ID: 960593003

View in Genome Browser
Species Human (GRCh38)
Location 3:119383132-119383154
Sequence TGCAGTCCGGGTCCAGCAGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 122}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960592997_960593003 8 Left 960592997 3:119383101-119383123 CCACTGGTTGCAATGGAGATGCA 0: 1
1: 0
2: 0
3: 13
4: 137
Right 960593003 3:119383132-119383154 TGCAGTCCGGGTCCAGCAGGTGG 0: 1
1: 0
2: 0
3: 9
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960593003 Original CRISPR TGCAGTCCGGGTCCAGCAGG TGG Exonic
900582454 1:3415769-3415791 TGCAGCCCGGAGCCAGGAGGTGG + Intronic
901074679 1:6546355-6546377 TGCAGTCCTGGTCCAGCTACTGG + Intronic
902368803 1:15993090-15993112 AGCTGTCGGGGTGCAGCAGGTGG - Intergenic
905910081 1:41647631-41647653 TGCAGCCTGGCTCCAGCAGGGGG + Intronic
913972031 1:143423204-143423226 GACAGCCCGGGGCCAGCAGGTGG + Intergenic
914066412 1:144248817-144248839 GACAGCCCGGGGCCAGCAGGTGG + Intergenic
914112741 1:144717537-144717559 GACAGCCCGGGGCCAGCAGGTGG - Intergenic
915164498 1:153941122-153941144 TGCAGGCTGGGTCCAGGTGGTGG - Intronic
919887635 1:201946446-201946468 TGCAGTCCTCGACCAGCAGGAGG - Exonic
921395997 1:214670262-214670284 AGGAGTCAGGGTCTAGCAGGAGG - Intergenic
923126815 1:231040374-231040396 TGGCGTCCGCGTCCAGCAGCCGG + Intergenic
1065102028 10:22340783-22340805 GGCAGTGCGGCTCCAGCTGGAGG + Intergenic
1067249802 10:44576643-44576665 CACAGTCAGGGTACAGCAGGTGG + Intergenic
1070250333 10:74767570-74767592 TGCAGTTCGGTACCAGCATGGGG - Intergenic
1070351699 10:75598964-75598986 TGCATTCCTTGTCCATCAGGTGG + Intronic
1071857881 10:89644734-89644756 TGCAGCCGGGGTCCAGTGGGCGG - Exonic
1073102929 10:101016261-101016283 TTCAGTCAGGGTCAAGCATGGGG - Intronic
1077185621 11:1234215-1234237 TGCAGTCCAGGTACACCATGGGG - Exonic
1077307825 11:1875830-1875852 GACAGCCCGGGGCCAGCAGGTGG - Intronic
1077442428 11:2574919-2574941 TGCAGGCAGGCTCCCGCAGGGGG - Intronic
1078488173 11:11743106-11743128 TGCAGGCCAGGGCCAACAGGGGG + Intergenic
1081667766 11:44926603-44926625 TGGAGTCAGAGTCCAGCATGTGG - Intronic
1083450503 11:62741417-62741439 TGCAGTCCTGGCTCAGTAGGAGG + Intergenic
1083626802 11:64076064-64076086 TGCAGGCTGGATCCACCAGGAGG - Intronic
1083951660 11:65959910-65959932 TGCACTCCGGGTCCAGGCTGGGG - Exonic
1084041853 11:66547045-66547067 CCCAGGCCGGGTCCAGCAGCAGG - Intronic
1090967493 11:131611705-131611727 TGCAGCCCAGTTCCAGCACGAGG - Intronic
1091529404 12:1339888-1339910 TGCAGTGACGGTCCAGCAGAAGG + Intronic
1091703656 12:2679752-2679774 TGCCATCCGGGTGCAGGAGGTGG + Exonic
1096181881 12:49555736-49555758 TGCAGCCAGGGGACAGCAGGGGG - Exonic
1098636105 12:72785628-72785650 TGCAGTGTGGCACCAGCAGGTGG + Intergenic
1101978578 12:109384836-109384858 TGCAGTCAGGTTGCTGCAGGTGG - Intronic
1102677024 12:114665893-114665915 CGCAGTCCGGGGACTGCAGGTGG - Intergenic
1103865043 12:124044886-124044908 TGCAGTCGGGGGCGAGCAGAGGG + Intronic
1113530460 13:111020703-111020725 GGCACTCAGGGACCAGCAGGTGG - Intergenic
1113627973 13:111860404-111860426 TGCAGTCTGGGAACAGGAGGGGG + Intergenic
1113760676 13:112844232-112844254 AGCAGTGGGGATCCAGCAGGTGG - Intronic
1117043255 14:51787198-51787220 TGCAGGCCTGGAGCAGCAGGTGG + Intergenic
1118675134 14:68176063-68176085 TGGAGTCCAGGCTCAGCAGGAGG - Intronic
1122126499 14:99581338-99581360 TGCAGGCGGGGTCCAGCATCTGG - Intronic
1122978210 14:105179699-105179721 ATCAGTCGGGGTACAGCAGGTGG - Intronic
1123176198 14:106421614-106421636 TGCAGCTCAGGGCCAGCAGGGGG - Intergenic
1128252080 15:66170810-66170832 TGCAGCCCCTGTCCAGGAGGTGG + Intronic
1128495769 15:68197692-68197714 GGCTGTGCAGGTCCAGCAGGAGG - Intronic
1128830447 15:70763527-70763549 TGCTGCCCGGGGCCCGCAGGTGG - Exonic
1130093413 15:80839468-80839490 TGCAAACCGGGCCCTGCAGGAGG + Intronic
1132500266 16:281849-281871 TGTCGTCCGGGTCCAGCTGCCGG - Exonic
1135590312 16:23700597-23700619 TGCACTCGGGGGCCAGCCGGAGG - Exonic
1137447975 16:48543789-48543811 TGCAGGCCGAGTCCAGTGGGAGG - Intronic
1138895053 16:61193928-61193950 TGCAGTTGGGGTCCAGCATATGG + Intergenic
1142398639 16:89847693-89847715 TGCAGGCCTGGGGCAGCAGGTGG - Intronic
1142401495 16:89860993-89861015 TGCGGTTCGGCCCCAGCAGGCGG - Intronic
1143972201 17:10803876-10803898 GGCCGACCGCGTCCAGCAGGAGG + Intergenic
1150676032 17:67246061-67246083 GCCAGTCCGGGTCCACCTGGCGG + Intergenic
1152252431 17:79219019-79219041 TGGACTGTGGGTCCAGCAGGGGG - Intronic
1154411348 18:14143737-14143759 TGCTGTCAGAGGCCAGCAGGGGG + Intergenic
1156369156 18:36457044-36457066 TCCAGTCAGGTTCCAGCAGGTGG + Intronic
1157298873 18:46465434-46465456 AGCAGTCCCTGTCCAGCAGGGGG + Intergenic
1160923927 19:1533955-1533977 CAGAGGCCGGGTCCAGCAGGTGG - Exonic
1160950351 19:1663977-1663999 GGCAGTGCGGATCCTGCAGGAGG - Intergenic
1162301655 19:9848239-9848261 GGCCTTCGGGGTCCAGCAGGTGG + Intronic
1162325475 19:9996557-9996579 TGGAGTCCTGATCCAGGAGGGGG - Intronic
1163725787 19:18922343-18922365 TGCAGCCCTGTTCCAGCAGCCGG - Exonic
1164247031 19:23439818-23439840 TACCGTTCAGGTCCAGCAGGAGG - Intergenic
1165816863 19:38647868-38647890 CCCAGGCCGGGTCCAGCAGCAGG - Exonic
1167373344 19:49097977-49097999 TGCAGTCTGTGTCCAGTAGGTGG + Intronic
929049843 2:37826739-37826761 AGCAGTCCAGCTCCAGCACGTGG + Intergenic
932775843 2:74527936-74527958 TGCACTCCGTGTACAACAGGTGG - Exonic
934176730 2:89584141-89584163 GACAGCCCGGGGCCAGCAGGTGG + Intergenic
934287036 2:91658501-91658523 GACAGCCCGGGGCCAGCAGGTGG + Intergenic
936041023 2:109149583-109149605 TGCATGCAAGGTCCAGCAGGAGG + Intronic
937892354 2:126948343-126948365 TGCAGGCCAGGTCCATCAGGAGG - Intergenic
946763575 2:223019681-223019703 TGCAGTCCTGGTTCACAAGGTGG + Intergenic
947286979 2:228528031-228528053 TGCAGTCCTGCTCCGGCAGTGGG + Intergenic
948523751 2:238558109-238558131 TGAAGTCGGGGTCCATCAGTAGG - Intergenic
1170515870 20:17129758-17129780 TTCAGTCAGGGGCCAGCAGAAGG - Intergenic
1175922567 20:62457019-62457041 TGCAGTCAGGGTGTAGTAGGCGG - Intergenic
1176030398 20:63008689-63008711 TGCAGTTCAGGCCCAGGAGGAGG - Intergenic
1176861709 21:14014680-14014702 TGCTGTCAGAGGCCAGCAGGGGG - Intergenic
1178621443 21:34180524-34180546 TGCAGACGGGGTCCAGAAAGGGG + Intergenic
1179442170 21:41402950-41402972 TCCAGTCCGTGTCCGGCAGGAGG - Intronic
1180594595 22:16964928-16964950 TGAAGTCAGGGCCCAGCTGGAGG - Intronic
1181087712 22:20449994-20450016 TGGGGTGCGGGTCCAGCAGGTGG - Intronic
1183658649 22:39205740-39205762 TGGAACCTGGGTCCAGCAGGCGG - Intergenic
1184296072 22:43526376-43526398 TGGAGTCTGGGCCCAGCAGTGGG + Intergenic
1184452190 22:44589966-44589988 GGCAGGCTTGGTCCAGCAGGTGG - Intergenic
1184519836 22:44986841-44986863 TGCAGGCGGGGTCCTGGAGGTGG + Intronic
1185045247 22:48525407-48525429 TGGAATCGGAGTCCAGCAGGCGG - Intronic
1185075569 22:48680363-48680385 TGCATGGCGGGTACAGCAGGAGG - Intronic
950215461 3:11155202-11155224 TGCAGTTCGGCTGCAGCTGGGGG + Intronic
954083037 3:48223679-48223701 TGGGGTCCAGGTCCAGGAGGCGG - Exonic
954245427 3:49327644-49327666 TGCAGACAGTGACCAGCAGGTGG + Intronic
954263303 3:49455405-49455427 TGGAGTATGGGTCAAGCAGGGGG - Intergenic
960593003 3:119383132-119383154 TGCAGTCCGGGTCCAGCAGGTGG + Exonic
961010055 3:123429701-123429723 TGTAGTCAGGGGACAGCAGGTGG + Intronic
963645020 3:147903266-147903288 TGGGCTCAGGGTCCAGCAGGAGG - Intergenic
967186727 3:186950345-186950367 TGCAGTCATTTTCCAGCAGGTGG + Intronic
968193130 3:196685291-196685313 TGCAGCCCGCGGGCAGCAGGTGG - Intronic
968303069 3:197630770-197630792 CGCTGTCCTGGTCCATCAGGGGG + Intergenic
968908307 4:3464402-3464424 TGCAGTCCAGGCCCTGCAAGGGG - Intronic
969494891 4:7520849-7520871 TGCAGTCAAGGTCCAGCTGCTGG + Intronic
969618512 4:8267341-8267363 TGCAGGGCGGGAGCAGCAGGGGG + Intergenic
985507678 5:293168-293190 CGCTGTCCTGGTCCATCAGGGGG - Intronic
985740294 5:1611961-1611983 CGCTGTCCTGGTCCATCAGGGGG + Intergenic
994529859 5:100955895-100955917 TGCAGTCCTGTTACAGCAGAAGG + Intergenic
998583958 5:143405765-143405787 TGCCTTCTGGGTCCAGAAGGGGG - Intronic
1001445112 5:171776866-171776888 TCCAGTCCTGCTCCTGCAGGTGG + Intergenic
1001715033 5:173808435-173808457 GGGAGTCCGAGTCCAGCTGGCGG + Intergenic
1003273730 6:4630097-4630119 TGCAGTCTGGCTCCAGCCAGTGG - Intergenic
1003962315 6:11220208-11220230 TGCAGTCTGGGTGCCACAGGAGG - Intronic
1007633989 6:43287228-43287250 TGCCCTCTGGGTCCAGCAGAGGG + Exonic
1016216589 6:141610977-141610999 AGCAGTCCAGGACCAGCAGATGG + Intergenic
1017899485 6:158706583-158706605 ACCAGTCCTCGTCCAGCAGGGGG - Intronic
1019740125 7:2668631-2668653 TGCTGTCCTGGACCAGCTGGAGG - Intergenic
1022889872 7:34685761-34685783 TGCAGCCCAGCTCAAGCAGGTGG - Intronic
1026809453 7:73450461-73450483 GGCAGTCCGGGTACAGAGGGTGG - Intronic
1026867911 7:73834706-73834728 TGGAGTCAGGGGCCAGCTGGGGG + Exonic
1028261684 7:88674174-88674196 TGCTGTGGGGGTCCAGCATGTGG - Intergenic
1034330653 7:150279502-150279524 AGCAGTCTGGATCCAGCAGTGGG - Intronic
1034667391 7:152830347-152830369 AGCAGTCTGGGTCCAGCAGTGGG + Intronic
1035245277 7:157559131-157559153 TGGAGTCAGGGTGCTGCAGGGGG - Intronic
1037592853 8:20328087-20328109 TCCAGTCTGGGTTCAGCAAGGGG - Intergenic
1037946747 8:22994403-22994425 TGATGTCCGGGTCCAGCGCGGGG - Intronic
1048654429 8:136519818-136519840 GGCAGTTCAGGTCCAGCGGGGGG - Intergenic
1048896912 8:139000513-139000535 AGCAGTCAGGGTCTAGAAGGAGG + Intergenic
1049094654 8:140541160-140541182 TGAAGGCCAGTTCCAGCAGGTGG - Exonic
1049508015 8:143014115-143014137 TGAAGGCCTGGCCCAGCAGGCGG - Intergenic
1056558129 9:87706698-87706720 TGCACACCGAGTCCAGCAGCAGG - Exonic
1056731057 9:89167100-89167122 TGCCCTGGGGGTCCAGCAGGAGG + Intronic
1060634594 9:125189896-125189918 TGCAGTCGGGGTTCAGCCAGAGG - Exonic
1061849822 9:133407818-133407840 TGGGCTCCAGGTCCAGCAGGCGG - Exonic
1061901797 9:133676664-133676686 TGCAGTCTGCGTCCAACAGAAGG + Intronic