ID: 960584484

View in Genome Browser
Species Human (GRCh38)
Location 3:119308471-119308493
Sequence CTTTGAAGACAGATGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 433
Summary {0: 1, 1: 0, 2: 1, 3: 40, 4: 391}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960584484 Original CRISPR CTTTGAAGACAGATGGAGGA AGG (reversed) Intronic
900084076 1:878840-878862 CTCTGGAATCAGATGGAGGAAGG - Intergenic
900394232 1:2446567-2446589 CATTGGAGGCAGAGGGAGGAAGG + Intronic
900584152 1:3424492-3424514 CGTGGAGGCCAGATGGAGGAAGG + Intronic
901148422 1:7084274-7084296 TCTTGAAGACAGATGGAGGACGG + Intronic
901455110 1:9358655-9358677 CTTTGCAGACAGACAGATGAGGG + Intronic
901713735 1:11136378-11136400 CTGTGAAGACAGATGTCTGAGGG - Intronic
901836393 1:11926452-11926474 CTTTTACGACAGATGGAAAACGG + Intergenic
902753039 1:18530743-18530765 CTTTGAACACAGATGGGCAATGG + Intergenic
902975343 1:20084420-20084442 CTTTGATGAAAGATGTAAGACGG - Intronic
905294856 1:36947677-36947699 CTTTGAAGAAAAATAAAGGAGGG - Intronic
906001008 1:42424923-42424945 ATTTGAAGAGAGATGAAGGGTGG - Intergenic
906068456 1:42999653-42999675 CTTTGAAGACACAGGTAGTAGGG - Intergenic
906803528 1:48758275-48758297 CTTTGAGGACAGAAGATGGAAGG - Intronic
907115882 1:51968063-51968085 CTTTGAAGATGGATGGAAGAAGG + Intronic
907309421 1:53530760-53530782 CTTTGAAGGCTGAGGGAGGTTGG - Intronic
907629527 1:56066362-56066384 TTTTGAAGCAGGATGGAGGATGG + Intergenic
908778885 1:67670104-67670126 CTTTCAAATCAGATGGATGAAGG + Intergenic
909042136 1:70667270-70667292 CTTTGAAGACAGATAGATCTGGG + Intergenic
909344755 1:74572173-74572195 CTCTGAGGAAAGAAGGAGGAGGG - Exonic
909619944 1:77656391-77656413 TTCTTAAGACAGATGGAGCATGG - Intronic
909877008 1:80819125-80819147 CATTGAGGAGAGAGGGAGGAAGG - Intergenic
910465273 1:87492596-87492618 CATGGAAGCCAGAAGGAGGATGG + Intergenic
912203649 1:107486225-107486247 CTATTCAGACAGATGTAGGAGGG - Intergenic
912245327 1:107956142-107956164 CTATGAGCACAGATGCAGGAAGG + Intronic
912314459 1:108654402-108654424 CTCTAAAGGGAGATGGAGGAGGG + Intronic
912960185 1:114189209-114189231 CTTTGCTGACAGGTGGAGGGAGG + Intergenic
913360435 1:117974933-117974955 GTTTGCATAGAGATGGAGGATGG - Intronic
913369728 1:118084558-118084580 CTTTGAAGACAGTGGGAAGAGGG - Intronic
914360099 1:146927668-146927690 CATGGAAGCCAGAAGGAGGATGG + Intergenic
914493648 1:148172228-148172250 CATGGAAGCCAGAAGGAGGATGG - Intergenic
915054227 1:153111029-153111051 CTTTGCAGGGAGATGGATGAAGG + Intergenic
915357827 1:155266896-155266918 CTGAGAAGAGAGATGGGGGAAGG + Intronic
916055865 1:161068736-161068758 CTTTGAAGCCAGAAGGACCAGGG - Intronic
916523816 1:165590494-165590516 ATTTGATGACAGATGGATGTGGG - Intergenic
916626651 1:166565335-166565357 CTATGGAGAAAGATGGAGCAGGG - Intergenic
917533325 1:175856188-175856210 CTTTGGAGGCAGGTGGAGGCAGG + Intergenic
918120518 1:181535292-181535314 TTTTAAAGACAAATGGGGGAGGG - Intronic
918146499 1:181760759-181760781 CTTTGAAGTCAGATAGAACAGGG - Intronic
918279014 1:182984546-182984568 CTTTGAACCCAGAAGGTGGATGG + Intergenic
918453849 1:184687050-184687072 TTTTGAAGACAGTTGTATGAAGG - Intergenic
918778178 1:188665352-188665374 ATTAGTAGACAGGTGGAGGAAGG - Intergenic
919186920 1:194162881-194162903 ATTTGAAGACGGGTAGAGGATGG + Intergenic
920742889 1:208598150-208598172 CTGGGAAAAGAGATGGAGGAGGG + Intergenic
920957101 1:210629712-210629734 CTTTGAAAACAGAGGAAGGAAGG - Intronic
921009113 1:211123561-211123583 TGATGAAGACAGATGGAAGACGG + Intronic
921430383 1:215058568-215058590 CTTTGAAGAAAGATTGAAGGAGG - Intronic
922184668 1:223263613-223263635 CTTTGGAGAAGGATGGGGGAAGG - Intronic
922671635 1:227512512-227512534 CTCTGGAACCAGATGGAGGAAGG - Intergenic
922752625 1:228077744-228077766 CTTTGAAGAGACATGGCTGAAGG - Intergenic
923747753 1:236718471-236718493 TTATGAAGACAGATGGATCAGGG - Intronic
924244075 1:242064459-242064481 CTCTGGAACCAGATGGAGGAAGG - Intergenic
1062763170 10:43096-43118 CTCTGGAATCAGATGGAGGAAGG + Intergenic
1062789925 10:296731-296753 CTTTGTAGGAACATGGAGGAAGG + Intronic
1062949042 10:1482807-1482829 CCTAGAACACAGATGGAAGAAGG - Intronic
1063078998 10:2747078-2747100 CTGTGAAGAGTGATGTAGGATGG - Intergenic
1063841381 10:10075876-10075898 CTTTAAAGGCAGATGAAGGTGGG - Intergenic
1064596743 10:16953159-16953181 CTTTGGAGAGAGATGGGGTAAGG + Intronic
1067331600 10:45327030-45327052 CTTTGCAGAGACATGGATGAAGG - Intergenic
1068425700 10:56860770-56860792 CATGGAAGACAGATGTAGGCTGG + Intergenic
1068534484 10:58226249-58226271 CTTTGAGGACAGAAAGAGAAGGG - Intronic
1068547835 10:58371145-58371167 CTTTTGAGATAGTTGGAGGATGG - Intergenic
1068858885 10:61826509-61826531 CTCTGGAGACAGATGGAGACTGG + Intergenic
1068878214 10:62020362-62020384 TTTTAAACACAGATGGGGGAGGG - Intronic
1070724864 10:78780923-78780945 CTTTGAAGTCAGATGGGTGTAGG + Intergenic
1070825149 10:79386457-79386479 CTCTGCAGAGAGAAGGAGGAAGG + Exonic
1071730169 10:88240084-88240106 CTTTGAAAACAGAGCGAAGAAGG - Intergenic
1074086603 10:110212596-110212618 CTTTGCAGTCACATGGAGCAGGG + Intronic
1075261502 10:120967272-120967294 CTTGGAAGACAGAGACAGGAGGG - Intergenic
1076025270 10:127107063-127107085 CTTTGAAGGCAGAGGCGGGAGGG - Intronic
1076377100 10:129997976-129997998 TTTTGTAGACAGATAGAGAAAGG - Intergenic
1076601971 10:131663162-131663184 ATTAGAAGACAGAGAGAGGAAGG - Intergenic
1076676733 10:132150988-132151010 GATAGAGGACAGATGGAGGATGG - Intronic
1076814840 10:132909610-132909632 CTGGAAAGCCAGATGGAGGAGGG - Intronic
1078110828 11:8390435-8390457 CTGTGAAAGCAAATGGAGGAAGG + Intergenic
1078397778 11:10996813-10996835 CTTTGAGGACAGAAGTTGGAAGG - Intergenic
1079160153 11:17984751-17984773 CTTTGAAGTCAGATAGACCAAGG - Intronic
1079321781 11:19457469-19457491 CTGGGAAGAGGGATGGAGGAGGG + Intronic
1079370967 11:19851892-19851914 CTTATAAGACAGAGGCAGGAAGG + Intronic
1080615629 11:33942524-33942546 CTTGGAAGACTGAGGCAGGAAGG + Intergenic
1080698564 11:34624346-34624368 ATCTGAAGACAGAGGCAGGAGGG + Intronic
1081295773 11:41387253-41387275 CTCTGAGGACAAATGGAGGCAGG + Intronic
1081698490 11:45136480-45136502 GGTGGAAGACAGCTGGAGGAAGG + Intronic
1082312438 11:50668796-50668818 CTGTGAAGACATATTAAGGAGGG - Intergenic
1085408637 11:76278678-76278700 CCTTGAGCACTGATGGAGGATGG + Intergenic
1086531546 11:87792169-87792191 CTTTGCAGAGACATGGATGAAGG - Intergenic
1086861332 11:91927887-91927909 GTTTGAAGAAAGATGGCGGGGGG + Intergenic
1087561874 11:99800831-99800853 TTTTGAAGACAGCTGGCAGATGG + Intronic
1087600418 11:100307612-100307634 CTTTTAAGACAGGTGCAGGTGGG - Intronic
1088428984 11:109736598-109736620 CTGTGAAGAGAGATGAAGAATGG + Intergenic
1089209726 11:116791869-116791891 CTGAGAAGACAGGTGGAGGGAGG + Exonic
1089691550 11:120189872-120189894 CCTTGAATACAGGTTGAGGAAGG + Intergenic
1090465230 11:126927672-126927694 GGTGGAAGACAGAGGGAGGAGGG - Intronic
1091768610 12:3137582-3137604 CTTTCCAGCCAGATGGAGGAGGG + Intronic
1092377542 12:7968307-7968329 CTCTGAAGGCAGAGGCAGGAAGG + Intergenic
1094813058 12:34160867-34160889 CTCTGAAATCAGATGGAGGAAGG + Intergenic
1096004393 12:48157310-48157332 CTTAGAAGGCAGATCGAAGAGGG - Intronic
1097379333 12:58876389-58876411 TTTTGAAGTCATATGGTGGAAGG - Intronic
1097861715 12:64524406-64524428 CTTGGAGGACAGAGGGAAGAGGG - Intergenic
1098170853 12:67745426-67745448 CTGTGAAGGAAGATGAAGGAAGG - Intergenic
1098570215 12:71980025-71980047 CTGTGAAGACAAATAGAGCATGG + Intronic
1099473219 12:83075761-83075783 GTTTGAAGACAGATGTGGGCAGG - Intronic
1100066040 12:90646465-90646487 CTTTGAAGAGACATGGATGGAGG + Intergenic
1100116136 12:91306615-91306637 TATTTAAGACATATGGAGGAAGG + Intergenic
1102159940 12:110760415-110760437 CTGTGAAGACAGGTGGAAGACGG + Intergenic
1102193468 12:111007020-111007042 CTCTGGAGACAGATGGAGAGAGG + Intergenic
1103024550 12:117562996-117563018 CTCTGGAGACAGAGGGAAGAGGG + Intronic
1105561502 13:21496724-21496746 TTTTGAAGTCAGATGGACCAAGG - Intronic
1106355833 13:28982169-28982191 CAGTGAAGACAGATGGAAAAAGG + Intronic
1106477947 13:30114412-30114434 CTTTGAAGATAAAGGGAGGGCGG - Intergenic
1107223705 13:38019774-38019796 TTTTGAAAACATATGGAGGATGG - Intergenic
1107246637 13:38304789-38304811 CCTTGAAGACAGAGGTTGGATGG - Intergenic
1108264580 13:48693648-48693670 CTCTGAAAAGAGAGGGAGGAAGG + Intronic
1108348613 13:49569969-49569991 CTTACAAAACAGATGGAGAAAGG + Intronic
1108362936 13:49684063-49684085 CTTTAAAGACAGAAGGCAGACGG + Intronic
1109617300 13:64852113-64852135 CTTTGAAGACATTTAGTGGAAGG + Intergenic
1111319649 13:86610180-86610202 CTTTATAGACAGATAGATGATGG - Intergenic
1111406410 13:87812478-87812500 TTTGGAAGAAAGATGGAGTATGG + Intergenic
1111519820 13:89385921-89385943 CCTTGAAGAGATTTGGAGGATGG - Intergenic
1111728117 13:92038943-92038965 CTTTGAAGTCAAATGAAGAAAGG + Intronic
1111764234 13:92507209-92507231 CTGTGAAGACAAACGGTGGATGG - Intronic
1113806518 13:113113214-113113236 CTTTCCAGACAAATTGAGGATGG + Intronic
1114359139 14:21950526-21950548 CAATCAAGCCAGATGGAGGAGGG + Intergenic
1114504175 14:23196331-23196353 CTTGGAAGCCAGCTGGAGGTTGG - Intronic
1114577271 14:23726317-23726339 ATTTGAAGTCAGAAAGAGGAGGG - Intergenic
1116799220 14:49425802-49425824 CATTATAGAAAGATGGAGGAAGG - Intergenic
1119772359 14:77228190-77228212 CTTACAAGAAAGATGGAGAAAGG + Intronic
1120227122 14:81803348-81803370 ATTTGTAGACAGATGGAAGCTGG - Intergenic
1121138392 14:91519354-91519376 TATTGAAGACAGATTGAAGAAGG + Intergenic
1121241696 14:92435195-92435217 CCTTGATGACAAATGGTGGAAGG + Intronic
1121729165 14:96174334-96174356 GGTTGTAGACAGAGGGAGGAAGG + Intergenic
1122372097 14:101234483-101234505 TTTGTAAGACAGAGGGAGGATGG + Intergenic
1122454521 14:101839654-101839676 TTATGATTACAGATGGAGGATGG - Intronic
1123478626 15:20611416-20611438 CTCTGGAGACTGATGGAGGATGG - Intergenic
1123639387 15:22388969-22388991 CTCTGGAGACTGATGGAGGATGG + Intergenic
1125438854 15:39679180-39679202 CTTTTAAGAAAGATGGAGAATGG + Intronic
1126577338 15:50210040-50210062 CTTTGAATACAGCTGAAGGTGGG + Intronic
1126665227 15:51069858-51069880 TTTCGAAGGCAGATGCAGGAAGG - Intronic
1127385330 15:58462207-58462229 CTTTGAAGGCAGAGAGAGGCTGG + Intronic
1128368018 15:67018433-67018455 CTGGGAACACAGATGGAAGAAGG - Intergenic
1129234479 15:74215698-74215720 CTTTGTAGAAAGTTGGAGGGAGG + Intergenic
1130330020 15:82914886-82914908 TTTAGAGGACAGATGGAGGTGGG + Intronic
1130941302 15:88511561-88511583 CAGTGGAGACAGATGAAGGAAGG - Intronic
1131233077 15:90673627-90673649 CTCTGAAGAAAGAGGGAGGGAGG - Intergenic
1131381887 15:91971032-91971054 CTTTGAAGACATGTGCAGGGTGG + Intronic
1131498253 15:92934067-92934089 CTTAGAAGACATCTGGAAGAGGG - Intronic
1131668289 15:94593156-94593178 CCTTGAATCCAGATGGATGATGG + Intergenic
1131844182 15:96471329-96471351 CTTTGAAGACAGATTAAAAACGG - Intergenic
1132915827 16:2342748-2342770 CTGTGAAGACTGATGGGGAAAGG - Intergenic
1133597455 16:7306447-7306469 ATATGAAGATAGATGGAGGGTGG + Intronic
1133761166 16:8799305-8799327 CTGGGAAGAAAGATGGAGGAAGG - Intronic
1133824288 16:9263156-9263178 CTTTGGAGGCAGACGCAGGAGGG - Intergenic
1134068475 16:11245685-11245707 CATTGAAGCCAGATGGCGGGGGG + Intergenic
1134888801 16:17819943-17819965 CTTTAAAGAAAGTTGTAGGATGG - Intergenic
1136108451 16:28048915-28048937 TTTTTAAAAAAGATGGAGGAGGG + Intronic
1136398005 16:30003509-30003531 CTGTGAAGACAGAAGCAGGTTGG + Intronic
1136412622 16:30086049-30086071 CTTTGAAGCCAGAGGGGGGTGGG + Exonic
1137495374 16:48965313-48965335 CTGTGTAGACAGATGAAGGAGGG + Intergenic
1137687866 16:50399417-50399439 CTGTAATGACAGATGGTGGAGGG + Intergenic
1137955666 16:52826401-52826423 CTTTGAAAATGGATGTAGGAAGG - Intergenic
1138211375 16:55166057-55166079 CTATGCAGACAGCTGGGGGAAGG - Intergenic
1138620045 16:58203759-58203781 CTTTGAAGACGGAAGGGGGGTGG + Intergenic
1138812794 16:60170772-60170794 CTTTCAAGACAGAAGGAATACGG + Intergenic
1139113112 16:63916714-63916736 CTTTGAAAACTGATTGAAGAAGG - Intergenic
1139236578 16:65345825-65345847 CCTTGAAGACAGAAGAAGCATGG - Intergenic
1141089456 16:81120289-81120311 CTGTGGAGGCAGTTGGAGGAGGG + Intergenic
1142066370 16:88065296-88065318 CTTTGAAGACGGATGGGGCCAGG - Exonic
1142312974 16:89324641-89324663 CATGGAAGAAAGATGGAGGCTGG - Intronic
1144702323 17:17347751-17347773 CATTGAAGACAGGCGGAGGAAGG + Intergenic
1147343688 17:39772185-39772207 AGTTGAAGACAGATTGTGGAGGG + Intronic
1147615671 17:41825814-41825836 CTTTGGAGACAGACGAGGGATGG + Intronic
1147652808 17:42071892-42071914 CCTGGAAGCCAGAAGGAGGAGGG + Intergenic
1148570342 17:48663204-48663226 CCTTTAAGAGAGATGGAGTAAGG + Intergenic
1148747691 17:49927654-49927676 CTTTGAAGTGGGTTGGAGGAGGG - Intergenic
1149046504 17:52252248-52252270 CTTTGAAGATAGATGGACCTGGG + Intergenic
1149144083 17:53468838-53468860 ATTTTAAGACAGAGGCAGGAGGG + Intergenic
1151229829 17:72676359-72676381 TTTTGAAGGCAGATGGAGAGAGG + Intronic
1151485007 17:74393553-74393575 CTTTGACAGCAGATGGATGATGG - Intergenic
1152867678 17:82734190-82734212 CTTTGGAGACCGATGGAAGGAGG + Intergenic
1152956079 18:43427-43449 CTCTGGAATCAGATGGAGGAAGG + Intergenic
1153545983 18:6205222-6205244 CTTTGAATATGGATGGAGAAAGG + Intronic
1153630187 18:7061962-7061984 CCTTGAGGACAGGTGGGGGAGGG + Intronic
1154055837 18:11013303-11013325 CTTTGAAGACAGAAGGGGCCAGG + Intronic
1154966931 18:21367826-21367848 CTTTGAAGGGAAATGGAGAAGGG + Intronic
1155746104 18:29357944-29357966 GTTGGGAGACAGAAGGAGGATGG + Intergenic
1155991243 18:32281676-32281698 TCTTAAAGACAGATGGAGGCCGG + Intronic
1156272013 18:35544320-35544342 CTTTATAGAAAGATAGAGGAGGG + Intergenic
1158201411 18:54945897-54945919 CTTGGAAGCCAGAGAGAGGATGG + Intronic
1158665970 18:59433109-59433131 TTTTGCAGAGAGAAGGAGGAAGG + Exonic
1158872982 18:61706852-61706874 CTCTGAAGACTGAAGGTGGAAGG - Intergenic
1160318339 18:77868296-77868318 CCTTGAAGACAGAGTGAGAATGG + Intergenic
1161002555 19:1918104-1918126 CTGCGAAGAGAGAGGGAGGACGG - Intronic
1161576697 19:5058401-5058423 CTCTGAGGACTGAGGGAGGAGGG + Intronic
1162810997 19:13164251-13164273 ATCTGAAATCAGATGGAGGAGGG + Intergenic
1162813828 19:13181247-13181269 CTTTGAACGCACATGCAGGACGG - Intergenic
1162897973 19:13776712-13776734 CTTTGAAGAGAGTTGGAAGAAGG - Intronic
1164776104 19:30854925-30854947 CTTTGTAGACAGATGCGGGGTGG - Intergenic
1164886357 19:31782038-31782060 CTCTGGAGGCTGATGGAGGAGGG - Intergenic
1165412877 19:35673209-35673231 CTGGGGAGACAGAGGGAGGACGG - Intronic
1165743394 19:38216784-38216806 CTTGGTAGACAGCTTGAGGAAGG + Intronic
1165869396 19:38960357-38960379 CTTTGCCGTCAGATGGTGGATGG + Intronic
1166523236 19:43495206-43495228 CTTTCAAGTCTGAGGGAGGAGGG + Intronic
1167674909 19:50877935-50877957 CACTGAGGCCAGATGGAGGATGG - Intronic
1168296528 19:55379728-55379750 CAGTGAAGACAGAAGGAGGCCGG + Intronic
926964721 2:18397246-18397268 CTATGGAGAAAAATGGAGGAAGG - Intergenic
927705851 2:25296210-25296232 CTTTGGAGACAGTTGGAGAAGGG + Intronic
927962772 2:27250919-27250941 CCTTGATGATAGATGGAGGAGGG - Intergenic
928260373 2:29761279-29761301 CTTTGAAGGCAGATAGATGTGGG + Intronic
928910049 2:36410878-36410900 CCTTGAAGCCACATTGAGGAGGG + Intronic
931170621 2:59799877-59799899 CTGTGGAGATAGATGGAGGACGG + Intergenic
931655053 2:64503144-64503166 CTTGGAAGAAAGAATGAGGAAGG + Intergenic
933295930 2:80491373-80491395 CTTTGAAGACAGATAGACAACGG + Intronic
933301518 2:80546085-80546107 CTTACAAGGCAGCTGGAGGAGGG + Intronic
934881622 2:97986538-97986560 TTTTGAAGAGAGATGTAGGAAGG - Intronic
934933425 2:98446376-98446398 CTTTGAAGAAAGATGAATGATGG + Intronic
935335528 2:102012302-102012324 CTCTGAAGCCAGCTGGTGGAAGG - Intronic
935503244 2:103868153-103868175 TTTGGAAGATGGATGGAGGAAGG + Intergenic
935920642 2:108009610-108009632 CTTTGCAGAGACATGGATGAAGG - Intronic
939219167 2:139280216-139280238 CTGTGAAGACAGGGAGAGGATGG + Intergenic
939879576 2:147614620-147614642 TTTGGAAGACGGGTGGAGGAAGG + Intergenic
942003202 2:171671400-171671422 CTTTGAAGATAGAAGGAACACGG + Intergenic
942241897 2:173970550-173970572 GTTTGAAGACAAATGGACAAAGG - Intergenic
942309826 2:174645713-174645735 CTTTGAAGACAGCTGGTCAAAGG - Intronic
943398050 2:187366829-187366851 CTTTCAAGACAAATTGAGGTGGG - Intronic
944613435 2:201434841-201434863 ATTTGAAAACAAATGGATGATGG - Intronic
945136835 2:206638666-206638688 CCTTGAAAACAGAGGGAGAAAGG - Intergenic
945323481 2:208454992-208455014 CTTTGAAGCAAGTAGGAGGAAGG - Intronic
946086563 2:217179351-217179373 CTTTGAAGATGGAAGGAAGATGG + Intergenic
946088989 2:217203810-217203832 GATTGAGGAAAGATGGAGGATGG + Intergenic
946989593 2:225313246-225313268 CCTTGAAGACAGGTGGAGAATGG + Intergenic
947481759 2:230507137-230507159 CTCAGAAGACAGAAGCAGGAGGG + Intronic
947802277 2:232937336-232937358 CATTTAGGACAGATGGAGGGAGG - Intronic
948616911 2:239204963-239204985 CTTTGATGACAGGTGGGGTAGGG - Intronic
1169241586 20:3985957-3985979 CCTTGAAGACAGTTTGAGGCTGG + Intronic
1169591322 20:7146315-7146337 CTTAGAAGACAGTTAAAGGACGG - Intergenic
1169648657 20:7842659-7842681 CTTAGAAGACAGAAGAAAGAGGG - Intergenic
1169744668 20:8931592-8931614 CTTTGAAGACAAAGGGAGTTAGG - Intronic
1170385562 20:15812380-15812402 CTTTGAATAAATATGGAGGACGG + Intronic
1170838929 20:19908105-19908127 CCCTGCAGACAGATGGAGCATGG - Intronic
1172885272 20:38226827-38226849 CTCTGAAAACAAAGGGAGGAGGG + Intronic
1173066564 20:39718685-39718707 CTTTGCAGGCACATGGAGAAGGG + Intergenic
1173136687 20:40444937-40444959 CCTAGAAGACATGTGGAGGAAGG - Intergenic
1173960946 20:47072082-47072104 CCTTGAAGCCACATGGAGGGAGG + Intronic
1175287350 20:57845753-57845775 CTTAGAAGAGAAAAGGAGGAGGG + Intergenic
1175839282 20:62016462-62016484 CTCTGGAGAAAGATGGAGGCCGG - Intronic
1177622614 21:23616219-23616241 CTATGTAGACAGACAGAGGATGG - Intergenic
1177952771 21:27559541-27559563 CTTAGAAAACTGATGTAGGAAGG + Intergenic
1177965566 21:27722392-27722414 CTTTGGAGAAAAATGGATGAAGG + Intergenic
1177989808 21:28023457-28023479 CTTTGAAGACAAAGGCAAGAAGG - Intergenic
1178692602 21:34761855-34761877 CCTAGAGGACTGATGGAGGAGGG - Intergenic
1179164853 21:38927358-38927380 CTTTGAAGATGGAGGAAGGAAGG - Intergenic
1179446992 21:41438923-41438945 CTTTGAAGCCAGCTGGACCATGG + Intronic
1179979195 21:44887675-44887697 CTTTGAGGACAGGTGAAGGAAGG - Intronic
1180581565 22:16844179-16844201 CTCTGTAGGCAGAGGGAGGAGGG + Intergenic
1182648738 22:31832982-31833004 CTGAGAAGAAAGCTGGAGGAAGG - Intronic
1183714313 22:39524756-39524778 CTTGGCAGACAGATGGAGAGAGG - Intergenic
1185169087 22:49281909-49281931 CTTTGTAGACACCTGGAGGGAGG + Intergenic
1185242505 22:49754250-49754272 CCTTGAAGACACATGGGGCAGGG + Intergenic
949363959 3:3260686-3260708 TTTTGAAGCCTGATGGAAGATGG - Intergenic
949939244 3:9141837-9141859 CTTTGAGGATAGATGGAGGCTGG + Intronic
950313999 3:11984392-11984414 GTGTGAAGACAGATGGAGGGAGG - Intergenic
950467136 3:13162244-13162266 CTTGGAAGACAGAGGGAGAAGGG + Intergenic
950658493 3:14452134-14452156 CTGTGAAAACAGAGGGAGGAAGG - Intronic
950665439 3:14492283-14492305 GGTTGGAGACAGATGGAGGTGGG + Exonic
953721539 3:45360130-45360152 CTTTGAAGAATGAGGTAGGAAGG + Intergenic
954073817 3:48162116-48162138 CTTTGGAGACAGATGTTTGAAGG + Intronic
954389815 3:50262811-50262833 GTTGGAAGACGGATGGAGAAAGG - Intergenic
954876696 3:53807073-53807095 CTGAGAACACAGGTGGAGGAGGG - Intronic
955173503 3:56588286-56588308 CTTTGAGGACTTATGGAGAAAGG + Intronic
955600053 3:60635499-60635521 CTATGAAGACAAATGGAGCCAGG - Intronic
956064355 3:65381251-65381273 ATCTGAAGGCAGTTGGAGGAAGG + Intronic
957190821 3:77007140-77007162 CTTTGATGCCAGTTGGAAGAAGG - Intronic
958714022 3:97756571-97756593 CTTTGAAGACATATCTAGCATGG - Intergenic
958962358 3:100522409-100522431 CTGTGAATTCAGAAGGAGGATGG - Intronic
959685156 3:109137316-109137338 CTTTAAAGGCAGATCAAGGAAGG + Intergenic
960584484 3:119308471-119308493 CTTTGAAGACAGATGGAGGAAGG - Intronic
961486983 3:127223503-127223525 CTGTGAAGACAGATGTGGGAGGG + Intergenic
962906607 3:139809137-139809159 CTTGGAAGACCGAGGGAGGAGGG + Intergenic
963501707 3:146135172-146135194 CTTTCAAGACAGTATGAGGATGG - Intronic
963523300 3:146383133-146383155 TTTTGAAGATAGATGCAAGAAGG - Intergenic
963704512 3:148669368-148669390 ATTTGAACACAGATGTAGGTAGG - Intergenic
963826336 3:149958358-149958380 CTTTGAAGATAGGGGGAAGAAGG - Intronic
964098170 3:152957817-152957839 CTGTGTAGACAGATGTATGAGGG - Intergenic
964497330 3:157305404-157305426 TTTTTAAGACAGATAGAGGCCGG - Intronic
965448746 3:168809947-168809969 CTGTGAAGACAGAAAGGGGAAGG - Intergenic
967323250 3:188214609-188214631 CTTTGAAGCAAGTGGGAGGAGGG + Intronic
968351006 3:198051868-198051890 CTTTGAAGACAGGAAGATGAGGG - Intergenic
969031398 4:4217892-4217914 CTTTGTGGAAAGCTGGAGGAGGG + Intronic
969282721 4:6181938-6181960 CTGTGCAGACAGGAGGAGGAGGG + Intronic
969905757 4:10394241-10394263 CCTTGAAGACAGAAGTTGGATGG + Intergenic
970482566 4:16492115-16492137 CTCTGAACACAGATGCATGAAGG + Intergenic
971112768 4:23607648-23607670 CTATGAAGATAGATAAAGGAGGG + Intergenic
971537892 4:27777401-27777423 CTCTGAAGGCTGAGGGAGGAGGG + Intergenic
972044246 4:34643541-34643563 ATTTGAAGCAAGATTGAGGAAGG + Intergenic
973367223 4:49217596-49217618 CTTTGAAGACAGGGAGATGAGGG - Intergenic
974218944 4:58940404-58940426 TTTTGAAGCCAGAGGGAGTATGG + Intergenic
977077951 4:92482321-92482343 CTTAGAGGGCAGAGGGAGGAAGG + Intronic
978281716 4:107024691-107024713 CTTTGCAAAGAGATGGAGAAAGG + Intronic
978464048 4:108988612-108988634 CTTTGAAGTCACAGGGAGGAGGG - Intronic
978806619 4:112807463-112807485 CTTTGAGGAGAGCTGGAGAATGG + Intergenic
979474020 4:121133811-121133833 ATTTGGACACAGATGGAAGATGG + Intronic
980819495 4:137994915-137994937 CTTTGAAGTTAGATGCAAGATGG + Intergenic
980884009 4:138742528-138742550 CTTTGGAGACAGATAGTGGTAGG + Intergenic
982150432 4:152449349-152449371 CTTTGAGGACTGATGGAAGAGGG + Intronic
984278933 4:177643830-177643852 AGTTGAAGACAGATGGTGAATGG - Intergenic
985229107 4:187796045-187796067 ATTTGAAGGGAGAGGGAGGAAGG - Intergenic
985440186 4:189978252-189978274 CTCTGGAATCAGATGGAGGAAGG + Intergenic
986504542 5:8435410-8435432 CTTTGAGGACTCAGGGAGGAAGG + Intergenic
987306251 5:16640572-16640594 TTTTGAAGACAAATGTAGGGAGG + Intergenic
987345214 5:16972831-16972853 GCTTGAAGCCACATGGAGGATGG - Intergenic
987466834 5:18282061-18282083 CTCTCCAGACAGAAGGAGGAGGG - Intergenic
987911064 5:24146193-24146215 CTTTGAAGATGGATGGTGTAGGG - Intronic
989148441 5:38272362-38272384 TTTTAAAGACAAATGGGGGAAGG - Intronic
989243284 5:39224344-39224366 CTGTGAAAACAGATGGGGGAGGG + Intronic
989266970 5:39486304-39486326 CTTTGAAGGCAGAGGGAGCTAGG - Intergenic
989332504 5:40276276-40276298 CTTTGGAGACACCTGGGGGAGGG + Intergenic
990195570 5:53311271-53311293 CTTTGGAGACAGATGGTCAAGGG - Intergenic
990837111 5:60034495-60034517 CTTTTAAGAGAGAGGCAGGAAGG - Intronic
991446377 5:66704433-66704455 CTTTCAACAGAGATGAAGGATGG - Intronic
993633862 5:90320353-90320375 CTTTGAGGGCAGAGGGTGGAAGG - Intergenic
993727425 5:91383777-91383799 GTGTGAAGAGAGATGGGGGAAGG + Intergenic
994560778 5:101368361-101368383 GTTTTCAGACAGATGGGGGAGGG - Intergenic
994617537 5:102124435-102124457 CTTTGGTGACTGATGGGGGAAGG + Intergenic
995254642 5:110032498-110032520 ATCTGGAGACAGATGGTGGAGGG + Intergenic
997354339 5:133252725-133252747 CTTTGGGGCCACATGGAGGAAGG - Intronic
999377782 5:151098786-151098808 CTCTGAGGACAAATGTAGGAAGG - Intergenic
999531751 5:152470671-152470693 CTTTGGTTAAAGATGGAGGAAGG + Intergenic
999805481 5:155077298-155077320 CTTTAGTGACAGATGGAGCATGG - Intergenic
1002195114 5:177497159-177497181 CTGTGGAGACAGATGGGGGCTGG + Intronic
1003879381 6:10466339-10466361 ATTTGAAGGCAGGAGGAGGAGGG + Intergenic
1004929383 6:20447127-20447149 CTCTGAACACAGAGGAAGGAGGG + Intronic
1005423882 6:25680880-25680902 ATTTGGAGACAGAGGAAGGATGG + Intronic
1005851442 6:29825992-29826014 CTCTGAAGACTGAGGTAGGAGGG + Intergenic
1006929425 6:37678738-37678760 CTCAGAAGACAGCTGAAGGAAGG - Intronic
1007973883 6:46080623-46080645 ATTTGGAGGCAGTTGGAGGAGGG - Intergenic
1009933117 6:70200214-70200236 CTTTGAATACAGCTTGTGGATGG + Intronic
1010034614 6:71310432-71310454 CTTTGAAGCCAGATGGACTTTGG + Intergenic
1010756763 6:79674053-79674075 CTTTGGAAACAGAAGTAGGAAGG + Intronic
1010991208 6:82482316-82482338 CTCTCAAGAGAGAAGGAGGAAGG - Intergenic
1011210830 6:84954722-84954744 CTTTGACGAGGGTTGGAGGAAGG + Intergenic
1011500464 6:87982610-87982632 CATTGAAGACACCTGGAGGCTGG + Intergenic
1012692829 6:102336399-102336421 CTTTGAAGATGGAAGGAAGAGGG - Intergenic
1012979725 6:105816733-105816755 CTTTGAAGGAAGAAGGAAGAGGG - Intergenic
1013299882 6:108794996-108795018 CTTTGGGGACAAAAGGAGGAAGG + Intergenic
1013674782 6:112446404-112446426 CTTTGAAGACAAAATGATGAGGG + Intergenic
1013813810 6:114073988-114074010 CTTTGCAGAGAGATGGATGAGGG + Intronic
1013877486 6:114850653-114850675 GTTAGAAGATAGATGGAGGCTGG - Intergenic
1014435647 6:121418166-121418188 CTTTGGAGACAGAGGCAGGTGGG + Intergenic
1014727264 6:124986461-124986483 GGCTGAAGACAGCTGGAGGAAGG - Intronic
1014732211 6:125046036-125046058 CTTTGAGGACACTTGAAGGAGGG + Intronic
1015604363 6:134939915-134939937 CTTTGCAGGCACATGGATGAAGG + Intronic
1016899901 6:149091077-149091099 CTATCAAGACAGATGGAGTAAGG + Intergenic
1017013341 6:150080008-150080030 CTTGGAGGGCAGATGGGGGAAGG - Intergenic
1018080940 6:160258905-160258927 CTTTGAAGTCAGCTGGACCAAGG - Exonic
1018381388 6:163261125-163261147 CCGGGAAGACAGAGGGAGGAGGG - Intronic
1019169297 6:170122843-170122865 CTTTGAAGATAAAGGGAGGAGGG + Intergenic
1019191366 6:170252960-170252982 CTTTGGAGACAGCCTGAGGAAGG - Intergenic
1019296459 7:278354-278376 TTTTGAAGACAGATGGATTCAGG + Intergenic
1019862189 7:3669588-3669610 GTTTAAAGACAGGTGGAGGAAGG - Intronic
1019952978 7:4388775-4388797 CTTTGAAGGGACATGGATGAAGG - Intergenic
1021682325 7:23146354-23146376 CTATGAAGACAGCTGGCAGATGG - Intronic
1022494735 7:30845734-30845756 CTGTGAAAGCAGATGGAGGATGG + Intronic
1022652766 7:32292734-32292756 CTTGGAACACAGCAGGAGGAGGG - Intronic
1024407168 7:48995102-48995124 CTTTGAAGCCAGAAGCAAGAGGG + Intergenic
1024483402 7:49888956-49888978 CTCAGCAGACATATGGAGGATGG + Intronic
1024522774 7:50321143-50321165 CTTGGAAGACTGATGGTAGAAGG + Intronic
1024524734 7:50338406-50338428 CTTTCAACACAGATGGAACAAGG - Intronic
1024649767 7:51393182-51393204 CTATGAAGACTGGTGTAGGAAGG - Intergenic
1024929128 7:54651588-54651610 CTTTAAAGACAGACGGAGAGAGG - Intergenic
1024993416 7:55253880-55253902 CTCGGAAGAAAGATGGAGGCGGG - Intronic
1026377359 7:69765393-69765415 CTTTGAGGTCAGATGGGGGCAGG + Intronic
1027490885 7:78824909-78824931 CTTTGAAGAGACACGGATGAAGG + Intronic
1027785385 7:82573661-82573683 CTTTGAAGTCAGGTGGATGCTGG + Intergenic
1028709848 7:93894290-93894312 CTATGACCACAGATGGAGAAAGG + Intronic
1031327591 7:120421495-120421517 TTTTGAAGACAGAATGAGAAAGG + Intronic
1031726162 7:125242179-125242201 CTTTTAAATCAGTTGGAGGAGGG + Intergenic
1031834756 7:126669010-126669032 CTTTGCAGAGACATGGATGAAGG + Intronic
1031835251 7:126673552-126673574 CTATAAAGACAGTGGGAGGATGG - Intronic
1033183569 7:139204192-139204214 CTTTGAAGACGGAGGAAGAAAGG + Intergenic
1033544446 7:142387268-142387290 CTCTGAGGATAGATGAAGGAAGG + Intergenic
1035705827 8:1673857-1673879 ATTTGGAGACAGAGGAAGGAAGG + Intronic
1035919702 8:3663552-3663574 CTTTGAATAGAGTTGGAGGCAGG - Intronic
1036298628 8:7555535-7555557 CTTGCAATTCAGATGGAGGAAGG + Intergenic
1036299933 8:7563185-7563207 CTTGCAATTCAGATGGAGGAAGG + Intergenic
1037604223 8:20423839-20423861 CATTGGAGACAGCTGAAGGAAGG + Intergenic
1037848465 8:22305904-22305926 CTTTGAAGAGAGAACGAAGAGGG - Intronic
1038410541 8:27355248-27355270 CTTTTAAGAGAGAGGCAGGAAGG + Intronic
1039594558 8:38779474-38779496 CTTTGAAGACACCCGGAGGGTGG - Intronic
1039831745 8:41220971-41220993 CTTTGAAGACAGGTGGTGAAGGG - Intergenic
1039854307 8:41399131-41399153 CCTGGAAGCCAGGTGGAGGAAGG - Intergenic
1041753977 8:61292533-61292555 CTTTGAAGACAGAAGGGTCAAGG + Intronic
1041775221 8:61515458-61515480 TTTAGAAGACGGAAGGAGGAAGG - Intronic
1042965542 8:74348007-74348029 CTCTGAAGCAGGATGGAGGATGG + Intronic
1043302237 8:78748000-78748022 CTTTGAAGAGAGAGGGATCATGG + Intronic
1043749634 8:83919736-83919758 CATTGAAGACTGTTGCAGGAGGG + Intergenic
1045755886 8:105541369-105541391 TTTTGAAGTCAGATGGAGATGGG - Intronic
1046031363 8:108787132-108787154 AATTGATGACAGATGGACGAGGG - Intronic
1046301143 8:112292537-112292559 CTTTGCACATAGGTGGAGGATGG + Exonic
1047649185 8:126901205-126901227 CTTTAAAAAAAGATGGAGGCTGG + Intergenic
1048466247 8:134666979-134667001 CTTTGAAGGGACATGGATGAAGG + Intronic
1048507698 8:135035595-135035617 GTTAGAAGACAAAAGGAGGAGGG - Intergenic
1048773242 8:137918483-137918505 CTTCGAAGACAGAGGCAGGAGGG + Intergenic
1050545604 9:6706293-6706315 CTTTGAATACAGTGGGAGGCAGG + Intergenic
1050585566 9:7108160-7108182 GTTAGAAGACACATGGAAGAGGG - Intergenic
1051309852 9:15758180-15758202 CCTTGAAAACAGCTGGAGGAAGG + Intronic
1052809810 9:33047511-33047533 CATAGGAGAAAGATGGAGGAGGG + Intronic
1053291519 9:36882544-36882566 CTTTGAAGGCAGGTGGTGGCAGG - Intronic
1055694425 9:78868390-78868412 CTTTGAGCACACCTGGAGGATGG - Intergenic
1056702914 9:88925683-88925705 TTTGGGACACAGATGGAGGAAGG - Intergenic
1056889650 9:90478908-90478930 CTTTGAAGAGAGTGGGAGGCAGG - Intergenic
1057329110 9:94095557-94095579 CTTTGGAGTCAGGTGGAAGAAGG + Intronic
1057788229 9:98104659-98104681 CTTTGAAGAGAGCTGGTGGCTGG + Intronic
1057999741 9:99852837-99852859 CTGGAAAGACAGATGGTGGAGGG - Intronic
1059094288 9:111395866-111395888 CTTTGAACACACATGAAGCAAGG - Intronic
1060830432 9:126710995-126711017 TTTTGGAGAGAGATGAAGGAAGG + Intergenic
1061084032 9:128389048-128389070 CTTTGTAGCCAGATGGAAAATGG - Intronic
1061251359 9:129428341-129428363 CCTTGCAGACTGATGGAGAAAGG + Intergenic
1062291941 9:135799409-135799431 CTTTGCAGGCTGGTGGAGGAAGG - Intergenic
1062322102 9:135995106-135995128 CTGTGGAGACAGACGGTGGAGGG - Intergenic
1186526078 X:10249519-10249541 CTTAGAAGAAAGAGGCAGGAGGG + Intergenic
1186987666 X:15034254-15034276 GTGTGAGGACAGATGGAGAATGG + Intergenic
1188218436 X:27509013-27509035 TTTTGAAGATAGATAGAGAATGG + Intergenic
1188363314 X:29283580-29283602 CTTCGCAGACAGATAGAGCATGG + Intronic
1189382916 X:40514464-40514486 CTTAGAAGAGAAAAGGAGGAAGG + Intergenic
1191771576 X:64766201-64766223 CTTTGAAGGCAGATGTAATAGGG + Intergenic
1193533709 X:82686994-82687016 CTTGGGAGACACATGGAGCAAGG - Intergenic
1195150696 X:102066712-102066734 CTTTGAATAGAAAGGGAGGAAGG - Intergenic
1195172986 X:102286756-102286778 CATTGAAAATGGATGGAGGAAGG - Intergenic
1195185880 X:102400339-102400361 CATTGAAAATGGATGGAGGAAGG + Intronic
1195850103 X:109273632-109273654 CTGTGATGAGAGATGGATGAGGG + Intergenic
1197521256 X:127499828-127499850 CTTTTAAGGCTAATGGAGGAAGG + Intergenic
1198206832 X:134473690-134473712 CATTGAAGGGAGATGGAAGAAGG + Intronic
1199353657 X:146834797-146834819 CACTGAAGAAAGATGTAGGATGG - Intergenic
1199887163 X:152031606-152031628 CTTTGAATACAGTGGGAGGCAGG + Intergenic