ID: 960588743

View in Genome Browser
Species Human (GRCh38)
Location 3:119345384-119345406
Sequence TGCCATAACCCCAGTGTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 122}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960588743_960588748 11 Left 960588743 3:119345384-119345406 CCCAGCACACTGGGGTTATGGCA 0: 1
1: 0
2: 0
3: 14
4: 122
Right 960588748 3:119345418-119345440 GGAGGCATGCCTGGTCTCAGTGG 0: 1
1: 0
2: 2
3: 30
4: 340
960588743_960588746 -7 Left 960588743 3:119345384-119345406 CCCAGCACACTGGGGTTATGGCA 0: 1
1: 0
2: 0
3: 14
4: 122
Right 960588746 3:119345400-119345422 TATGGCATTCTACTTACAGGAGG 0: 1
1: 0
2: 1
3: 7
4: 118
960588743_960588752 28 Left 960588743 3:119345384-119345406 CCCAGCACACTGGGGTTATGGCA 0: 1
1: 0
2: 0
3: 14
4: 122
Right 960588752 3:119345435-119345457 CAGTGGTAGAAAGTGGCAGTGGG 0: 1
1: 0
2: 1
3: 25
4: 209
960588743_960588751 27 Left 960588743 3:119345384-119345406 CCCAGCACACTGGGGTTATGGCA 0: 1
1: 0
2: 0
3: 14
4: 122
Right 960588751 3:119345434-119345456 TCAGTGGTAGAAAGTGGCAGTGG 0: 1
1: 0
2: 0
3: 20
4: 289
960588743_960588745 -10 Left 960588743 3:119345384-119345406 CCCAGCACACTGGGGTTATGGCA 0: 1
1: 0
2: 0
3: 14
4: 122
Right 960588745 3:119345397-119345419 GGTTATGGCATTCTACTTACAGG 0: 1
1: 0
2: 0
3: 1
4: 74
960588743_960588747 2 Left 960588743 3:119345384-119345406 CCCAGCACACTGGGGTTATGGCA 0: 1
1: 0
2: 0
3: 14
4: 122
Right 960588747 3:119345409-119345431 CTACTTACAGGAGGCATGCCTGG 0: 1
1: 0
2: 0
3: 7
4: 111
960588743_960588750 21 Left 960588743 3:119345384-119345406 CCCAGCACACTGGGGTTATGGCA 0: 1
1: 0
2: 0
3: 14
4: 122
Right 960588750 3:119345428-119345450 CTGGTCTCAGTGGTAGAAAGTGG 0: 1
1: 0
2: 0
3: 27
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960588743 Original CRISPR TGCCATAACCCCAGTGTGCT GGG (reversed) Intronic
900872336 1:5312957-5312979 TGCCACAACCCCTGTGCCCTGGG + Intergenic
901104396 1:6743945-6743967 TGCCAAAACTCCACAGTGCTCGG - Intergenic
901401758 1:9019506-9019528 GGCCTTAACCCCAGTGTGATGGG + Intronic
904288571 1:29469471-29469493 TGCCAAAATACCAGGGTGCTTGG + Intergenic
904835438 1:33332533-33332555 TGTCATCATCCAAGTGTGCTGGG + Intronic
906783862 1:48596998-48597020 TACGAGAACACCAGTGTGCTTGG - Intronic
911985166 1:104613827-104613849 TGCCATAAACAATGTGTGCTTGG - Intergenic
915632268 1:157161630-157161652 GGCCTTAATCCCAGTATGCTTGG + Intergenic
915715544 1:157941287-157941309 TGCCACCACCTCACTGTGCTGGG - Intergenic
917394808 1:174581940-174581962 TGCCATTACCACAGTGGGGTAGG + Intronic
920348271 1:205320904-205320926 TGCCAGAGCTCCAGTGTGCTGGG + Intronic
920986800 1:210898276-210898298 TGACAGATCCCCAGTGTGGTGGG - Intronic
922757437 1:228104315-228104337 TACCAGAACCTCAGCGTGCTGGG + Intronic
924606633 1:245540971-245540993 TGCCATTTGCCCAGTGTGCGAGG + Intronic
1062878919 10:962843-962865 TGCCGTAGCCTCAGTGAGCTCGG + Intergenic
1070799035 10:79234224-79234246 TGCCAGGACACCAGTCTGCTGGG + Intronic
1076508711 10:130997387-130997409 TTCCATAAACGGAGTGTGCTTGG - Intergenic
1076919204 10:133442511-133442533 TGCCATCTCCCCGGTGAGCTGGG + Intergenic
1078662360 11:13297653-13297675 TGCCCTTTCCCAAGTGTGCTAGG + Intronic
1079734430 11:23977995-23978017 TGCCTTCACCCCAAAGTGCTGGG + Intergenic
1084971072 11:72772326-72772348 TGCCATAGCCACAGTGGGCACGG + Intronic
1085326710 11:75611974-75611996 TGCCAGAGCTGCAGTGTGCTCGG + Intronic
1090653547 11:128825874-128825896 TACCATCAGCCCAGTGTGCATGG + Intergenic
1090701912 11:129304078-129304100 AGCCCTTGCCCCAGTGTGCTGGG + Intergenic
1091892333 12:4069451-4069473 TGATAAAACCCCAGTGTGTTTGG + Intergenic
1092410473 12:8249093-8249115 TGCAATAATCACAGTGTTCTGGG + Intergenic
1097599541 12:61673586-61673608 TCCCATAATCCCCGTGTGTTTGG - Intergenic
1103338890 12:120210725-120210747 TGGCAGAAGCCGAGTGTGCTGGG - Exonic
1104031700 12:125069447-125069469 TGCCATAACCACAGGTTGGTTGG + Intronic
1108091273 13:46852464-46852486 TGCCTTAGCCCCTGTGTGTTTGG + Intronic
1109835531 13:67851618-67851640 TGCCATTTACCAAGTGTGCTAGG - Intergenic
1110469887 13:75847533-75847555 TGACATGACCCAAGTGTGCATGG - Intronic
1111649845 13:91075646-91075668 TTCCATAACCTGAGTATGCTTGG + Intergenic
1111813050 13:93115864-93115886 TGCTATAATCTCAGTGAGCTGGG - Intergenic
1113780947 13:112977025-112977047 TGCCACAACCCAGGTGTGCACGG + Intronic
1113922332 13:113920093-113920115 TGCCATGCCCTGAGTGTGCTGGG + Intergenic
1121250674 14:92497392-92497414 TCCCAAAATCCCAGTCTGCTTGG - Exonic
1121538422 14:94707221-94707243 TGCCCCAACCCCAGTGTCCTGGG + Intergenic
1122790271 14:104181441-104181463 TGTCTTGACCCCAGTTTGCTGGG + Intergenic
1124619528 15:31265860-31265882 TGCCTTCACACCTGTGTGCTCGG - Intergenic
1129572217 15:76700132-76700154 TGCCATCAGACCAGAGTGCTCGG + Intronic
1129694260 15:77731636-77731658 TGCCACCATCCCAATGTGCTAGG + Intronic
1132673587 16:1112621-1112643 AGCCCTAACCCCAGTGTGAGGGG + Intergenic
1135651626 16:24211418-24211440 TATCACAACCCCAGTGTGATAGG + Intronic
1137845627 16:51684980-51685002 TGAAATTACCCCAGTGTGGTGGG + Intergenic
1138339274 16:56278237-56278259 TGCCATAACGGAACTGTGCTTGG - Intronic
1142160290 16:88554095-88554117 TGTGAAAACCCCAGTGTGCCTGG + Intergenic
1142220925 16:88854569-88854591 TGCCCCTCCCCCAGTGTGCTTGG + Intronic
1145267166 17:21385468-21385490 TGCCATCACCCCGGCCTGCTGGG + Intronic
1148318641 17:46728479-46728501 TGCCATAATCCCACTGTACTCGG - Intronic
1150894983 17:69199087-69199109 TGCCATATCCCCTGTGTGGAAGG + Intronic
1152142155 17:78542972-78542994 GGCCATACCCACATTGTGCTGGG + Intronic
1155141230 18:23046455-23046477 TGTCATGAGCCCAGTGTGATGGG - Intergenic
1160225077 18:77006116-77006138 TTCCTAAACGCCAGTGTGCTGGG + Intronic
1162135415 19:8552183-8552205 TGTCAGCACCCCAGTGTCCTGGG + Intronic
1163356923 19:16819174-16819196 AGCGATCCCCCCAGTGTGCTGGG + Intergenic
1164180240 19:22811953-22811975 TGCCATGTCACCTGTGTGCTGGG - Intergenic
1166439788 19:42803072-42803094 TGCCTTAGCCCCAAAGTGCTGGG + Intronic
1166457834 19:42958614-42958636 TGCCTTAGCCCCAAAGTGCTGGG + Intronic
1166468316 19:43054607-43054629 TGCCTTAACCCCAAAGTGCTGGG + Intronic
1166474775 19:43113836-43113858 TGCCTTAGCCCCAAAGTGCTGGG + Intronic
925964861 2:9055130-9055152 TGACATAACCCCTATGTACTTGG + Intergenic
926544823 2:14226597-14226619 TGGCATATCTCCAGTGTGGTAGG + Intergenic
930270530 2:49251197-49251219 TGCCATATCCCCATTTTGCAGGG - Intergenic
930680217 2:54249690-54249712 TGCCATGGCCTCAGAGTGCTGGG - Intronic
935090836 2:99893410-99893432 AGCCCTAACCCCAGTGTGATGGG + Intronic
941154640 2:161960766-161960788 TGCCATAAATCAAGGGTGCTAGG + Intronic
943659477 2:190543118-190543140 TGCCTTAAGCCCAGTTTGCCTGG + Intergenic
946336161 2:219038074-219038096 TCCCAGCACTCCAGTGTGCTTGG + Intronic
1171023708 20:21609751-21609773 TGCCATGACCACAGTGGGTTGGG + Intergenic
1173123496 20:40315751-40315773 TGCCACCACCCAGGTGTGCTAGG + Intergenic
1173197105 20:40924493-40924515 TGCTGTAATCCCAGAGTGCTGGG - Intergenic
1173937945 20:46884009-46884031 TGCCAAAACCCCAGTTGGTTTGG - Intergenic
1175052874 20:56171196-56171218 TGCCATCACCCAAGTGTCCCTGG + Intergenic
1175813575 20:61872135-61872157 TGCCAGAAGCCCAGGGTGCGGGG - Intronic
1175997362 20:62817660-62817682 AGCCAGAACCCCAGAGCGCTCGG - Intronic
1176375384 21:6084543-6084565 TGCCCTGACCCCAGTGTGGGAGG + Intergenic
1179748090 21:43453701-43453723 TGCCCTGACCCCAGTGTGGGAGG - Intergenic
1182059832 22:27388861-27388883 TGCTATACCCCCACTGTGATGGG - Intergenic
1183947582 22:41335435-41335457 TGCCATCACCCCAGCCTGCCAGG - Intronic
1184379661 22:44137394-44137416 TGCCAAAGGCCCACTGTGCTGGG - Intronic
951929799 3:27952461-27952483 TGCCCTAACCCCAGGATGCACGG - Intergenic
955346532 3:58165758-58165780 TCCAGGAACCCCAGTGTGCTCGG + Intronic
958661110 3:97068687-97068709 AACCCTAACCCCAGTGTGATAGG + Intronic
960572654 3:119200310-119200332 GGCCATAATCCCAGTGTTTTGGG - Intronic
960588743 3:119345384-119345406 TGCCATAACCCCAGTGTGCTGGG - Intronic
961003948 3:123391983-123392005 TGCCAGAGTCCCAGTGTGATGGG - Intronic
962930113 3:140028163-140028185 TGCTATTCCCCCAATGTGCTAGG - Intronic
964217664 3:154305310-154305332 TCCCATTACCCCATTGTGGTAGG - Intronic
968623655 4:1615998-1616020 TGTCATCACCCCTGGGTGCTGGG + Intergenic
968713193 4:2135731-2135753 ATCCACACCCCCAGTGTGCTGGG - Intronic
969488568 4:7485939-7485961 TGCCCTAAACCCAGCGGGCTGGG + Intronic
969631550 4:8341641-8341663 TGCCCTAACCCCTGTGTGCCTGG + Intergenic
970113778 4:12669846-12669868 TGCCATAACCACAGTGCAGTTGG + Intergenic
974718950 4:65711413-65711435 AACCATAACCCTAATGTGCTGGG + Intergenic
979899020 4:126194054-126194076 TGATATAAGCCCAGTGTGGTGGG - Intergenic
985236458 4:187880648-187880670 TGCCAAAACCCCCGTGAGCTTGG - Intergenic
985667265 5:1187625-1187647 TGCCTTCAGCCCAGTGTGGTGGG - Intergenic
1001261376 5:170232789-170232811 TTCCTTACCCCCAGTGTGCCAGG - Exonic
1003961121 6:11210533-11210555 CGCCTGATCCCCAGTGTGCTGGG + Intronic
1004583352 6:16975768-16975790 TGGCAGAATCCCAGTGGGCTGGG - Intergenic
1008875981 6:56328411-56328433 TGCCATACCACTAGTGTGATGGG - Intronic
1011026642 6:82876573-82876595 TACTATAAGCCAAGTGTGCTGGG + Intergenic
1013283372 6:108659699-108659721 GGCCATAACCACAGGGTGTTCGG - Intronic
1014767964 6:125428861-125428883 TGCCAGCACTCCAGTGTGCCAGG + Intergenic
1015208197 6:130666059-130666081 CACCTTAACCCCAGTGTCCTGGG - Intergenic
1016857392 6:148684596-148684618 TCCCTTAACCCCAGGGTCCTTGG - Intergenic
1018178451 6:161199525-161199547 GGCCATAACCCCAGGCAGCTTGG - Intronic
1027445463 7:78268578-78268600 TGCCATACCCCTAGTGGGTTTGG + Intronic
1030114918 7:106055740-106055762 TGCAATACCCCCAGAGTTCTTGG + Intergenic
1031964401 7:128017301-128017323 TATCATCACCCCAGAGTGCTTGG + Intronic
1035099404 7:156384051-156384073 TCCCACAACCCCAGTGGTCTGGG + Intergenic
1036696221 8:10976869-10976891 TGCCTGAGCCCCAGTGGGCTGGG + Intronic
1037441581 8:18921758-18921780 GGCCATAAGCCCAGTGTTCACGG + Intronic
1038016750 8:23522088-23522110 TGAGATCACCCCACTGTGCTGGG + Intergenic
1038981294 8:32762345-32762367 TGACATTTCCCCACTGTGCTGGG + Intronic
1040581694 8:48703848-48703870 TGCCATCACCACAGTTTGCTAGG - Intergenic
1041399200 8:57423538-57423560 TGACATAACCCCTGTGTCCTTGG - Intergenic
1049180443 8:141219454-141219476 TGCCTTGGCCCCACTGTGCTTGG + Intronic
1050010334 9:1179446-1179468 TGGCTTAACCCCAGAGTGGTTGG - Intergenic
1051627995 9:19116512-19116534 TGCCATCACCCCCATGTGCTTGG + Exonic
1052447359 9:28580352-28580374 TGCCTTAAAACCACTGTGCTGGG - Intronic
1055590790 9:77811747-77811769 TGCCTTAATCCCACTGTGCCAGG - Intronic
1055686009 9:78775500-78775522 TGCCATCACCCTAATGTGCAGGG - Intergenic
1059231647 9:112726281-112726303 CACCATAAGCCCAGAGTGCTAGG - Intergenic
1059798620 9:117727355-117727377 TTCCACTACCCCAGTGTACTGGG - Intergenic
1061414075 9:130436525-130436547 TGGCCTATCTCCAGTGTGCTGGG + Intergenic
1186184365 X:7005656-7005678 TGCCTTAGCCCCAAAGTGCTGGG + Intergenic
1187127970 X:16471487-16471509 TCCCTTAACATCAGTGTGCTGGG - Intergenic
1190915968 X:54811360-54811382 TGCCCTTACACCATTGTGCTGGG + Intronic
1192853531 X:74982647-74982669 TGCAAGAACCACAGTGTGATAGG + Intergenic
1193821538 X:86171278-86171300 TCCCATAACCCCAGGCTGCATGG - Intronic
1195689928 X:107616133-107616155 TGCAAGAAGCCCACTGTGCTAGG + Intergenic
1197558980 X:127993376-127993398 TGCAAGAACCACAGTGTTCTTGG + Intergenic
1202251512 Y:22878230-22878252 AGCCACAACCCCAGAGTGCTGGG + Intergenic
1202404500 Y:24511979-24512001 AGCCACAACCCCAGAGTGCTGGG + Intergenic
1202466279 Y:25158103-25158125 AGCCACAACCCCAGAGTGCTGGG - Intergenic