ID: 960585127

View in Genome Browser
Species Human (GRCh38)
Location 3:119314139-119314161
Sequence ACTTGGAGGCAAGAGCGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 413
Summary {0: 1, 1: 0, 2: 3, 3: 31, 4: 378}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960585127_960585131 5 Left 960585127 3:119314139-119314161 CCATGCCGCTCTTGCCTCCAAGT 0: 1
1: 0
2: 3
3: 31
4: 378
Right 960585131 3:119314167-119314189 TACACGTTCCTTCCTCTGTGTGG 0: 1
1: 0
2: 0
3: 10
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960585127 Original CRISPR ACTTGGAGGCAAGAGCGGCA TGG (reversed) Intronic
901682289 1:10920223-10920245 ACGTGGAGGAAAGACCGACAAGG + Intergenic
901941399 1:12665051-12665073 TGTGGGAGGCAAGAGGGGCAGGG - Intronic
903031172 1:20465363-20465385 GCTTGGTGGCCAGAGAGGCAAGG - Intergenic
904415653 1:30359741-30359763 ACTTGGAGCCAGGTGCTGCAGGG + Intergenic
905230408 1:36511655-36511677 ACTTGGGGGGAAGAGTGGGAGGG + Intergenic
905331322 1:37201133-37201155 ACTTGGGGGGAAGAGTGGGAGGG + Intergenic
905572642 1:39017897-39017919 ACCTGGAGGAAAGGGCGGGAGGG - Intergenic
906563222 1:46775909-46775931 ACTTGGGGGGAAGAGTGGGAGGG - Intronic
907250312 1:53133806-53133828 ACTTGGGGACAAGGGCGGGATGG - Intronic
907349692 1:53817476-53817498 ACTTGCAAGCAAGAGTGGGAGGG + Intronic
908500417 1:64738076-64738098 ACTTAGAGGCCAGAGAGGAAAGG - Intergenic
908784309 1:67720025-67720047 ACTTGTAGGAAGGAGCAGCAAGG - Intronic
909721114 1:78771016-78771038 ACTTGGGGGAAAGAGTGGGAGGG - Intergenic
910078145 1:83304857-83304879 ACTTGGGGGGAAGAGTGGGAGGG + Intergenic
910738484 1:90489187-90489209 ACTTGGAGGGAGGAGGGGTAGGG - Intergenic
911050854 1:93669928-93669950 ACTTGGAGGGAAGAGTGGGAGGG + Intronic
911473441 1:98346973-98346995 ATTTGGGGGCAAGAGCGCCTGGG + Intergenic
913152516 1:116058955-116058977 ACTTGGAGGGAAGCGGGGCAAGG + Intronic
913410247 1:118542902-118542924 ACTTGGAGGCAGCAGAGGAAGGG - Intergenic
916372137 1:164110036-164110058 ACATGGAGGCATGAGAGGGAGGG - Intergenic
917053704 1:170954961-170954983 ACTTGGAGGAAAGAGTGGGAGGG - Intronic
917173235 1:172201389-172201411 ACTTGGAGACAACAGAGGAAGGG + Intronic
917319489 1:173764718-173764740 ACTTGGGGGGAAGAGTGGAAGGG + Intronic
917637761 1:176953707-176953729 ATGTGGAGGGAAGGGCGGCAGGG + Intronic
917887440 1:179400413-179400435 ACTTGGGGGAAAGAGTGGGAGGG + Intronic
919548935 1:198960662-198960684 ACTTGGGGGGAAGAGTGGGAGGG - Intergenic
921192388 1:212722200-212722222 ACTGGGAGGCCAGAGCAGGAGGG + Intergenic
921422014 1:214959080-214959102 ACTTGGAGGGAAGGGCAGGAGGG - Intergenic
921835023 1:219769718-219769740 ACTTGGGGGAAAGAGTGGGAGGG + Intronic
922870103 1:228895730-228895752 ACTTGGGGGAAAGGGCGGGAGGG + Intergenic
923648731 1:235851394-235851416 ACTTGGGGGGAAGAGTGGGAGGG + Intronic
924471342 1:244345225-244345247 ACTTGGAGTCAAGATCTCCAAGG + Intergenic
1069725302 10:70573718-70573740 ACGTAGAGGCAAGAGGGGGAAGG - Intergenic
1070382577 10:75894177-75894199 ACTTGGGGGGAAGAGTGGGAGGG - Intronic
1070870643 10:79748593-79748615 ACTTGGCGGCAACAGAGGAAAGG - Intergenic
1071441528 10:85701818-85701840 ACTTGGGGGCAAGGGTGGGAAGG + Intronic
1071637563 10:87270805-87270827 ACTTGGCGGCAACAGAGGAAAGG - Intergenic
1071657682 10:87467146-87467168 ACTTGGCGGCAACAGAGGAAAGG + Intergenic
1071982777 10:91020514-91020536 ACATGAAGGCTAGAGCTGCAAGG + Intergenic
1072815444 10:98503851-98503873 ACTTGGTGGGAAGAGTGGGAGGG + Intronic
1072900952 10:99406289-99406311 ACTAGGAGGCATGAGTGGAAAGG + Intronic
1074472502 10:113740334-113740356 ACTTGGGGGGAAGAGTGGGAGGG + Intergenic
1074612033 10:115030998-115031020 GCTTGGAGGCAGGAAAGGCATGG - Intergenic
1074876376 10:117616666-117616688 ACTTAGGGGGAAGAGCGGGAGGG + Intergenic
1075645830 10:124095413-124095435 ACTTGGAGGGAGGAGAGGAAAGG - Intergenic
1075824191 10:125340168-125340190 ACTTGGAGGGAAGGGTGGGAGGG + Intergenic
1075976391 10:126699819-126699841 ACTTGGGGGGAAGAGTGGGAGGG + Intergenic
1076023389 10:127092513-127092535 ACTTGGATGACAGAGCAGCATGG - Intronic
1076908686 10:133376885-133376907 ACATGGACCCAAGAGCTGCAGGG - Intergenic
1077166713 11:1144841-1144863 ACTTGGGGGGAAGAGTGGGAGGG - Intergenic
1077191917 11:1259200-1259222 ACTTGGGGGCAAGTGCCTCAGGG - Intronic
1077755851 11:5026257-5026279 ACTTGGAGGCATCAGGGGCAAGG - Intergenic
1078186061 11:9053034-9053056 ACCTGGAGGCCAGAGAGGCCTGG + Intronic
1079824619 11:25175240-25175262 GCTAGGAAGCAAGAGAGGCAGGG - Intergenic
1080152547 11:29070880-29070902 ACTTGGGGGAAAGAGTGGGAGGG - Intergenic
1081710288 11:45211717-45211739 ACTTGGGGGGAAGAGTGGGAAGG - Intronic
1083017186 11:59466864-59466886 ACTTGGGGGGAAGAGTGGGAGGG + Intergenic
1084220986 11:67679016-67679038 ACTTGGAGGGAAGAGTGGGAAGG + Intronic
1085880881 11:80464643-80464665 ACTTGGAGGCAGAAGAGGGAAGG - Intergenic
1086978934 11:93172400-93172422 ACTTGGGGGGAAGAGTGGGAGGG - Intronic
1087071767 11:94088947-94088969 ACGTGGACGCAAGAGGGGAAAGG + Exonic
1087619657 11:100527166-100527188 ACTTGGGGGGAAGAGTGGGAGGG + Intergenic
1087974246 11:104524940-104524962 ACTTGGGGGGAAGAGTGGGAAGG - Intergenic
1088893397 11:114060967-114060989 ACTCCGCGGCGAGAGCGGCAGGG - Intronic
1089652321 11:119922365-119922387 ACTGGGAAGTAAGAGGGGCAAGG - Intergenic
1090132309 11:124157605-124157627 ACTTGGGGGAAAGAGTGGGAGGG + Intergenic
1091112457 11:132982585-132982607 ACTTGGAGGCAAGGGGAGCTGGG + Intronic
1091167775 11:133495054-133495076 ACTTGGGGGAAAGAGTGGCAGGG - Intronic
1092143798 12:6201076-6201098 ACTTTTACGCAGGAGCGGCAGGG + Intronic
1092436825 12:8454682-8454704 ACTTGGGGGGAAGAGTGGGAGGG + Intergenic
1092579398 12:9821632-9821654 ACTTGGAGGCAGCAGCAGAAGGG - Intergenic
1093118075 12:15235240-15235262 ACTTGGAGGGAAGGGTGGGAGGG - Intronic
1093172841 12:15878497-15878519 ACTTGGAGGGAGGAGTGGGAGGG + Intronic
1094219116 12:27974482-27974504 ACTTCGAGGCCAGCGTGGCACGG - Intergenic
1094810335 12:34130762-34130784 ACTTGGGGGGAAGAGTGGGAGGG + Intergenic
1097169141 12:57102790-57102812 AGTTGGAGGGAACAGGGGCAGGG - Intronic
1098836231 12:75427805-75427827 ACATGGTGGCAGGAGAGGCAGGG - Intronic
1099891132 12:88589609-88589631 ACTTGAAGACAAGAGTGGGAGGG + Intergenic
1101024833 12:100590923-100590945 ACTTGGGGGGAAGAGTGGGAGGG + Intronic
1101576036 12:105997278-105997300 ACTTGGGGGGAAGAGTGGGAGGG + Intergenic
1102641470 12:114370931-114370953 ACTTGGAAGGAAGGGCGGGAGGG - Intronic
1102795769 12:115687664-115687686 TCTTGGAGGCAACAGAGGCTGGG - Intergenic
1103195513 12:119040347-119040369 ACTTGGGGGGAAGAGTGGAAGGG - Intronic
1104420012 12:128627504-128627526 ACTAGGAGGCAAGAGACTCAAGG - Intronic
1107115712 13:36743245-36743267 ACATGGAGGCAAGATAGGTATGG - Intergenic
1107178425 13:37427162-37427184 ACTTGGAGGGAAGAGTGGGAGGG + Intergenic
1108789240 13:53946807-53946829 ACTTGGTTGCAAGAGAGGCTGGG + Intergenic
1110330056 13:74260981-74261003 ACTTGGAGGCAAGAGTGTGAGGG + Intergenic
1111165264 13:84449724-84449746 ACTTGGGGGGAAGAGTGGGAGGG - Intergenic
1111755032 13:92382208-92382230 ACTTGGGGGGAAGAGTGGGAGGG + Intronic
1112034952 13:95488514-95488536 ACTTGGGGGGAAGAGTGGGAGGG - Intronic
1113226987 13:108169571-108169593 ACTTGGAGGCAGCAGAGGAAGGG - Intergenic
1113958648 13:114113057-114113079 ACTTGGGGGCAGGAGCTGGAGGG + Intronic
1115970360 14:38938730-38938752 ACTTGGAGGGAAGGGTGGGAGGG + Intergenic
1116021578 14:39468605-39468627 AAGTGGAGGGAAGAGCGGGAAGG - Intergenic
1117290113 14:54324229-54324251 ACTTGGGGGGAAGAGTGGGAGGG + Intergenic
1118997392 14:70848940-70848962 ACTTGGAGGCAGAGGCTGCAGGG + Intergenic
1121795037 14:96727736-96727758 AATAGGAAGCAAGAGCAGCATGG + Intergenic
1122175051 14:99910998-99911020 ACCTAGAGCCAAGAGCAGCAGGG - Intronic
1123075184 14:105664493-105664515 ACTTCGAGGCCAGAGAGCCATGG + Intergenic
1124965974 15:34433998-34434020 GCCTGGAGGCAAGAGTGGCCTGG + Intronic
1124982594 15:34580097-34580119 GCCTGGAGGCAAGAGTGGCCTGG + Intronic
1126566411 15:50105092-50105114 ACTTGGGGGAAAGGGTGGCAGGG + Intronic
1126578056 15:50217088-50217110 ACTTGGGGGGAAGAGTGGGAGGG + Intronic
1126866989 15:52947625-52947647 ACTTGGGGGGAAGAGTGGGAGGG - Intergenic
1126996961 15:54454958-54454980 ACTTGGGGGCAAGGGTGGTAAGG - Intronic
1128415665 15:67443418-67443440 ACTTGGGGGAAAGAGTGGGAGGG + Intronic
1131544431 15:93304074-93304096 ACTTGGGGGGAAGAGTGGGAGGG + Intergenic
1133030425 16:3008314-3008336 TCTAGGAGGAAAGAGGGGCAGGG - Intergenic
1134451592 16:14367374-14367396 CCTTGGAGGCAAGGGGGTCAGGG - Intergenic
1134502961 16:14783512-14783534 ACTTGGGGGAAAGAGTGGAAGGG - Intronic
1134577603 16:15345384-15345406 ACTTGGGGGAAAGAGTGGAAGGG + Intergenic
1134662380 16:15993874-15993896 GCTTGGAGGCAAGATCTCCAGGG - Intronic
1135351427 16:21732484-21732506 ACTTGGATGGAAGAGTGGGAGGG - Intronic
1135449909 16:22548612-22548634 ACTTGGATGGAAGAGTGGGAGGG - Intergenic
1136396669 16:29996231-29996253 AAGTGGAGGCGGGAGCGGCACGG + Exonic
1136995333 16:35185009-35185031 ACTTGGGGGTAAGAGTGGGAGGG + Intergenic
1138514970 16:57530942-57530964 ACGTGGAAGCAAGTGAGGCAGGG - Intronic
1140607032 16:76551320-76551342 CCTGGGAGGCAAAAGCTGCAGGG + Intronic
1141079949 16:81041639-81041661 AAGTGGAGGGAAAAGCGGCACGG + Intronic
1143502582 17:7347822-7347844 ACTGGGAGGCAAGGCTGGCATGG - Intronic
1145142292 17:20455528-20455550 ACACGGAGGCGAGAGCGGAAAGG + Intronic
1146685165 17:34836595-34836617 ACTTGGGGGGAAGAGTGGGAGGG + Intergenic
1148083597 17:44980839-44980861 ACTGGGAGGCAAGGGCAGCCAGG - Intergenic
1148583868 17:48762781-48762803 ACTGGGAGGGAACAGAGGCAGGG + Exonic
1149201479 17:54190686-54190708 ACTTGTGGGGAAGAGCGGGAGGG - Intergenic
1149336467 17:55641123-55641145 AGGTGGAGGCAAGAGAGTCAGGG - Intergenic
1150137428 17:62703623-62703645 CCTTGGGGCCGAGAGCGGCAGGG + Intronic
1150569064 17:66369812-66369834 ACTTGGAGGTAGCAGTGGCAGGG - Intronic
1153869884 18:9308266-9308288 ACTTGGAGGGAAGTGTGGGAGGG + Intergenic
1157541365 18:48512712-48512734 ACTTGGAGGGAAGAGTGGGAGGG + Intergenic
1158206095 18:54994629-54994651 ACTTGGGGGGAAGAGTGGAAGGG - Intergenic
1158442819 18:57492383-57492405 ACTTGGGGGGAAGAGTGGGAGGG + Intergenic
1159220490 18:65457494-65457516 ACTTGGAGGAAAGGGTGGGAGGG + Intergenic
1159421705 18:68229751-68229773 AAGGGGAGGCAAGAGAGGCAGGG - Intergenic
1159442585 18:68500432-68500454 ACTTGGAGGACATAGCTGCATGG - Intergenic
1159596637 18:70388852-70388874 ACTTGGCGGGAAGAGTGGGAGGG - Intergenic
1159607046 18:70485557-70485579 ACTTGGAGGCAGCAGAGGAAGGG + Intergenic
1160863322 19:1246737-1246759 AGTTGGAGGGAGGAGGGGCAGGG - Intergenic
1160945006 19:1637527-1637549 ACATGGAAGCAAGAGCGGGATGG - Intronic
1164125174 19:22308014-22308036 ACTTGAGGGGAAGAGCGGGAGGG - Intronic
1166263990 19:41665588-41665610 ACTTGGAGGAAAGGGTGGGAAGG + Intronic
1166743464 19:45128584-45128606 ACTTCGAGACAAGAGATGCAGGG + Intronic
1167257439 19:48439605-48439627 ACTTGGTGGGAAGAAGGGCAGGG - Intronic
1167708521 19:51096328-51096350 ACTTGGGGGGAAGAGTGGGAGGG + Intergenic
1168362114 19:55750524-55750546 ACTTGGGGGGAAGAGAGGGAGGG - Intergenic
1168702858 19:58451928-58451950 ACTGGGAGGGAAGAAAGGCATGG - Intronic
925002796 2:419637-419659 ACTTGGAGGAAAGAGAAGCCTGG - Intergenic
925121148 2:1419475-1419497 ACTTTTAGGCAATAGAGGCAGGG - Intronic
925164312 2:1705969-1705991 ACATGGATGCCTGAGCGGCAGGG - Intronic
925756122 2:7133714-7133736 ACATGCAGGAAAGAGAGGCATGG - Intergenic
926944819 2:18175916-18175938 ACTTGGAGGGAAGAGTGAGAGGG + Intronic
927327904 2:21827594-21827616 ACTTGGGGGAAAGAGAGGGAGGG - Intergenic
929036828 2:37701368-37701390 AATTGGGGGGAAGAGTGGCAAGG - Intronic
929069219 2:38011925-38011947 ACTGGGAGTCAAGAGTGGCCTGG - Intronic
929300771 2:40301584-40301606 ACTTGGAGGGAAGGGTGGGAGGG + Intronic
929462623 2:42114552-42114574 GCTTGGAGGCAAGGTGGGCAAGG + Intergenic
929925424 2:46203144-46203166 AGTTAGAGGCAAGATGGGCAGGG - Intergenic
930446114 2:51474407-51474429 ACTTGGAGGGAAGGGTGGGAGGG + Intergenic
930939460 2:56997232-56997254 ACTTGGAGGCAGCAGAGGAAGGG + Intergenic
931524598 2:63138850-63138872 ACTTGGGGGGAAGAGTGGGAAGG - Intronic
931543445 2:63354344-63354366 ACTTGGAGGCAGCAGAGGAAGGG - Intronic
931548410 2:63414718-63414740 ACTTGGAGGAAGGAGTGGAAGGG + Intronic
933872068 2:86576310-86576332 CCTGGGAGGCAGGGGCGGCAGGG + Intronic
934916268 2:98303232-98303254 CCCTGGAGGCTAGAGTGGCATGG + Intronic
935483587 2:103624045-103624067 ACTGGGAGGAAACAGGGGCAGGG - Intergenic
937058369 2:118959949-118959971 ACTTGGAGGGAAGAGTGGGAGGG + Intronic
937094495 2:119226559-119226581 ACTTGGAGAGGAGAGGGGCAGGG + Intronic
938239612 2:129733231-129733253 ACATGTAGGAAAGAGGGGCAGGG - Intergenic
938308507 2:130269837-130269859 CCTTGGAGGTAAGAGGGGAAGGG - Intergenic
938446820 2:131386999-131387021 CCTTGGAGGTAAGAGAGGAAGGG + Intergenic
938765176 2:134456320-134456342 ACTTGGAACCAGGAGTGGCAGGG + Exonic
939554257 2:143655262-143655284 ACTTGGGGGGAAGAGTGGGAGGG - Intronic
940446977 2:153787067-153787089 ACTTGGAGGCAGCAGAGGAAGGG - Intergenic
940847985 2:158661717-158661739 AATTGGAGGAAATAGCAGCATGG - Intronic
940911030 2:159210225-159210247 GCTTGGAGAGAAGGGCGGCAGGG - Intronic
940963203 2:159808935-159808957 ACTTGGAGGCATGAGGGTCTGGG - Intronic
941627986 2:167850808-167850830 ACTTGGGGGGAAGAGTGGGAGGG + Intergenic
943752669 2:191525932-191525954 ACTTGGGGGCAAGGGTGGAAGGG + Intergenic
944493012 2:200277529-200277551 AGTTGGAGGCAAGGGCGGTGGGG - Intergenic
945762098 2:213926392-213926414 ACTTGGAGGAAAGGGTGGAATGG - Intronic
945992622 2:216408773-216408795 ATTTGGAGACAAGACCTGCAAGG + Intergenic
947089581 2:226495168-226495190 ACTTGGGGGCAAGAGCGGGAAGG + Intergenic
947456502 2:230259247-230259269 ACTTGGAGGGAAGAGTGGGAGGG - Intronic
948199093 2:236116747-236116769 ACTTGGGGGGAAGAGTGGGAGGG - Intronic
1169290583 20:4347531-4347553 ACTTGGGGGAAAGAGTGGGAGGG + Intergenic
1169715755 20:8615970-8615992 AGTTGTAGTCAAGAGAGGCAGGG - Intronic
1170003810 20:11644970-11644992 ACATGGTGGAAAGAGGGGCAAGG - Intergenic
1170245261 20:14214752-14214774 ACTTGGGGGAAAGAGTGGGATGG - Intronic
1171141107 20:22743534-22743556 ACTTGGAGACAAGATCAGAAGGG - Intergenic
1172193085 20:33074037-33074059 AGCTGGAGGCAAGGGGGGCAGGG - Intergenic
1172650258 20:36497476-36497498 GCTTGGCGGCAGGAGCAGCATGG + Intronic
1172776185 20:37408405-37408427 CCTGGGAGGCAACAGCAGCAGGG - Intergenic
1173716913 20:45216152-45216174 ACTTGGGGGGAAGAGTGGGAGGG + Intergenic
1174545550 20:51322496-51322518 ATTTGGAGGCTGAAGCGGCAAGG - Intergenic
1175929122 20:62485290-62485312 ACTTGGAGGCAGGCGCAGCCTGG - Intergenic
1177027935 21:15944716-15944738 ACTTGGGGGGAAGAGTGGGAGGG - Intergenic
1178906970 21:36644416-36644438 ACTTGGGGGGAAGAGTGGGAGGG - Intergenic
1182324141 22:29499094-29499116 ACTTGGAAGGAAGAGTGGGAGGG - Intergenic
1183041773 22:35185213-35185235 ACTTGGAGGCAGCAGAGGAAGGG - Intergenic
1184045517 22:41970244-41970266 ACTTGGAGTCCAGAGTAGCAGGG + Intergenic
1184419001 22:44368800-44368822 ACTTGCAGGGAAGAGCTCCAAGG - Intergenic
1185212220 22:49576798-49576820 ACTTGGAGGTCTGAGCGGGAAGG - Intronic
949727311 3:7064233-7064255 ACTTGGGGGGAAGAGTGGGAAGG - Intronic
950566963 3:13775164-13775186 CCTTGGTGGCAAGAGGAGCAAGG - Intergenic
951749802 3:26021978-26022000 ACTTGGTGGAAAGAGTGGGAGGG - Intergenic
953684818 3:45068473-45068495 ACTTGGAGGAAAGAGTGGAAAGG + Intergenic
954584391 3:51720940-51720962 TCGGGGAGGCAAGAGCAGCATGG - Intergenic
956896169 3:73662510-73662532 ACTTGGAGGCCAGAGCTCTATGG + Intergenic
957419123 3:79945602-79945624 ACTTGGAGGAAAGGACGGGAAGG + Intergenic
958002819 3:87772730-87772752 ACTTGGGGGGAAGAGAGGTAGGG - Intergenic
959131810 3:102365397-102365419 ACTTGGAGGAAAGAGTGGGAGGG - Intronic
959436662 3:106323435-106323457 ACTTGGGGGGAAGAGTGGGAGGG + Intergenic
959452221 3:106517785-106517807 ACTTGGAGGCAGCAGAGGAAGGG - Intergenic
959733471 3:109630647-109630669 ACTTGGAGGCAAGGGCAGGTGGG - Intergenic
959811447 3:110625033-110625055 TCTTGGAGGAGAGAGGGGCACGG - Intergenic
959998569 3:112705745-112705767 ACTTGCAGGGAAGGGTGGCAGGG + Intergenic
960342980 3:116497614-116497636 ACTTGGAGGCAACAGAGGAAGGG - Intronic
960585127 3:119314139-119314161 ACTTGGAGGCAAGAGCGGCATGG - Intronic
960633136 3:119753809-119753831 ACTTGGGGGGAAGAGTGGGAAGG - Intronic
961264137 3:125626848-125626870 ACTTGGAGGGAAGAACGGCAGGG - Intergenic
961380614 3:126494412-126494434 ACTCGGAGGCTGGAGCTGCAGGG - Intronic
962487099 3:135854415-135854437 ACTTGGGGGGAAGAGTGGGAGGG - Intergenic
963505492 3:146179804-146179826 ACTTGGGGGGAAGAGTGGGAGGG - Intergenic
964035600 3:152192697-152192719 ACCTGGAGGCAGAAGTGGCAGGG + Intergenic
964456552 3:156874685-156874707 ACTTGGGGGGAAGAGCAGGAGGG - Intronic
964600661 3:158497399-158497421 ACTTGGGGGGAAGAGTGGGAGGG - Intronic
965223311 3:165955214-165955236 ACTTGGGGGGAAGAGTGGGAGGG + Intergenic
965284784 3:166805109-166805131 AGCTGGAGGCAAGAGCTGCTTGG + Intergenic
965415906 3:168391818-168391840 ACTTGGGGGGAAGAGTGGGAGGG - Intergenic
965817733 3:172654106-172654128 AAATGGAGGCAAGAGGAGCATGG + Intronic
967917898 3:194592355-194592377 ACTTGGAGGCAAGGGTGGCATGG + Intronic
968435750 4:588101-588123 ACTTGGAAGACAGAACGGCAAGG + Intergenic
970216961 4:13769316-13769338 ACTTGGGGGGAAGAGTGGAAAGG - Intergenic
970906546 4:21223160-21223182 AGTGGGAGGCAAGTGGGGCAGGG + Intronic
971003893 4:22352277-22352299 ACTTGGAGGCAACAGAGGAAGGG - Intronic
971182622 4:24343891-24343913 ACTTGGGGGGAAGAGTGGGAGGG - Intergenic
974425516 4:61738076-61738098 ACTTGGAGGAAAGGGTGGGAGGG - Intronic
974472462 4:62336495-62336517 ACTTGGAGGGAAGGGTGGGAAGG + Intergenic
975106122 4:70571221-70571243 ACTTGGAGGCAGCAGAGGAAGGG + Intergenic
975517793 4:75266159-75266181 ACGTGGGGGGAAGAGTGGCAGGG + Intergenic
977305577 4:95319339-95319361 ACATGAAGGCAAGAGCCGCAAGG - Intronic
977747257 4:100564218-100564240 ACTCGGAGGAAAGAGTGGGAGGG + Intronic
978538052 4:109784026-109784048 ACTTGGAGGGAAGAGTGGGAGGG + Intronic
978683679 4:111414491-111414513 ACTTGGAGGCAGCAGAGGAAGGG + Intergenic
978726118 4:111971752-111971774 ACTTGGGGGGAAGAGTGGGAGGG - Intergenic
978952887 4:114582368-114582390 ACTTGGAGGCAGCAGAGGAAAGG + Intergenic
979045093 4:115852444-115852466 ACTTGGAGGCAGCAGAGGCAGGG - Intergenic
979079802 4:116321880-116321902 ACTTGGGGGTAAGAGTGGGAGGG + Intergenic
980086704 4:128398212-128398234 ACTTGGGGGGAAGAGTGGGAGGG - Intergenic
981347195 4:143689874-143689896 ACTTGGGGGGAAGAGTGGGAGGG + Intronic
981400384 4:144307270-144307292 ACTTGGGGGGAAGAGTGGAAGGG - Intergenic
981606357 4:146545509-146545531 ACTTGGAGGCAGCAGAGGAAGGG + Intergenic
981654516 4:147098272-147098294 ACTTGGGGGGAAGAGTGGGAGGG + Intergenic
981760250 4:148186762-148186784 ACTTGGGGGGAAGAGTGGGAGGG - Intronic
983175209 4:164580151-164580173 ACTTGGGGGGAAGAGTGGGAGGG - Intergenic
984139002 4:175978495-175978517 ATGTGGAGGCAAGAGGGGAAGGG - Intronic
984345688 4:178521850-178521872 ACTTGGGGGGAAGTGCGGGAGGG - Intergenic
985093406 4:186387450-186387472 ACTTGGGGGGAAGAGAGGGAGGG + Intergenic
986414993 5:7519445-7519467 GCTTGGAGTCAAGAGCCGCATGG + Intronic
986669729 5:10132258-10132280 ACTTGGGGGGAAGAGTGGGATGG + Intergenic
986702696 5:10427141-10427163 ACTTGGAGACCAGAGGGACATGG - Intronic
988424147 5:31043165-31043187 ACTTGGGGGGAAGAGTGGGAGGG + Intergenic
988902728 5:35751308-35751330 ACTTGGGGGGAAGAGTGGGAGGG + Intronic
989004485 5:36795323-36795345 ACTTGGGGGGAAGAGTGGAAGGG - Intergenic
989101076 5:37823684-37823706 AGTTGGAGACAAGAGAGGCCCGG + Intronic
990557812 5:56952386-56952408 AATTGGAGGCAAGTGGGGGACGG + Intronic
990775634 5:59302527-59302549 ACTTGGGGGGAAGAGTGGGAGGG - Intronic
991400554 5:66246669-66246691 GCTTTAAGGCAAGAGTGGCATGG + Intergenic
992630901 5:78679203-78679225 ACTTGCAGGCCAGAGGGGAAAGG + Intronic
993283033 5:85952223-85952245 ACTTGGAGGCAGCAGAGGAAGGG + Intergenic
993413598 5:87600486-87600508 ACTTAGAGGCAACAGAGGGAAGG + Intergenic
993553829 5:89310185-89310207 ACTTGGAGAGAAGAGTGGGAGGG - Intergenic
993965303 5:94352917-94352939 ACTTGGGGGGAAGAGTGGGAGGG + Intronic
994330221 5:98496246-98496268 ACTTGGGGGGAAGAGTGGGAGGG + Intergenic
994644355 5:102450645-102450667 GCTTGGAGGCACCAGGGGCAAGG + Intronic
995270910 5:110219250-110219272 ACTTGGAGGCAGCAGAGGAAGGG + Intergenic
995797716 5:115959560-115959582 ACTTGGGGGGAAGAGTGGGAGGG + Intergenic
996151853 5:120047621-120047643 ACTTGGGGGGAAGAGTGGGAGGG - Intergenic
996325903 5:122273060-122273082 ACTTGGAGGGAAGAGTGGGACGG + Intergenic
997057980 5:130467456-130467478 ACATGGAGCCAAGATCTGCAGGG - Intergenic
997761402 5:136451639-136451661 ACTTGGGGGGAAGAGTGGGAGGG + Intergenic
998289755 5:140902711-140902733 ACTTGGAGGGAAGGGTGGGAGGG - Intronic
998817124 5:146025962-146025984 CCTTGGAGGAAAGAGGGGGAAGG - Intronic
999052226 5:148534854-148534876 ACTTGGAGGCAGCAGAGGAAGGG - Intronic
999422897 5:151460108-151460130 GGTTGGAGGAAAGAGGGGCAGGG - Intronic
1000031739 5:157407451-157407473 ACTTGGAGGCAGCAGAGGAAGGG - Intronic
1000209085 5:159095038-159095060 ACTTGGAGGCAAAAGCAGGAGGG + Intronic
1000649403 5:163797584-163797606 ACTCGGGGGAAAGAGTGGCATGG - Intergenic
1002386903 5:178875242-178875264 GCTTGGAGGCAACAGGGGAAGGG + Intronic
1002814393 6:665771-665793 ACTTGGGGGGAAGAGGGGGAGGG + Intronic
1003237821 6:4313567-4313589 ACTTGGAGGGAAGGGTGTCATGG + Intergenic
1003580743 6:7338704-7338726 ACTTGGGGGAAAGAGTGGAAGGG - Intronic
1004916928 6:20340930-20340952 ACTAGGAAGCAAGAGAGGAATGG + Intergenic
1005179159 6:23083936-23083958 ACATGGAGACAAGAGGGGAAAGG + Intergenic
1006589225 6:35141739-35141761 ACTTAGAGTCAAGAAAGGCAAGG - Intronic
1006722568 6:36167112-36167134 ACTTGGGGGGAAGAGCGGGAGGG + Intergenic
1007215810 6:40236214-40236236 ACTTGGAGGCAGCAAAGGCAGGG - Intergenic
1008173294 6:48234990-48235012 ACTTGGAGGCAGCAGAGGAAGGG - Intergenic
1008175592 6:48264491-48264513 ACTTGGAGGAAAGGGTGGCAGGG + Intergenic
1008211512 6:48729915-48729937 ACTTGGAGGCAGCAGAGGAAGGG - Intergenic
1008305803 6:49898595-49898617 ACTTGGGGGTAAGAGCGGGAGGG + Intergenic
1008437377 6:51492189-51492211 ACCTGGATGCAAGAGAGGCCTGG - Intergenic
1008651915 6:53572748-53572770 ACTTGGAGGAAAGGGTGGGATGG + Intronic
1008738060 6:54571470-54571492 ACTTTGGGGCAAGAGTGGGAGGG - Intergenic
1009322548 6:62310087-62310109 ACTTGGGGGGAAGAGTGGGAGGG + Intergenic
1009383953 6:63066999-63067021 ACTTGGGGGGAAGAGTGGGAGGG - Intergenic
1009389401 6:63127575-63127597 ACTTGGGGGGAAGAGAGGGAGGG - Intergenic
1009454202 6:63835573-63835595 ACTTGGAGGGAAGAGTGGGAGGG + Intronic
1009946713 6:70348537-70348559 GCCTGAAGGCAAGAGCAGCAAGG + Intergenic
1010068088 6:71709700-71709722 ACTTGGATGCAAGAGCGATCAGG - Intergenic
1011392397 6:86868116-86868138 ACTTGGAGGCAGCAGAGGAAGGG - Intergenic
1012251956 6:96990603-96990625 ACTTGGAGGCAGCAGAGGGAGGG + Intronic
1012523300 6:100146475-100146497 ACCTGGAGGCAGGAGCTGTAGGG + Intergenic
1012634184 6:101515046-101515068 ACTTGGCGGGAAGAGTGGGAGGG - Intronic
1012744951 6:103074562-103074584 ACTTTGAGGAAAGAGTGGGAGGG - Intergenic
1014124453 6:117760224-117760246 ACTTGGAGGCATCAGAGGAAGGG - Intergenic
1015350376 6:132210692-132210714 ACTTGCAGCCAAGAGCAGCTTGG - Intergenic
1018439757 6:163800382-163800404 ACTTGGGGGAAAGAGTGGGAGGG + Intergenic
1018490755 6:164290174-164290196 ACTTGGAAGAGAGAGGGGCATGG + Intergenic
1020703555 7:11513150-11513172 ACTTGGGGGGAAGAGTGGGAGGG + Intronic
1021355828 7:19652047-19652069 GCTTGGAGGCAGGAGGGGAAGGG - Intergenic
1021526260 7:21592392-21592414 ACTTTGAGGCAGGAGCAGCCTGG + Intronic
1021977355 7:26023695-26023717 ACTTGGGGGCAAGTGTGGGAGGG - Intergenic
1022953388 7:35360024-35360046 ACTTGGGGGAAAGAGTGGGAAGG - Intergenic
1023068012 7:36398764-36398786 ACTTGGGGGGAAGAGCGGAAGGG - Intronic
1023159205 7:37281222-37281244 ACTTGGGGGGAAGAGCGGGAGGG + Intronic
1023509704 7:40938710-40938732 ACTTGGTGGGAAGAGTGGGAAGG - Intergenic
1024854521 7:53762815-53762837 ACTTGGGGGGAAGAGTGGAAGGG - Intergenic
1025129122 7:56366664-56366686 ACTGGGAGGCAGGAGAGGCTGGG + Intergenic
1027295919 7:76770036-76770058 ACTTGGGGGGAAGAGTGGGAGGG + Intergenic
1027349851 7:77300290-77300312 ACTTGGGGGGAAGAGTGGGAGGG - Intronic
1028386749 7:90263388-90263410 ACTTGGAGGCCAAAACGGAAAGG - Intronic
1029000050 7:97143452-97143474 ACTTGGGGGAAAGAGTGGGAGGG - Intronic
1029723248 7:102384255-102384277 ACTTGGACGCACGAGGGGGAGGG + Intronic
1029811734 7:103056001-103056023 ACTTGGGGGAAAGAGTGGGAGGG - Intronic
1030200842 7:106902082-106902104 ACTTGGAGGCAGCAGAGGAAGGG + Intronic
1030726667 7:112934393-112934415 AGTTGGAGGCAAGAGGAACAGGG - Intronic
1030727911 7:112947857-112947879 CCTGGGAGGCAAGAGTGGGAGGG + Intergenic
1031740800 7:125427931-125427953 ACTGGGAGGAAAGAGAGGTAAGG - Intergenic
1031879713 7:127182888-127182910 ACTTGGGGGGAAGAGTGGGAGGG + Intronic
1032001472 7:128268144-128268166 ACTTGCAGGGATGAGGGGCATGG - Intergenic
1032289197 7:130572084-130572106 ACTTGGGGGGAAGAGAGGGAGGG + Intronic
1032464830 7:132137673-132137695 ACTTGGAGGCAGGAATGGGAGGG + Intronic
1034445814 7:151113777-151113799 AATTGGAGGCAAGAGCTCCCCGG - Intronic
1035076921 7:156185723-156185745 ACTTGGAAGGAAGAGCGTGATGG - Intergenic
1035664352 8:1369841-1369863 ACTTGGAGGCGCGAGGCGCAAGG + Intergenic
1035763689 8:2088201-2088223 ACTTGGGGGAAAGAGTGGGAGGG - Intronic
1035821231 8:2594303-2594325 ACTTGGGGGTAAGAGTGGGAAGG - Intergenic
1037358596 8:18049412-18049434 ACTTGGGGGGAAGAGTGGGAGGG + Intergenic
1038061332 8:23916975-23916997 ACTTGGGGGGAAGAGTGGGAGGG - Intergenic
1039087190 8:33791678-33791700 ACTTGGGGGAAAGAGCGGGAGGG + Intergenic
1040674544 8:49733303-49733325 ACTTTGAAGCAAGAGCAGCTGGG + Intergenic
1040850761 8:51898826-51898848 GCTTGGAGGCCAGAGGGCCAGGG - Intronic
1041364377 8:57085473-57085495 ACTTGGGGGGAAGAGTGGGAGGG + Intergenic
1041611457 8:59854737-59854759 ACTTGGAGGCAGCAGAGGAAGGG - Intergenic
1041638277 8:60168240-60168262 ACTTGGGGGGAAGAGTGGGAGGG + Intergenic
1041874517 8:62672520-62672542 ACTTGGAACCAAAAGAGGCATGG + Intronic
1042089146 8:65139741-65139763 ACTTGGGGGAAAGAGTGGGAGGG + Intergenic
1042687582 8:71459496-71459518 ACATGGAGACAAGAGAAGCAAGG - Intronic
1044394136 8:91689548-91689570 ACTTGGTGGGAAGAGTGGGAGGG + Intergenic
1045780407 8:105856008-105856030 ACTTGGGGGGAAGAGTGGGAGGG + Intergenic
1045881441 8:107045596-107045618 ACTTGGGGGGAAGAGTGGGAGGG + Intergenic
1046782329 8:118229126-118229148 ACTTGAAGGGAAGAGTGGGAGGG + Intronic
1047388255 8:124429439-124429461 ACTTGGAGGAAATAGGGGAAAGG - Intergenic
1047457324 8:125027610-125027632 ACTTGGAGGGAAGAATGGGAGGG + Intronic
1048714403 8:137251940-137251962 ACTTGGGGGGAAGAGTGGGATGG + Intergenic
1049621289 8:143599448-143599470 ACTTGTAGGCCAGAGCCGCCAGG - Exonic
1050999228 9:12259621-12259643 ACTTGTAGGGAAGAGTGGGAAGG + Intergenic
1051227670 9:14918995-14919017 ACTTGGAGGCAGGAGAAACAAGG + Intergenic
1051678001 9:19578079-19578101 ACTTGGGGGGAAGAGTGGGAGGG + Intronic
1055880066 9:80990241-80990263 ACTTGGGGGAAAGAGTGGGAGGG + Intergenic
1055905133 9:81284864-81284886 ACTTGGGGGGAAGAGTGGGAGGG - Intergenic
1056309912 9:85330007-85330029 ACTTGGGGGGAAGAGTGGGAGGG + Intergenic
1057992000 9:99780409-99780431 ACTTGGGGGGAAGAGTGGGAGGG - Intergenic
1058025093 9:100134089-100134111 ACTTGGGGGGAAGAGTGGAATGG - Intronic
1058622693 9:106899991-106900013 ACTTGGGGGGAAGAGTGGGAGGG - Intronic
1061213721 9:129208341-129208363 ACTTGGAGTCAAGCCCGGCAAGG - Intergenic
1061913647 9:133738062-133738084 ACTTGTGGGGAGGAGCGGCAGGG + Intronic
1185933293 X:4227474-4227496 ACTTGGGGGGAAGAGAGGGAGGG + Intergenic
1186026950 X:5323792-5323814 AGCTGGAAGCAAGAGCTGCAGGG - Intergenic
1186351661 X:8746150-8746172 ACTTGGGGAGAAGAGCGGGAGGG - Intergenic
1187278448 X:17837136-17837158 TCTTGGAGGAGAGAGCTGCAGGG + Intronic
1187710292 X:22046377-22046399 ACTTGATGGGAAGAGCAGCAAGG + Intronic
1189896364 X:45660431-45660453 ACTTGGAGGAAAGGGTGGGAGGG + Intergenic
1190449435 X:50563719-50563741 ACTTGGGGGGAAGAGTGGGAAGG + Intergenic
1190732581 X:53235040-53235062 ATTTGGAAGCAAGCGGGGCAAGG - Exonic
1191741758 X:64443622-64443644 ACTTGGAGGAAAGTGTGGAAAGG + Intergenic
1192403204 X:70858047-70858069 ATTTGGAGGGAAGAGTGGGAGGG + Intronic
1192530907 X:71883825-71883847 ACTTGGGGGAAAGGGTGGCAGGG - Intergenic
1192638430 X:72842734-72842756 CCTTTGTGGCAAGAGCGGGAAGG + Intronic
1192643284 X:72878074-72878096 CCTTTGTGGCAAGAGCGGGAAGG - Intronic
1193006010 X:76618593-76618615 ACTTGGAGGCAGCAGAGGAAGGG - Intergenic
1193077417 X:77369681-77369703 ACTTGGGGGTAAGAGTGGGAGGG + Intergenic
1193193355 X:78600262-78600284 ACTTGGAGGGAAGAGTGGGAGGG + Intergenic
1193299111 X:79867976-79867998 ACTTGGAGGCAGCAGAGGAAGGG - Intergenic
1193497861 X:82236652-82236674 ACTTGGAGGCAGCAGAGGAAGGG + Intergenic
1193714864 X:84926533-84926555 ACTTGGAGGCAGCAGAGGAAGGG + Intergenic
1193826007 X:86228115-86228137 ACTTGGGGGTAAGAGTGGAAGGG - Intronic
1194028230 X:88780831-88780853 ACTTGGGGGAAAGAGTGGGAGGG + Intergenic
1194542988 X:95197918-95197940 ACTTGCAGGGAAGAGTGGAAGGG - Intergenic
1194593906 X:95835395-95835417 ACTTGGAGGCAGCAGAGGAAGGG + Intergenic
1194948116 X:100092241-100092263 ACTTGGAGGCAGCAGAGGAAGGG - Intergenic
1195135222 X:101899456-101899478 ACTTGGGGGGAAGAGTGGAAGGG - Intronic
1195446743 X:104960707-104960729 ACTTGGAGGGAGGAGGGGGAAGG - Intronic
1195856441 X:109337892-109337914 ACTTGGAGGCAGCAGAGGAAGGG + Intergenic
1195999233 X:110763275-110763297 ACTTGGGGGGAAGAGTGGGAGGG - Intronic
1196515431 X:116605739-116605761 GCTTGGAGGCAGCAGGGGCAAGG + Intergenic
1196575478 X:117313076-117313098 ACTTGGTGGGAAGAGTGGGAGGG + Intergenic
1197070325 X:122289004-122289026 ACTTGGGGGGAAGAGTGGGAGGG + Intergenic
1197668581 X:129250385-129250407 ACTTGGGGGGAAGAGTGGGAGGG - Intergenic
1197954165 X:131929111-131929133 ACTTGGGGGAAAGAGTGGGAGGG - Intergenic
1198384630 X:136116853-136116875 AAGTGGAGACAAGAGTGGCATGG + Intergenic