ID: 960588596

View in Genome Browser
Species Human (GRCh38)
Location 3:119344313-119344335
Sequence GTGTCCTATCTGGTTTCAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 135}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960588596_960588601 24 Left 960588596 3:119344313-119344335 CCGTCTGAAACCAGATAGGACAC 0: 1
1: 0
2: 0
3: 11
4: 135
Right 960588601 3:119344360-119344382 TCTGCAAGTACACCCTCATATGG 0: 1
1: 0
2: 1
3: 3
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960588596 Original CRISPR GTGTCCTATCTGGTTTCAGA CGG (reversed) Intronic
907194641 1:52676588-52676610 GTGTCCGATCAGGTTCCAGGAGG - Intergenic
907325807 1:53638056-53638078 GTATCCCATCTGGGTTTAGAGGG + Intronic
913081537 1:115392103-115392125 GAGCACTATGTGGTTTCAGACGG - Intergenic
915187435 1:154118643-154118665 GTGTCCTATAAGGCTTCACAAGG - Intronic
915695017 1:157731635-157731657 GTGACCTCTCTGGTCTCAGATGG - Intergenic
918304315 1:183232168-183232190 CTTTCCTGTGTGGTTTCAGATGG + Exonic
923831727 1:237565759-237565781 CTCTCCTCTGTGGTTTCAGAAGG + Intronic
924465983 1:244299690-244299712 GTTTCAGATTTGGTTTCAGAAGG - Intergenic
1062762010 10:29999-30021 GTGTCCTATCTGATTTCTCTGGG - Intergenic
1063920993 10:10932814-10932836 TTGCCCTTTCTGGTTGCAGAAGG - Intergenic
1065164478 10:22960809-22960831 GGGTCCTATCTGGTCTCAGTGGG - Intronic
1066348954 10:34618895-34618917 GTCTCCTTTCTGGTTTCACTTGG + Intronic
1066802250 10:39205257-39205279 GTGTCCTATCTGCTTGCAATAGG + Intergenic
1073940074 10:108687100-108687122 ATGTCTTAACTGGTTTCATAAGG + Intergenic
1075893735 10:125977323-125977345 TTGTTGTCTCTGGTTTCAGAGGG + Intronic
1079839466 11:25377881-25377903 GTGCCATATCTAGATTCAGAAGG + Intergenic
1082919307 11:58475273-58475295 GTGTTCTTTCTTTTTTCAGAGGG + Intergenic
1086148824 11:83585999-83586021 GAGTCCTTTCTGGTTTCACTAGG - Intronic
1086972766 11:93101564-93101586 GTCTCCTTTCTGGTCTCAGAAGG - Intergenic
1087718328 11:101634139-101634161 GTGACTTTTCTGGTGTCAGATGG + Intronic
1098180616 12:67842332-67842354 GTGTCCCATCTGTTCACAGAGGG - Intergenic
1100670780 12:96810217-96810239 GTGTCCTAAGTGTTTTCAGAGGG - Intronic
1101623493 12:106415265-106415287 GTGACCTCACTGCTTTCAGAGGG - Intronic
1103454986 12:121058474-121058496 GGGTACTCTCTGGGTTCAGAGGG - Intergenic
1106093679 13:26623003-26623025 GTGTCCTGTCTACTCTCAGATGG - Intronic
1106155036 13:27146677-27146699 ATTTCCTACCTTGTTTCAGAAGG + Intronic
1107307910 13:39042681-39042703 GTGTCCTCTCTAGTATCAGGAGG + Intronic
1107441220 13:40429010-40429032 GAGTCCTTTCTGGTTACACATGG - Intergenic
1107731410 13:43352756-43352778 GTGTTACCTCTGGTTTCAGAAGG + Intronic
1109154818 13:58894241-58894263 TTTTACTATCTAGTTTCAGATGG + Intergenic
1121898614 14:97672160-97672182 GTTTCCTCTGTGGTGTCAGAAGG - Intergenic
1123579487 15:21703557-21703579 GGGTCCTGTCTGGGTTCACACGG - Intergenic
1123616114 15:22146068-22146090 GGGTCCTGTCTGGGTTCACACGG - Intergenic
1126325715 15:47474768-47474790 GTGTCCTGTCTGATTGCAAAAGG - Intronic
1130394644 15:83491597-83491619 GTGTGCAAGTTGGTTTCAGAAGG + Intronic
1202988357 15_KI270727v1_random:437802-437824 GGGTCCTGTCTGGGTTCACACGG - Intergenic
1133141154 16:3745594-3745616 GTTTCCTTTCTGGTTGCAAAGGG - Intronic
1134244986 16:12533193-12533215 GTGTCCTCTGTGGCCTCAGATGG - Intronic
1136624346 16:31452794-31452816 GTGTCCTATCAGGTCTGAGGAGG + Intergenic
1139278054 16:65746307-65746329 GTGTCCGACTTGGCTTCAGATGG - Intergenic
1139295574 16:65897603-65897625 GTGTGCTGTCTGGAATCAGATGG - Intergenic
1141851248 16:86647542-86647564 GTGTTCTATGTGGTTCCTGAGGG + Intergenic
1145318433 17:21748860-21748882 GTGCCCTGGATGGTTTCAGAGGG + Intergenic
1149272821 17:55000126-55000148 ATGTCATATTTGGTTTCAGTTGG + Intronic
1152954918 18:30329-30351 GTGTCCTATCTGATTTCTCTGGG - Intergenic
1159370206 18:67518617-67518639 GATTCCTATCTGTTTGCAGAGGG + Intergenic
1161416975 19:4152872-4152894 GAGTCCAAGCTGGTTTCGGAGGG + Intergenic
1163703550 19:18799194-18799216 GTGCCCTGTCTGCTTTCACATGG + Intergenic
1168257416 19:55174301-55174323 GTGTCCTATCTGCTCTAAGCGGG - Intronic
926724957 2:15990374-15990396 AGGTACTATCTGGTTTCAGCTGG + Intergenic
928759523 2:34565730-34565752 GTTTCCTGTTTGTTTTCAGATGG + Intergenic
929175114 2:38968145-38968167 TTGTCCTCTCTGGATTCAGAGGG + Intronic
933589293 2:84214392-84214414 GTGTGCCATCTGTTTTCTGAGGG - Intergenic
934623128 2:95828455-95828477 TTCTCATTTCTGGTTTCAGAGGG + Intergenic
934810635 2:97273632-97273654 TTCTCATTTCTGGTTTCAGAGGG - Intergenic
934827057 2:97434307-97434329 TTCTCATTTCTGGTTTCAGAGGG + Intergenic
935253885 2:101290929-101290951 TTGGCCTATCTTGTGTCAGATGG - Intronic
936540790 2:113349302-113349324 TTGTCCTCTCTGGTTACAAAAGG - Intergenic
936669575 2:114640997-114641019 GTTTCCTATCTGGTTTGAAGAGG + Intronic
937635048 2:124146052-124146074 TTGTCCTATCTGCTTTAAGTGGG - Intronic
939194464 2:138954876-138954898 GTATCCTACTTGGTTTCAGAGGG - Intergenic
941184878 2:162309350-162309372 GTTTCCTTTTTGGTTTCAAAGGG - Intronic
942627590 2:177919049-177919071 GTTTCTTATCTGTTTTCATAAGG - Intronic
945555843 2:211274834-211274856 TTGTCCTTTCTGGTATAAGAGGG - Intergenic
1169188415 20:3639856-3639878 TTGTCCTAAGTGGTTCCAGATGG + Intronic
1169913721 20:10667665-10667687 GAGTCCGATCTGGTTACAAAGGG + Intronic
1177888505 21:26776136-26776158 TTGTTCTATCTGATTTTAGATGG + Intergenic
1180796346 22:18607644-18607666 GTGTCCAACCTGGGCTCAGAAGG - Exonic
1181225377 22:21387627-21387649 GTGTCCAACCTGGGCTCAGAAGG + Exonic
1181253256 22:21547186-21547208 GTGTCCAACCTGGGCTCAGAAGG - Exonic
1184596723 22:45518436-45518458 CTGTCCAAGCTGGATTCAGATGG + Intronic
1185076883 22:48687872-48687894 GTCTCCTGTCTGGTTCCAGGAGG - Intronic
954116406 3:48469183-48469205 GGGTCCTCTCTGCTTTCAGGAGG - Exonic
954729432 3:52645760-52645782 CTGTCCTATCTGGTCTCACCTGG - Intronic
954779260 3:53046670-53046692 GTGCCCTTTCAGGTCTCAGAGGG - Intronic
954851588 3:53605538-53605560 GTTACCTATCTGGCTTCTGAAGG - Intronic
955492547 3:59497881-59497903 TTGAGCAATCTGGTTTCAGAAGG + Intergenic
956579151 3:70791260-70791282 GCGTCCCATCTGTCTTCAGAGGG + Intergenic
957599015 3:82308052-82308074 GTGTCCTCTCTGATTTCCTAAGG - Intergenic
958461803 3:94407182-94407204 GTGGCCTTTCTCTTTTCAGATGG + Intergenic
958655742 3:97000872-97000894 GTGTCTTATCTGGCTACAAAAGG + Intronic
960486199 3:118255613-118255635 GTGTCCTATTTGTGTTCTGATGG + Intergenic
960588596 3:119344313-119344335 GTGTCCTATCTGGTTTCAGACGG - Intronic
962154565 3:132932249-132932271 GGGTCCCATCTGTCTTCAGAGGG + Intergenic
964190212 3:153992542-153992564 ATGTCCAATATGGTTTCAGAGGG + Intergenic
964557203 3:157952757-157952779 GTGTGCTGTCTGCTTTCAGCTGG - Intergenic
966669517 3:182511245-182511267 GTGTCCTATCAGGTGGTAGAAGG + Intergenic
966899195 3:184468099-184468121 GTGGCCTTTATGGTTACAGAGGG + Intronic
967214524 3:187199195-187199217 GTTTCTTATCTGGTGTGAGAAGG + Intronic
967733132 3:192924809-192924831 TTCTCCTATGTGGCTTCAGAGGG + Intergenic
968358805 3:198131834-198131856 GTGTCCTATCTGATTTCTCTGGG + Intergenic
969374366 4:6753419-6753441 TTGTCGCATCTGTTTTCAGATGG - Intergenic
976428902 4:84939303-84939325 GTGTCCTATCTGGAGTCACATGG + Intronic
984677678 4:182569047-182569069 GTGTGCTATCTTGTTTTGGATGG + Intronic
985117102 4:186603126-186603148 GTGTCACAGATGGTTTCAGACGG - Intronic
995613295 5:113933990-113934012 TTTTCCTATGTGGTATCAGAAGG + Intergenic
995826472 5:116305256-116305278 GGTTCTTATCTGGTTGCAGAAGG - Intronic
996306430 5:122053234-122053256 GTGTCCTGTCTGGCTTTAGGAGG + Intronic
1000523832 5:162330816-162330838 GTGTCCTCTCTTATTTCTGAAGG - Intergenic
1001230480 5:169983093-169983115 GTCACCCATCTGGTTTAAGATGG - Exonic
1003407857 6:5838333-5838355 GTGGCCTATCTGGAGGCAGAGGG - Intergenic
1004066068 6:12245711-12245733 GTTTACTATCTGGTTCCAAAGGG - Intergenic
1004232893 6:13849103-13849125 GTGTCCTATGTGGTTGCTTAGGG + Intergenic
1010162520 6:72874143-72874165 TTGTCCTTTCAGGTTTGAGAAGG - Intronic
1011788111 6:90868694-90868716 GTGTCCAATCTGATAACAGAAGG + Intergenic
1011846457 6:91569476-91569498 TTTTCCCATCTGCTTTCAGAAGG + Intergenic
1013023064 6:106239436-106239458 GTGTCCTGTCTGATTAGAGATGG - Intronic
1013466836 6:110425152-110425174 ATTTCCTAACTGTTTTCAGAGGG + Intronic
1014120289 6:117717114-117717136 CGGTCCTAGATGGTTTCAGAGGG - Intergenic
1015008713 6:128316663-128316685 GTGACCTCTCTGGTTCCTGATGG - Intronic
1021459573 7:20871074-20871096 GTGTCCTGGCTGGTCTCAGATGG + Intergenic
1029162520 7:98562842-98562864 GTGTCCTCACTGGTTTCAAAAGG + Intergenic
1038914956 8:32010873-32010895 ATGTCCTATAATGTTTCAGAGGG + Intronic
1039229365 8:35426105-35426127 GTATCCTATGTAGTTTCAAAGGG - Intronic
1039660019 8:39450916-39450938 GTGATCTCTCTTGTTTCAGAAGG + Intergenic
1043699968 8:83273510-83273532 GATTTCTATCTGCTTTCAGATGG - Intergenic
1044023915 8:87144205-87144227 TTGCCCTTTCTGGTTTTAGAAGG - Intronic
1044401046 8:91772232-91772254 GTGTACTTTCCGTTTTCAGATGG + Intergenic
1045148993 8:99381593-99381615 CTGTTCTATCTGGTGTGAGATGG + Intronic
1048126548 8:131641861-131641883 GTGTTCTATCTGTTTTCTGCTGG - Intergenic
1049882283 8:145074013-145074035 GTGTCCTATCTGATTTCTCTGGG + Intergenic
1050564303 9:6866312-6866334 GTTTCCTTTTTGGTTCCAGATGG + Intronic
1052076351 9:24145349-24145371 TTGTCCAATCTGGATTCATATGG - Intergenic
1052378103 9:27740950-27740972 TTCTCGTCTCTGGTTTCAGAGGG + Intergenic
1056539370 9:87558175-87558197 GTGGTCTGTCTGGTTTCACATGG + Intronic
1057287796 9:93774435-93774457 GCTTCCTACTTGGTTTCAGAGGG + Intergenic
1058533660 9:105932521-105932543 TTGTCCTTTCTCATTTCAGAAGG + Intergenic
1058818270 9:108705439-108705461 CTGCCCTATCTAGTTTCAGGTGG - Intergenic
1059057628 9:111000620-111000642 GGTTCCTGCCTGGTTTCAGAAGG - Intronic
1059990624 9:119861992-119862014 GTGGCCAATCTTGTTCCAGAAGG - Intergenic
1060798566 9:126528884-126528906 TTATCCTAACTGGTTTCACATGG - Intergenic
1060908524 9:127329863-127329885 GGGTCCTTTCTGGTTTTAGCAGG + Intronic
1061485969 9:130920686-130920708 CTGGCCTATCTGGTTTAAGGAGG - Intronic
1186573391 X:10739486-10739508 GTCTCCTATCTGCTCTCAGAAGG + Intronic
1187123491 X:16431826-16431848 GTCCCATATCTGATTTCAGATGG + Intergenic
1187170395 X:16846041-16846063 GGGTGCTGTCTGGTTTTAGAAGG + Intronic
1189666794 X:43364416-43364438 GTGTGCCATCTGTTTTCAGTTGG - Intergenic
1190952926 X:55163387-55163409 GTGTCCTCAGTGGTTTCTGAAGG - Intronic
1190972203 X:55361054-55361076 GTGTCCTCTCTGGTTTCCTTGGG - Intergenic
1191982377 X:66940641-66940663 GTGTCCTGTATTATTTCAGAGGG + Intergenic
1193027580 X:76861279-76861301 GTGTCTCATCCTGTTTCAGAGGG + Intergenic
1193480540 X:82022277-82022299 GTGTCCTGTCTCTTCTCAGAGGG - Intergenic
1196583050 X:117397349-117397371 GTCTTATCTCTGGTTTCAGAGGG - Intergenic
1196932728 X:120697025-120697047 GTCTTGTCTCTGGTTTCAGAGGG - Intergenic
1196942886 X:120795024-120795046 TTGTCCTATTTGGTTTCTGCAGG + Intergenic
1197599696 X:128514060-128514082 GTGGATTTTCTGGTTTCAGAAGG - Intergenic
1201060404 Y:10038880-10038902 GTGGCCTCTCTTGTCTCAGAGGG - Intergenic