ID: 960586122

View in Genome Browser
Species Human (GRCh38)
Location 3:119322870-119322892
Sequence GCACCCGGGACCCCCGCGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 181}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960586122 Original CRISPR GCACCCGGGACCCCCGCGGC CGG (reversed) Intronic
900109733 1:1000387-1000409 GGGCCCGGGACCCCCGGGGCTGG + Intergenic
903263498 1:22143301-22143323 GCTCCCGGGGCCTCCCCGGCTGG + Intronic
903724555 1:25431076-25431098 GCACCCGGCCCCCCAGCGGGAGG + Exonic
905580797 1:39081718-39081740 GCACCTGCAGCCCCCGCGGCCGG + Intronic
906150221 1:43583282-43583304 GCACCAGGGACCCAAGCAGCAGG - Intronic
906731840 1:48089585-48089607 GCACCCTGCGGCCCCGCGGCTGG + Intergenic
907430102 1:54406533-54406555 GCAGCGGGGACTGCCGCGGCCGG - Intronic
911188475 1:94926534-94926556 GCCCCCGAGACCCCCGCAGCCGG + Intronic
914213959 1:145607890-145607912 GCCCCTGGGGCCTCCGCGGCGGG + Intergenic
914821470 1:151107603-151107625 GCACCCGGGTTCACCGCGCCCGG + Intronic
917876787 1:179293646-179293668 GCGCCGGGGACCCGCGCGCCCGG + Intergenic
917981382 1:180271759-180271781 GCCCCCAGGACCCCCTAGGCGGG - Intronic
922279960 1:224114249-224114271 GCGCCTGGGACCCCGGCTGCGGG - Exonic
924172445 1:241356761-241356783 GCCCCCGGGAGCCCCGCGCCGGG - Intronic
1063115585 10:3069147-3069169 CCACCCGGGTCTCCCGCGGGGGG - Intronic
1064059984 10:12129500-12129522 GGACCCGGGACCCGGGAGGCGGG - Intergenic
1064354347 10:14604138-14604160 GCTCCGGGGACCCTCTCGGCGGG - Intronic
1065102078 10:22340955-22340977 GCACCCGGGTCCGCCCCGGGAGG + Intergenic
1068523880 10:58106367-58106389 GCACCTGGGACCCCGCAGGCAGG + Intergenic
1070609982 10:77926555-77926577 CCTCCCGGGCCCCCCGAGGCCGG + Intergenic
1073491345 10:103855338-103855360 GGCCCCGGGACCCCGGCAGCTGG - Exonic
1075665120 10:124224387-124224409 GGAGCCGGGACCCCCAGGGCTGG + Intergenic
1075911762 10:126131182-126131204 GCACCCAGGGTCCCCGAGGCAGG - Intronic
1076700395 10:132269909-132269931 GCATCCGGGGCCCACGTGGCTGG - Intronic
1076871036 10:133195293-133195315 GGACCCGGGAGCCCCCCGACTGG - Intronic
1077264700 11:1642854-1642876 GCACCCTGGACCCCCGAGCTGGG + Intergenic
1078594684 11:12675293-12675315 GCGCCGGGTACCCCCGAGGCCGG + Intronic
1081528370 11:43942417-43942439 TCTCCCGGAACCCCCGCGGGCGG + Exonic
1082810499 11:57476581-57476603 GCCCGCGGCACCCACGCGGCCGG + Exonic
1084146289 11:67266898-67266920 GCGACCTGGACCCCCGGGGCCGG + Intronic
1084165589 11:67373426-67373448 ACCCCCGGGAGCCCCGCGCCGGG - Intronic
1084785432 11:71439223-71439245 GCCGCTGGGACCCCCACGGCTGG + Intronic
1090699304 11:129279602-129279624 GCACCCGCGACGCCCGCAGCGGG + Intergenic
1091750890 12:3020674-3020696 GCCCCCGGCACCCCCATGGCAGG + Exonic
1091796227 12:3298886-3298908 GCAGGCGGGACTCCTGCGGCTGG - Intergenic
1092194372 12:6540443-6540465 GCACCCGAGGCCCTCGCAGCAGG - Exonic
1094199179 12:27779965-27779987 GCCCGCGGGACCCCAGCCGCCGG - Intergenic
1095090511 12:38099835-38099857 GCAGCAGGGACCCCCGTGTCCGG + Intergenic
1095584614 12:43836270-43836292 GCAGCCGGGACACGGGCGGCAGG - Intronic
1096706610 12:53425855-53425877 GCGGCCAGGACCCCCCCGGCTGG - Exonic
1102453381 12:113057165-113057187 GCACCCGGCATCCCCCCGGCAGG + Intronic
1102527113 12:113520055-113520077 CCAGCCAGGATCCCCGCGGCTGG - Intergenic
1103918856 12:124389251-124389273 GCAGCCGTGTCCCCCGCAGCCGG + Intronic
1104865275 12:131949941-131949963 GCATCCGGGGCCCCGGCGGGAGG - Intronic
1104906389 12:132215674-132215696 GCACCCGGGTCCCACGAGGCCGG + Intronic
1105389189 13:19959148-19959170 GGCCCCGCGACCCCCGCCGCTGG - Intronic
1106413001 13:29524100-29524122 GGACCCGGGACCGCAGTGGCTGG + Intronic
1112506740 13:99980479-99980501 GCTCCCGGGAGCGCCGCGGTCGG + Intergenic
1113582163 13:111437506-111437528 GCACCAGGGACCCCACCTGCCGG + Intergenic
1113883281 13:113641566-113641588 CCACCCGGGCCCACCGCGTCTGG - Intergenic
1114635023 14:24182478-24182500 GCCCCAGGGACCCCTGCAGCTGG - Intronic
1114649019 14:24271458-24271480 GCACCCCCGCCCCCCGCGGGCGG + Exonic
1115261301 14:31457154-31457176 TGACCCGGTATCCCCGCGGCCGG + Intronic
1117251835 14:53946793-53946815 GCCCGCGGGAGCCGCGCGGCAGG - Intergenic
1119260897 14:73237616-73237638 GCCCCCGGGCGCCCAGCGGCGGG + Intronic
1120190525 14:81436115-81436137 CACCCCGGGACGCCCGCGGCTGG + Intronic
1122151091 14:99726675-99726697 GCACCCTGCGGCCCCGCGGCTGG + Exonic
1122486643 14:102086702-102086724 GGGCGGGGGACCCCCGCGGCGGG + Intronic
1122719940 14:103716192-103716214 CCTCCCGGGACCCCCGCACCGGG - Intronic
1122982096 14:105196563-105196585 GCCCCCGGGAGCCCCGAGCCAGG + Intergenic
1128264312 15:66253707-66253729 GCAGCCGGGAGCCGGGCGGCGGG + Exonic
1128322712 15:66704090-66704112 GGACCCGGGGCCCCCCCGGCCGG - Intronic
1128455672 15:67830006-67830028 GCACCCCCCACCCCCGCGCCTGG - Intronic
1129761430 15:78131302-78131324 GCCCTCGGCAGCCCCGCGGCTGG + Exonic
1131215200 15:90530244-90530266 GCGGGCGGGACCCGCGCGGCGGG + Intronic
1132317353 15:100899677-100899699 GCACCCTTGACCCCTGCAGCTGG - Intronic
1132364986 15:101251071-101251093 GCACCCGGGATGCCGGCCGCCGG + Intronic
1132478390 16:153750-153772 GCACCCGGGCCCCGCGAGGAGGG + Intronic
1132480475 16:164340-164362 GCACCCGGGCCCCGCGAGGAGGG + Intronic
1132667389 16:1088398-1088420 GCACCGGGCACCCCCGTGGTCGG - Intergenic
1132915132 16:2340114-2340136 GCGCCCGGCATCCCTGCGGCCGG + Intronic
1132933061 16:2468466-2468488 GCACCCAGCACCCTCGCGCCGGG - Intergenic
1136153093 16:28364963-28364985 ACACCCGGGGCGGCCGCGGCAGG - Intergenic
1136209990 16:28750310-28750332 ACACCCGGGGCGGCCGCGGCAGG + Intergenic
1136242161 16:28951233-28951255 GCCCCCGGAGCCCCCGGGGCCGG + Exonic
1136519461 16:30786711-30786733 GGAGCCGGGACCCCGGGGGCCGG - Intronic
1139949965 16:70663945-70663967 GCAGCCGGGTACCCCGGGGCAGG - Exonic
1139965283 16:70741928-70741950 CCACCAGGGACCCCCGGGTCAGG + Intronic
1140477956 16:75248459-75248481 GCACCCGGGACCCACCTGGAGGG + Intronic
1141469498 16:84228799-84228821 GCACCCGGGAGACCCGCTGAGGG + Intronic
1142115564 16:88354376-88354398 GAACCCGGGACGCAGGCGGCGGG + Intergenic
1142156271 16:88534115-88534137 GCCCCCGGGACCCCCTGGGCCGG + Exonic
1142849505 17:2697567-2697589 GCACCGGGGGTCCCCGCCGCTGG - Intronic
1142876262 17:2853554-2853576 GCTCCCGGGACCCCCCTGCCCGG - Intronic
1143083305 17:4397181-4397203 CCACCCTGGACTCCCCCGGCAGG - Intergenic
1146214894 17:30971222-30971244 GCGCCCGCGACGCCCGCCGCTGG + Exonic
1150168471 17:62966589-62966611 GCACCCCGGAACGGCGCGGCGGG - Intergenic
1151876016 17:76868666-76868688 GCAGACGGGCTCCCCGCGGCGGG - Intronic
1152410173 17:80119098-80119120 GCACCCGGTTCCTCCCCGGCAGG - Intergenic
1152464062 17:80456039-80456061 ACTCCCGGGACCCCCTCTGCAGG - Intergenic
1152542067 17:80981511-80981533 GCAGCGGCGACCCCCGCGCCAGG - Intergenic
1152552217 17:81035452-81035474 CCACCCGGGACCCGGGCTGCTGG + Intronic
1152615958 17:81337876-81337898 GAGCCTGGGACCACCGCGGCTGG + Intergenic
1152616326 17:81339626-81339648 ACACCCTGGACCCCCGTGACAGG + Intergenic
1152798619 17:82320983-82321005 GCGCCCGGGACCCCCGCACGGGG - Intergenic
1153688270 18:7567465-7567487 GGACCCGGGACCCGAGCTGCCGG - Exonic
1155199345 18:23503583-23503605 GCCCCCGGGGCCCCCGCCGCGGG + Exonic
1159045588 18:63366741-63366763 GGCCCCGGGAACCCTGCGGCCGG + Intronic
1160568029 18:79798780-79798802 GAACCCGGGAGCCCCGCAGGAGG - Intergenic
1160901910 19:1433014-1433036 GCACCCGGGACCCACACCGAGGG - Intronic
1161241429 19:3225576-3225598 GCATCCGTGTCCCCCGCGGCCGG - Intronic
1161574506 19:5048184-5048206 GCACCCGGCACCTCCCGGGCAGG - Intronic
1162128243 19:8510877-8510899 GCCCCCGCGGCCCCCGCGGCCGG - Exonic
1163851932 19:19669128-19669150 ACACCCGGGGTCCCGGCGGCTGG - Intronic
1164995789 19:32719925-32719947 GCGCCTGGGCCCCCCGCGGCAGG - Intronic
1165405613 19:35629169-35629191 GCACCCGGGAGTCCCGGGGCTGG - Exonic
1166182126 19:41116487-41116509 GCACCTGGGACCCAGGCGGGTGG + Exonic
1166331579 19:42080804-42080826 GCACTCTAGACCCCGGCGGCGGG - Exonic
1168146076 19:54420695-54420717 CCACCCGGGACCCAAGCGTCGGG - Intronic
1168276971 19:55284126-55284148 GCACCTCAGACCCCCCCGGCGGG + Intronic
925170050 2:1744632-1744654 GAACCCGGGGCCCCAGCGTCCGG + Intronic
925640568 2:5982652-5982674 GCACCTGGGGCTCCCGTGGCCGG + Intergenic
926308738 2:11659296-11659318 GCACCCGGGGCCTCAGTGGCTGG - Intronic
927489149 2:23509182-23509204 GCACCCGGGAAGACTGCGGCTGG + Intronic
929780206 2:44952438-44952460 GCACCCGGTTCCCGCGGGGCTGG + Intergenic
931321370 2:61177373-61177395 GCTCCCGGGCGCGCCGCGGCAGG + Intergenic
932180627 2:69643434-69643456 GAACCCGGGACCCCCGAGCCGGG + Intronic
935196736 2:100820551-100820573 GCACCGGGGACCCCGGACGCGGG + Intronic
937123089 2:119454214-119454236 GCACCCGGTACCCAGGAGGCAGG + Intronic
938727296 2:134120154-134120176 GCGCCCGGGGCCGCCGCCGCGGG - Intronic
947429383 2:230012338-230012360 GCACCGGGGAGCCCCGTGACTGG - Exonic
948953999 2:241272909-241272931 GCGGCGGGGACCCCAGCGGCGGG - Intronic
949010533 2:241675943-241675965 GCACTGGGGACCCCCGTGGTGGG - Exonic
1169327488 20:4687072-4687094 GCTCCCGGAACTCCCCCGGCGGG - Intronic
1172919980 20:38473078-38473100 GCAGCCGGCCCCGCCGCGGCCGG + Intronic
1173251621 20:41366730-41366752 GACCCCGGGACCCTCGGGGCGGG - Exonic
1173909232 20:46651632-46651654 GCAAACGGGACCCCAGCCGCAGG + Intronic
1175439701 20:58981687-58981709 GGCCCTGCGACCCCCGCGGCGGG + Intronic
1175572878 20:60037340-60037362 GCACCCGTGACTCACACGGCTGG + Intergenic
1175916279 20:62427433-62427455 GTACCCGGGACCCCGGGGCCAGG - Intronic
1176077820 20:63256477-63256499 GCGCCTGGGGTCCCCGCGGCTGG - Intronic
1178555794 21:33588809-33588831 CCACCCGGGATCGCCGCTGCGGG - Intronic
1179577446 21:42316938-42316960 CCACCGGGGACCCCAGCTGCAGG - Intergenic
1180045631 21:45303839-45303861 GCCTCCGGGACCCCCCTGGCTGG - Intergenic
1181854510 22:25772474-25772496 GCACCGAGGGCCCCCGGGGCTGG - Exonic
1183540705 22:38427831-38427853 GCCGCCGGGCCCCCCGCCGCAGG + Exonic
1183744846 22:39686284-39686306 GCAGCAAGGACCCCCCCGGCCGG + Exonic
957048828 3:75396321-75396343 GCCCCCGGGGTCCGCGCGGCTGG + Intergenic
960465974 3:117997120-117997142 CCACCCCGGAGCCCGGCGGCAGG + Intergenic
960586122 3:119322870-119322892 GCACCCGGGACCCCCGCGGCCGG - Intronic
961674267 3:128555366-128555388 GCACCCTGGCCGCCCGAGGCAGG - Intergenic
966868710 3:184276520-184276542 GCACCCGAGACCCCCGTAGAGGG + Intronic
968092726 3:195908871-195908893 GCCCCCGGGGCCCCACCGGCCGG + Intronic
968313172 3:197700869-197700891 GCAACTTGGACCCCCGAGGCCGG - Exonic
968573187 4:1353201-1353223 GCACCCCTGACCCCCGGGACGGG + Exonic
968871177 4:3243336-3243358 GGACCCGGGACCACAGCTGCTGG + Exonic
969138842 4:5051812-5051834 GCATCCGGCATCCCAGCGGCCGG + Exonic
969393983 4:6909286-6909308 GCTCCCAAGACCACCGCGGCGGG + Intronic
969788316 4:9474858-9474880 GCTCCTGGGACCCCCATGGCAGG + Intergenic
972738283 4:41866311-41866333 GCACGCTGGGCCCCCGAGGCGGG - Intergenic
975991943 4:80266798-80266820 GCACTTAGGACCCCCGCGGCTGG + Exonic
980923930 4:139115424-139115446 GCCTCCGGGACGCCCCCGGCTGG + Intronic
983254144 4:165379306-165379328 GAGCCCGGGGCGCCCGCGGCGGG + Exonic
983904568 4:173169590-173169612 GCACCCCGGCTCCCCGCCGCCGG - Intronic
985083686 4:186292206-186292228 GCACCCGGGGCACCAGTGGCTGG + Intergenic
985591172 5:766292-766314 AGACCCGGGACCCCTGCCGCTGG + Intronic
989103475 5:37840184-37840206 GCACCCCGGCCCCCCGCCTCGGG - Intergenic
990347448 5:54884128-54884150 GGACGCGGGGCCGCCGCGGCGGG - Intergenic
990910076 5:60843988-60844010 GCTCCCGGGGCCCCCGCACCCGG + Intronic
997530190 5:134577166-134577188 GCACCCAGGACCCCCCAGCCAGG - Intronic
997625764 5:135329602-135329624 GCACCCGGGATCCCCACATCAGG - Intronic
999062873 5:148654348-148654370 GCAGCGGGGACCACCGGGGCTGG - Intronic
1000052593 5:157575615-157575637 GCTCCCGCGCCGCCCGCGGCCGG + Exonic
1001382055 5:171311649-171311671 GCGCCCCGGACCCCCCAGGCGGG + Exonic
1002054211 5:176589478-176589500 GCACCAGGGACCCTGGGGGCTGG - Intronic
1002439341 5:179256256-179256278 GCACCCGTGTCCCCAGGGGCGGG - Intronic
1005905602 6:30259857-30259879 GAACCGGGGCTCCCCGCGGCCGG - Intergenic
1006411686 6:33877624-33877646 GCAGCCGGGACCCCATGGGCAGG - Intergenic
1006634547 6:35452555-35452577 GCCCCAGGGAGCCCCGCGTCCGG - Exonic
1017914207 6:158819166-158819188 TCGCCCGGCACCCCCGGGGCAGG - Intronic
1018416728 6:163608087-163608109 CCACCCGGGACCCCCGAGTGTGG + Intergenic
1020099947 7:5389049-5389071 GGACCGGGGGCCCCCGCGCCTGG - Exonic
1022528241 7:31052102-31052124 GCGCCCCCGACCCCCGCCGCTGG + Intergenic
1027232631 7:76281640-76281662 GCGCCGGCGACCCCTGCGGCGGG - Exonic
1029582736 7:101448105-101448127 GCACCCAGAACCCCTGGGGCAGG + Intronic
1030168580 7:106579137-106579159 GCGCCCGGCACCCCCCCGCCCGG - Intergenic
1032509977 7:132465013-132465035 GCACCTGGGCTCCCCGGGGCTGG - Intronic
1036020739 8:4842591-4842613 GCACCCGGGTTCCCTGCAGCAGG - Intronic
1037336925 8:17801148-17801170 GCCCCCGAGACCTCCGGGGCGGG - Intergenic
1038807857 8:30812057-30812079 GCACCCGAGCCCCCCACGCCCGG + Intronic
1039904177 8:41774104-41774126 CCACCCAGGACCCCCTGGGCAGG + Intronic
1049195884 8:141315414-141315436 CCACCCAGGACCCCTGCGGCAGG + Intergenic
1049570579 8:143368643-143368665 GCGGCCGGAACGCCCGCGGCTGG - Intergenic
1049762627 8:144337980-144338002 GCTCCCGGCACACCCGCGCCCGG - Intergenic
1049803988 8:144530673-144530695 GCAGCGGGGACCCCCGGGGAGGG + Intronic
1051171570 9:14322708-14322730 GCGCCCGGGACCCGGGAGGCGGG + Intronic
1052048733 9:23822611-23822633 CCACCCCGGAGCCACGCGGCTGG + Intronic
1053010085 9:34628037-34628059 GTACCAGGGACCCCCTCAGCTGG - Exonic
1056746960 9:89311386-89311408 TCAGCCGGGGCCCCCGCGGGCGG + Intronic
1060811986 9:126615231-126615253 GCTCCCCGGACCGCCGCGCCAGG - Intronic
1062115532 9:134806254-134806276 GCCCCAGGGACCCCCAGGGCCGG + Exonic
1062289756 9:135789246-135789268 GCTCACAGGACTCCCGCGGCAGG + Intronic
1203787631 EBV:136694-136716 GCACCCGGGTCCCCGCCCGCGGG - Intergenic
1185457908 X:319738-319760 GCATCGGGGACCCCCAGGGCGGG - Intergenic
1185457991 X:319986-320008 GCATCCGGGCCCCCCAGGGCTGG - Intergenic
1185458054 X:320168-320190 GCATTCGGGACCCTCACGGCTGG - Intergenic
1185466385 X:357216-357238 GCACGTGGGACACCCGCGGCAGG + Intronic
1187698166 X:21941108-21941130 GCACCCGGGACTGCCCCTGCAGG - Intronic
1198685600 X:139225225-139225247 GCACCTGTGACCCCAGCGTCTGG - Intergenic