ID: 960590364

View in Genome Browser
Species Human (GRCh38)
Location 3:119359948-119359970
Sequence TAATGATACTTGAGGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 230}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960590364_960590368 -8 Left 960590364 3:119359948-119359970 CCCTCTTCCCTCAAGTATCATTA 0: 1
1: 0
2: 3
3: 16
4: 230
Right 960590368 3:119359963-119359985 TATCATTATTCTTTGCCCACCGG 0: 1
1: 0
2: 0
3: 15
4: 179
960590364_960590369 2 Left 960590364 3:119359948-119359970 CCCTCTTCCCTCAAGTATCATTA 0: 1
1: 0
2: 3
3: 16
4: 230
Right 960590369 3:119359973-119359995 CTTTGCCCACCGGCAGCTCTTGG 0: 1
1: 0
2: 1
3: 13
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960590364 Original CRISPR TAATGATACTTGAGGGAAGA GGG (reversed) Intronic
900867835 1:5281089-5281111 AAAGGATGCTGGAGGGAAGATGG + Intergenic
905512472 1:38533037-38533059 TAATGAAAATAGAGGGAAGTAGG + Intergenic
906285768 1:44586841-44586863 TTCTGAAAATTGAGGGAAGATGG + Intronic
906884385 1:49628819-49628841 TATTTATATTTGAGAGAAGAGGG - Intronic
907580680 1:55569832-55569854 TACTGCTACCTGAAGGAAGAGGG - Intergenic
910491664 1:87779306-87779328 AAAGGATAGATGAGGGAAGAAGG - Intergenic
911600597 1:99844324-99844346 TAATTATCCTTAAAGGAAGAAGG + Intergenic
914081875 1:144417502-144417524 TAATGTCACTTGATGGCAGACGG + Intergenic
914099228 1:144569331-144569353 TAATGTCACTTGATGGCAGACGG - Intergenic
914176783 1:145286006-145286028 TAATGTCACTTGATGGCAGACGG + Intergenic
914299757 1:146368341-146368363 TAATGTCACTTGATGGCAGATGG + Intergenic
914531510 1:148527497-148527519 TAATGTCACTTGATGGCAGACGG + Intergenic
914636881 1:149560227-149560249 TAATGTCACTTGATGGCAGACGG - Intergenic
915811861 1:158921296-158921318 AAATGAGAGCTGAGGGAAGAAGG - Intergenic
919678930 1:200414504-200414526 TAACAATTATTGAGGGAAGAGGG - Intergenic
919941506 1:202289901-202289923 TAAGGGTACATGAGGGAATATGG - Intronic
921422249 1:214961817-214961839 TAATGAGACTTCAGGGACAAGGG - Intergenic
924014192 1:239702102-239702124 TAATGCTATTTGAGGAAAAACGG - Intronic
924056559 1:240129879-240129901 TAATTATATTAGAAGGAAGAAGG - Intronic
924638062 1:245807503-245807525 CAATGCTACTTGAGGGAAGCAGG + Intronic
1062989422 10:1802068-1802090 AAATGGTACCTGAGGGAAAAAGG + Intergenic
1064088949 10:12367103-12367125 TAATTATACTTGTGAGAAAAAGG + Intronic
1065522947 10:26589625-26589647 GAATGATACTCGGGGGAAAACGG - Intergenic
1066104275 10:32143357-32143379 AAAAAATACTTGATGGAAGAAGG + Intergenic
1068690754 10:59911411-59911433 TAATGATTCTTGTTGGAAGAAGG + Intergenic
1069071547 10:63994894-63994916 TCATGCTAAATGAGGGAAGATGG - Intergenic
1071595797 10:86923073-86923095 TAATTATACTTTAGGGTAAATGG + Intronic
1072167059 10:92823898-92823920 TAAAGATACTAGAGAGAAGACGG + Intergenic
1072226340 10:93373375-93373397 AAATGATGCTTGAGATAAGATGG - Intronic
1072400018 10:95087984-95088006 TAAAAATACTGGAGGGAAGGTGG - Intergenic
1073449063 10:103598835-103598857 TATTAATACTTGAAGCAAGAAGG - Exonic
1073502662 10:103955519-103955541 TCATGGAACTTGAGGGTAGAAGG + Intergenic
1079703135 11:23574437-23574459 TAATGATAGCTGAGAGCAGATGG + Intergenic
1080918142 11:36680956-36680978 TACTTATATTTGAGGGAAGATGG + Intergenic
1081711814 11:45221698-45221720 TGAAGATACAGGAGGGAAGAGGG + Intronic
1084414987 11:69026719-69026741 TATTGATATTTGAGGCCAGATGG - Intergenic
1085754183 11:79190562-79190584 TGATGCTTCTTGAGGGAATAGGG - Intronic
1087323722 11:96695973-96695995 TCATGATACATGAGGGCAGAAGG + Intergenic
1088409397 11:109516813-109516835 TGATGATGCATGAGAGAAGAGGG - Intergenic
1089202477 11:116732749-116732771 TAGTCACACCTGAGGGAAGAGGG + Intergenic
1089527284 11:119105833-119105855 GAAGGATTCTTGGGGGAAGAGGG + Intronic
1090033440 11:123227718-123227740 TAACTTTACTTAAGGGAAGAAGG + Intergenic
1090368908 11:126232959-126232981 TTATTACACTTAAGGGAAGATGG + Intronic
1092934029 12:13343324-13343346 TAATGAAACGTGAGCGAACATGG - Intergenic
1095459019 12:42421898-42421920 TAATTTTACTTTAAGGAAGATGG + Intronic
1096417532 12:51426578-51426600 AAATGTTAACTGAGGGAAGAGGG + Intronic
1098097862 12:66979260-66979282 TAATGGTACTTGCAGGATGACGG - Intergenic
1099228857 12:80000328-80000350 TAGTGGTACTTGATGGAAAAGGG - Intergenic
1100526784 12:95427036-95427058 TAATGATCCTTGAGGGATGATGG - Intergenic
1103059891 12:117850093-117850115 TTATTATTTTTGAGGGAAGAAGG + Intronic
1104723554 12:131060706-131060728 TACTGATACGTGAGGGAAGATGG - Intronic
1106175235 13:27324672-27324694 TAATAATTATTGAAGGAAGAGGG - Intergenic
1106326609 13:28697049-28697071 TAATGATACTTTATGGTAAAAGG - Intergenic
1107006785 13:35620837-35620859 TAGAGATACCTGAGGGAAAATGG - Intronic
1107125416 13:36840513-36840535 TACTGATACTAGAGGGAGGCAGG - Intergenic
1108086430 13:46797686-46797708 TAATTTTTATTGAGGGAAGAAGG - Intergenic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1111892375 13:94099949-94099971 TGCAGATACTTGAGGGTAGAGGG + Intronic
1113305213 13:109070227-109070249 CAATGAGACTTATGGGAAGATGG - Intronic
1114539520 14:23444295-23444317 TAGGGATACTAGAGGCAAGAGGG - Intergenic
1114799836 14:25761031-25761053 TAATGAAACTTGGTGCAAGATGG + Intergenic
1115182926 14:30650911-30650933 TAATGATAATTGAAAGAAAATGG - Intronic
1115964026 14:38866622-38866644 AAATGATACTAGAGGAAAGGAGG - Intergenic
1116607531 14:47020494-47020516 TATTGCTCCTTGAGTGAAGATGG - Intronic
1116851162 14:49910814-49910836 TTATTAAACTAGAGGGAAGAAGG - Intergenic
1117484895 14:56186111-56186133 TCATGAGATGTGAGGGAAGAAGG + Intronic
1119314150 14:73677410-73677432 TCAGGAGACTTGAGGCAAGAGGG - Intronic
1119888312 14:78163044-78163066 TAATGTTTCTTAAAGGAAGAAGG - Intergenic
1120281729 14:82447294-82447316 CAAAGATACCTGAGGCAAGAGGG + Intergenic
1120437546 14:84499661-84499683 TAATTCTACTTGAGTAAAGAGGG + Intergenic
1120541972 14:85762027-85762049 TAAGGATACATGAGGGAGGATGG - Intergenic
1120814058 14:88834949-88834971 TAATGATACAAAAGGGAACAAGG + Intronic
1125061060 15:35424835-35424857 TAATCCTGCTTGAGTGAAGATGG + Intronic
1125509704 15:40286371-40286393 TGGTGACACTTGAGGAAAGAAGG - Intronic
1125822884 15:42648760-42648782 TAATGGTAGTGGAGGGAAGGGGG - Intronic
1126430424 15:48577678-48577700 TAAAGAAACTTCAGGGAAGGCGG - Intronic
1127211276 15:56777246-56777268 TAATGCTAATGGAGGGAGGATGG - Intronic
1128206322 15:65855836-65855858 TAATGCTACTTGAGGAAAGAAGG + Intronic
1129094370 15:73187752-73187774 TAAGGATATTCAAGGGAAGATGG - Intronic
1130534461 15:84773654-84773676 TCATAATACTAGAGAGAAGAGGG - Intronic
1130896226 15:88172377-88172399 TAATGAAGCCTTAGGGAAGAGGG + Intronic
1131040464 15:89260830-89260852 TACTGATGCTGGAGGTAAGATGG + Exonic
1131948475 15:97653447-97653469 TAATAATAATTGTGGGAAGGGGG - Intergenic
1133427383 16:5704588-5704610 TAAAATAACTTGAGGGAAGAGGG - Intergenic
1135120486 16:19762029-19762051 AAATGAAACTTCAAGGAAGAAGG + Intronic
1137401893 16:48160561-48160583 TATTGATATGTGAGGGGAGAAGG + Intergenic
1137405564 16:48186349-48186371 TAATTATACGTGATTGAAGAAGG - Intronic
1138234668 16:55371895-55371917 TAACAATACATGATGGAAGATGG + Intergenic
1147482168 17:40776451-40776473 TAGTGATATTTGAAGGTAGAAGG - Intergenic
1153095279 18:1394430-1394452 CAATGATACTTGATGAAACATGG + Intergenic
1153196071 18:2597805-2597827 GAATGAAACTTGATGAAAGAGGG + Intronic
1154051551 18:10964539-10964561 TAATGAGACTTTAGTGAATACGG + Intronic
1155614909 18:27710860-27710882 TTATGATACGTGAGGGAAAGAGG + Intergenic
1155781299 18:29839235-29839257 TAAGGATACTTTACGTAAGATGG - Intergenic
1155782306 18:29851659-29851681 TAGTGAAACTTGAGGGCAAAGGG + Intergenic
1156164649 18:34403627-34403649 TAGTGACTCTTGAGGGAAGAAGG - Intergenic
1157102109 18:44740448-44740470 TAATAATTCTTGAGGCAAGTTGG - Intronic
1158650987 18:59285594-59285616 TATGGAGACTTCAGGGAAGAAGG - Intronic
1160136730 18:76278194-76278216 TAATGAGATATGACGGAAGAAGG - Intergenic
1161828740 19:6587696-6587718 TAAAGATCCTAGAGAGAAGAGGG - Intronic
1163325810 19:16602388-16602410 TCATGACAGTTGAGGGGAGAGGG - Intronic
1164647473 19:29870208-29870230 CAATGATTCTTGAGGGGAGCAGG - Intergenic
1168463461 19:56582227-56582249 TAATGATAATTTAAGGAGGATGG + Exonic
925726236 2:6875295-6875317 TAGTTTTGCTTGAGGGAAGAGGG - Intronic
928800584 2:35085879-35085901 AAATGAATCTTGAAGGAAGAGGG - Intergenic
929682385 2:44004603-44004625 GAATCATATTTGAGGGATGAGGG + Intergenic
931057946 2:58493879-58493901 TGATGTTTCTTGAGAGAAGAGGG + Intergenic
931669995 2:64638542-64638564 TCATGAGACATGAGGTAAGACGG - Intronic
934503618 2:94876254-94876276 TCCTGATACTTGATGGAAGGAGG - Intronic
935608565 2:104996398-104996420 TAATGATACTTAAAAGAAAATGG + Intergenic
937208307 2:120251145-120251167 GTATGATAGTTGAGGGAACAGGG - Intronic
937873119 2:126800407-126800429 TAATGTTATTTTAGGGATGATGG - Intergenic
938617112 2:133010885-133010907 CAAGGATACTTGAGGGGAAAGGG + Intronic
938700031 2:133868290-133868312 TGAGGCTAGTTGAGGGAAGATGG + Intergenic
939722685 2:145674665-145674687 TAATGATGTTTAAGGAAAGAAGG - Intergenic
940479413 2:154209385-154209407 TCATGATATTTCAGGGAATAGGG + Intronic
940671544 2:156675532-156675554 TAATAGTGCTTGAAGGAAGAAGG + Intergenic
941183999 2:162298540-162298562 TTATGAAACTGGAGGGAAGGTGG - Intronic
943842377 2:192599181-192599203 CCATGATCCTGGAGGGAAGAGGG - Intergenic
944415569 2:199476066-199476088 TAATAGTAATTGTGGGAAGATGG - Intergenic
945769121 2:214017660-214017682 TCCTGATACTTCAGGGAATAAGG - Intronic
946259407 2:218473355-218473377 TAATGATACTTGTATCAAGAAGG + Intronic
946510344 2:220349094-220349116 AAATTATACTTGTGGCAAGATGG + Intergenic
947809225 2:232990589-232990611 TAATGATATTTGGGAGAAGAAGG - Intronic
948348226 2:237317087-237317109 CAATGATATTTAAAGGAAGAAGG - Intergenic
1169558448 20:6773178-6773200 TAATTATATTTGTGGAAAGAGGG - Intronic
1173040678 20:39459630-39459652 TAATGATAGGTGAGGACAGATGG + Intergenic
1175354632 20:58354712-58354734 TGATGATACTCGATGGGAGAGGG + Intronic
1176933680 21:14842507-14842529 AAATGATACTGAAGGGGAGAGGG - Intergenic
1177654054 21:23994270-23994292 TACTGATAGATGTGGGAAGAAGG - Intergenic
1178964366 21:37102318-37102340 TAATTATAATTGAGGAAAAAAGG + Intronic
1182869239 22:33631753-33631775 TAATAATACTAGAGAGAAAATGG - Intronic
1183133425 22:35862607-35862629 TAGGGATACTTTAAGGAAGAAGG - Intronic
949932973 3:9094094-9094116 GAATTATAATTGAGGAAAGAGGG - Intronic
950057691 3:10040426-10040448 TAATGAAACTTAAGGGATCATGG - Intronic
951253294 3:20419074-20419096 AGATGACACTTGAGGCAAGATGG + Intergenic
951662885 3:25089793-25089815 GAATGATACTAGAGTCAAGATGG + Intergenic
951911264 3:27753148-27753170 AAATGCTACATGAGGCAAGATGG + Intergenic
955390727 3:58520595-58520617 AACTGCAACTTGAGGGAAGAGGG - Intronic
960376244 3:116905087-116905109 TAATCATATCTGAGGTAAGATGG + Intronic
960543238 3:118883631-118883653 AAAAGATACTTTGGGGAAGATGG + Intergenic
960590364 3:119359948-119359970 TAATGATACTTGAGGGAAGAGGG - Intronic
960745939 3:120888694-120888716 TGAGGATAGATGAGGGAAGATGG + Intergenic
961918981 3:130406181-130406203 TTATGATACTTGAAGAAATATGG - Intronic
964194672 3:154048728-154048750 TAATAATAGATGAAGGAAGAAGG + Intergenic
964408796 3:156377490-156377512 TAAGGATACTTCAGAGGAGAGGG + Intronic
965814856 3:172625800-172625822 CAATGGCACTTCAGGGAAGAAGG + Intergenic
970687804 4:18588387-18588409 TAATAATACTTGAAGAATGATGG - Intergenic
971310109 4:25518428-25518450 TAATGTCAGGTGAGGGAAGAGGG - Intergenic
971752865 4:30673958-30673980 TAATGTTACTTGAGTAAAAAAGG - Intergenic
971907777 4:32749782-32749804 ATAAGATACTTGAGGGATGAGGG + Intergenic
976584483 4:86779737-86779759 TGCTGATAATTGAGAGAAGAGGG - Intronic
976662766 4:87557275-87557297 TAATGGAACTTGAAAGAAGAAGG + Intergenic
979001406 4:115225508-115225530 TAGAGATATTTGAGGAAAGATGG + Intergenic
979187165 4:117811351-117811373 GAATGAGCCTTGAGGGAACAGGG - Intergenic
979304312 4:119124864-119124886 GAAGGAAATTTGAGGGAAGAGGG + Intergenic
982620601 4:157699046-157699068 GAAAGATACTTGGGTGAAGAGGG - Intergenic
983521371 4:168712399-168712421 CAATGAAACTGGAGGGAAGCAGG + Intronic
984424513 4:179565750-179565772 TAATTATAACTGAGGGATGAGGG - Intergenic
985015061 4:185624943-185624965 TAATGATACATAGGTGAAGAAGG + Intronic
985083056 4:186286115-186286137 TAAAGATAATTTAGGGATGAAGG + Intronic
986418286 5:7550341-7550363 TAATGATACTTCTGGGGACAGGG - Intronic
986875366 5:12100967-12100989 TAAAGGTACTTGTGGGAAAAAGG + Intergenic
989061840 5:37417100-37417122 TGAGGATACTTTAAGGAAGATGG + Intronic
990257623 5:53987577-53987599 TAATGATTCTTTAAAGAAGAAGG + Intronic
990268999 5:54114528-54114550 TAATGAAAATTGAGGGAATGAGG + Intronic
992408303 5:76480387-76480409 AAATGATAATTGAGGGAGAAAGG - Intronic
992467419 5:77020704-77020726 TAATGATAGTGGAAAGAAGAGGG - Intergenic
993189290 5:84660809-84660831 TAATGGTATTTGAGGGCTGAGGG - Intergenic
993715024 5:91267878-91267900 TAAAGATACTTGAGAGTAGAGGG + Intergenic
994531733 5:100981601-100981623 TATTGATACTGGAGGGGAGCAGG + Intergenic
994654284 5:102570394-102570416 AAAAGATACTTGAGAGAAAATGG - Intergenic
995446031 5:112244900-112244922 TAATGATACAGGAGCTAAGAAGG - Intronic
997231288 5:132245220-132245242 CATTGTTACTTGAGGGAATAGGG - Intronic
997336905 5:133114971-133114993 TCATGATACAGGAGGGAGGAGGG + Intergenic
998228983 5:140347198-140347220 TAATGTCCCCTGAGGGAAGATGG - Intergenic
999145670 5:149391648-149391670 GAATGACACTTGAGAGATGAAGG - Intronic
1000251310 5:159498122-159498144 TAATGATAGTTCTGTGAAGAAGG + Intergenic
1000908684 5:166994946-166994968 TATTGATCCTTGAGTGAAGGTGG + Intergenic
1001463402 5:171939311-171939333 TAATCATACTTAATGGAAGAGGG + Intronic
1003203719 6:3988114-3988136 CAAAGATCCTTGAGGGAAAAAGG + Intergenic
1004210534 6:13637564-13637586 TAACTTTACTAGAGGGAAGAAGG + Intronic
1004460572 6:15831994-15832016 TAATAAGCCTTGAGGGAACAAGG - Intergenic
1005130559 6:22502777-22502799 TAATTATACATGAGGTATGAAGG + Intergenic
1005152776 6:22771950-22771972 TGATGAAACTTAAGGAAAGAAGG + Intergenic
1005817232 6:29563540-29563562 TACTGAAACTAGAGGCAAGAGGG + Intronic
1008824374 6:55675014-55675036 TACTGATACATGCTGGAAGAAGG + Intergenic
1009609207 6:65917366-65917388 AAATCATTCCTGAGGGAAGATGG + Intergenic
1009650424 6:66469889-66469911 TAATCATAGTTGAGGGAAAATGG - Intergenic
1009837422 6:69020511-69020533 TAATAACATTTAAGGGAAGAAGG - Intronic
1010864499 6:80957923-80957945 TAATGATACTTTACAAAAGAAGG + Intergenic
1012740501 6:103010396-103010418 TAATGTTACTTTACAGAAGAAGG + Intergenic
1013771616 6:113634239-113634261 TAAAGACACTTGAGGGAAAATGG - Intergenic
1013860141 6:114625808-114625830 TGATGAGACTTCAGGGCAGAGGG - Intergenic
1016508297 6:144810192-144810214 TTATGACCCTTTAGGGAAGAAGG + Intronic
1017147658 6:151249136-151249158 AAATGATAAATAAGGGAAGAGGG - Intronic
1017179286 6:151535017-151535039 TAATAATTCTTGAAGGAAGCAGG + Intronic
1017317126 6:153044344-153044366 TAATCATTCTTGAGTAAAGAAGG - Intronic
1018848021 6:167568581-167568603 CAAAGATACTTGAGTAAAGACGG - Intergenic
1022776859 7:33535756-33535778 AAAGGAGACTTGAGGGAAAAGGG + Intronic
1022779322 7:33562475-33562497 TAATTAAATTTGGGGGAAGAAGG - Intronic
1023175254 7:37429800-37429822 GAATGGAACTAGAGGGAAGAGGG + Intronic
1024394882 7:48854767-48854789 TAATGAGAGGTGGGGGAAGAAGG + Intergenic
1024435107 7:49342770-49342792 TAATGCTAATTAAGGAAAGAAGG - Intergenic
1027746645 7:82082851-82082873 AAATGCTAATTGAGGGATGATGG - Intronic
1028482741 7:91325493-91325515 AAATCATATTAGAGGGAAGAGGG - Intergenic
1031492863 7:122410540-122410562 TGATGATACTTGAGTGATAACGG + Intronic
1031964640 7:128018851-128018873 CAATGTTAGTTGAGGGTAGAGGG - Intronic
1033970503 7:147033775-147033797 TAATCACAATTGAGTGAAGAGGG + Intronic
1035785845 8:2260256-2260278 TATTAATAATTGAGGAAAGATGG - Intergenic
1035806962 8:2461460-2461482 TATTAATAATTGAGGAAAGATGG + Intergenic
1035884414 8:3276883-3276905 TTAAGTTACTTGAGGGCAGATGG - Intronic
1036409226 8:8483423-8483445 TAATGTTACCTCTGGGAAGAAGG + Intergenic
1038131969 8:24742532-24742554 TAAGGATAAATGAGGGAACAAGG + Intergenic
1038180696 8:25224613-25224635 TAGTTATGGTTGAGGGAAGATGG + Intronic
1038804746 8:30779932-30779954 TAATGCCACTTGATGGCAGATGG + Intronic
1039106559 8:33996072-33996094 TGATGATGCTTGAGGGAGGGAGG + Intergenic
1040664327 8:49614368-49614390 TAAAACTACTTGAGCGAAGAGGG + Intergenic
1041495055 8:58476979-58477001 TAATAATAATTGAGTGAGGAGGG - Intergenic
1041583311 8:59487424-59487446 ACATGATACTTCAGTGAAGATGG + Intergenic
1042679746 8:71369729-71369751 CAAGGCTACTTGAGGGAACATGG + Intergenic
1046276466 8:111966988-111967010 GAAACATACTTGTGGGAAGAAGG - Intergenic
1046676388 8:117113407-117113429 TAATAATACATGAGGGAGGAAGG - Intronic
1046808750 8:118509067-118509089 TACTGAACCTTAAGGGAAGAAGG - Intronic
1047029728 8:120863147-120863169 TAATGATAACTGAGTGAAGGGGG + Intergenic
1048955385 8:139531739-139531761 TCTGGATACTTGAGGTAAGAAGG + Intergenic
1049028710 8:140016057-140016079 TACTAATTCTTGAGGAAAGAAGG - Intronic
1049937761 9:516059-516081 CAATAATATTTAAGGGAAGATGG - Intronic
1050266514 9:3896342-3896364 AAATCATACCTGAGGGAAGGAGG + Intronic
1050862502 9:10452263-10452285 GAATGATGCTTCAGGGAACATGG + Intronic
1050902263 9:10963524-10963546 TAATAATACTCGAAGGCAGAGGG - Intergenic
1051943827 9:22541700-22541722 TAATGTTACTTTATGGAAGAGGG - Intergenic
1056090143 9:83197283-83197305 TACTGACACTTGAGGAAGGAGGG - Intergenic
1056119861 9:83476927-83476949 TTATGATCCTTGAGGGCAGGTGG + Intronic
1057846175 9:98526407-98526429 TAAGGAGACCTGAGAGAAGAGGG - Intronic
1058254794 9:102748554-102748576 TAATGCTCCTTGAGAGATGAGGG - Intergenic
1060096071 9:120791865-120791887 TATTGATACTGAAGGCAAGAGGG - Intronic
1060379724 9:123156336-123156358 TAATATTACTTGAGGAATGAAGG - Intronic
1187073579 X:15912248-15912270 TAGTGATAGTAGAGGGAACAGGG + Intergenic
1188705634 X:33326115-33326137 TAGTAATATTAGAGGGAAGAAGG + Intronic
1188747423 X:33863377-33863399 TCATGATTCTGGAGGGTAGAAGG + Intergenic
1188759364 X:34006960-34006982 AAATGATAGTTGAATGAAGAAGG + Intergenic
1192756775 X:74054927-74054949 TACAGATATTTGAGAGAAGAGGG - Intergenic
1195227774 X:102815876-102815898 TATTCATACCTGAGGGTAGAGGG + Intergenic
1195576523 X:106457956-106457978 TTATGATACTTTAGGGAATAAGG - Intergenic
1197156075 X:123271929-123271951 TAAAGATGCTTTAGGGAAAAAGG + Intronic
1197229226 X:123985536-123985558 TAATGATCCTTTAGGGAGGGAGG + Intronic
1198128427 X:133670437-133670459 TTCTGATACTTAAGGGAAGAAGG - Intronic
1198894464 X:141437528-141437550 TAATGAAAATTAAGTGAAGAGGG + Intergenic
1199804518 X:151284597-151284619 TAAAGATATTTCAGGGAAGGGGG - Intergenic