440636 TCACACTCCTTGAGACAAAGCGG + Intergenic
1038038615 8:23706191-23706213 TTGGACTCCTCGAGAGAAAATGG + Intronic
1039043597 8:33430475-33430497 TTAGTCACCTTGAGAAAAAAGGG + Intronic
1039296704 8:36164223-36164245 TCGAACTCCGTGAGGCAAAAAGG - Intergenic
1041755939 8:61313256-61313278 GGAGACTGCTTGAGACAAAAGGG + Intronic
1041888682 8:62843967-62843989 TTGGACTCCTACTGACAAATGGG - Intronic
1041991996 8:64004345-64004367 TTAGACTCCTAAAGCCAAAATGG - Intergenic
1043472457 8:80576512-80576534 TTCGACTCCTTGAATGAAAAAGG + Intergenic
1043475713 8:80603670-80603692 CTGGACTCTATGAGACAATATGG - Intergenic
1046579019 8:116068557-116068579 TGGGACTCCTTGAGACAAACAGG + Intergenic
1047536958 8:125728732-125728754 TTGGACTGCTTAAGGCCAAATGG - Intergenic
1049056163 8:140239103-140239125 TTTGACTCCGTGAAACAGAAAGG - Intronic
1050237430 9:3596683-3596705 TGTCCCTCCTTGAGACAAAAAGG - Intergenic
1052663631 9:31467972-31467994 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1055970845 9:81911319-81911341 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1056345155 9:85686220-85686242 TTGGATTCAATGACACAAAAAGG + Intronic
1056726926 9:89127441-89127463 TGGGGCTCCTTGAGAAAAACAGG + Intronic
1056898768 9:90578856-90578878 TTGGACACTAGGAGACAAAAAGG + Intergenic
1058355754 9:104081966-104081988 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1058799583 9:108531999-108532021 TTTTACTCCTTTAGAGAAAAGGG + Intergenic
1058817520 9:108698824-108698846 TAGGACTGCTTGAGCCGAAAAGG + Intergenic
1061513634 9:131076002-131076024 TTGGCCTCCTGGAGCCAACAGGG + Intronic
1189555555 X:42141773-42141795 TTAAACTCCTTGAGCCAATAAGG + Intergenic
1191617244 X:63182421-63182443 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1191619054 X:63196502-63196524 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1193505367 X:82336172-82336194 TTGGCTTCCTTGGGCCAAAATGG - Intergenic
1193707294 X:84837317-84837339 TTGGAGTGCTTGAAACACAAAGG + Intergenic
1194379907 X:93178943-93178965 TGGGACTCCTTGGGAAAAATAGG + Intergenic
1198181978 X:134219230-134219252 TGGGACTCCTTGAGAAAAACAGG - Intergenic
1199269052 X:145861751-145861773 TTGGAATTCTTGAAACAGAAAGG + Intergenic
1199999505 X:153050956-153050978 ATTTACTCCTTGAGACAATAAGG - Intergenic
1201795359 Y:17890684-17890706 TTTGACTATTTGAGAGAAAAAGG + Intergenic
1201806197 Y:18015301-18015323 TTTGACTATTTGAGAGAAAAAGG - Intergenic
1202346247 Y:23931225-23931247 TTGGCCTCTTTGAGAAATAAAGG + Intergenic
1202356790 Y:24059766-24059788 TTTGACTATTTGAGAGAAAAAGG + Intergenic
1202513988 Y:25610348-25610370 TTTGACTATTTGAGAGAAAAAGG - Intergenic
1202524524 Y:25738865-25738887 TTGGCCTCTTTGAGAAATAAAGG - Intergenic