ID: 960593845

View in Genome Browser
Species Human (GRCh38)
Location 3:119390711-119390733
Sequence CTGTGGATGGGGAATCTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 350
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 321}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960593833_960593845 6 Left 960593833 3:119390682-119390704 CCCCCATCATAGGATCAAGAATG 0: 1
1: 0
2: 0
3: 4
4: 99
Right 960593845 3:119390711-119390733 CTGTGGATGGGGAATCTGGATGG 0: 1
1: 0
2: 0
3: 28
4: 321
960593834_960593845 5 Left 960593834 3:119390683-119390705 CCCCATCATAGGATCAAGAATGG 0: 1
1: 0
2: 2
3: 6
4: 109
Right 960593845 3:119390711-119390733 CTGTGGATGGGGAATCTGGATGG 0: 1
1: 0
2: 0
3: 28
4: 321
960593831_960593845 22 Left 960593831 3:119390666-119390688 CCAGGGTGGCACTCAGCCCCCAT 0: 1
1: 0
2: 1
3: 22
4: 263
Right 960593845 3:119390711-119390733 CTGTGGATGGGGAATCTGGATGG 0: 1
1: 0
2: 0
3: 28
4: 321
960593836_960593845 4 Left 960593836 3:119390684-119390706 CCCATCATAGGATCAAGAATGGA 0: 1
1: 0
2: 2
3: 7
4: 103
Right 960593845 3:119390711-119390733 CTGTGGATGGGGAATCTGGATGG 0: 1
1: 0
2: 0
3: 28
4: 321
960593837_960593845 3 Left 960593837 3:119390685-119390707 CCATCATAGGATCAAGAATGGAG 0: 1
1: 0
2: 0
3: 12
4: 135
Right 960593845 3:119390711-119390733 CTGTGGATGGGGAATCTGGATGG 0: 1
1: 0
2: 0
3: 28
4: 321

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960593845 Original CRISPR CTGTGGATGGGGAATCTGGA TGG Intronic
901757697 1:11451272-11451294 CTGGGGCTGGGGAAGCGGGAGGG + Intergenic
902510781 1:16965911-16965933 GGCTGGATGGGGAACCTGGAGGG + Intronic
902834646 1:19038651-19038673 CTGAGGGTGGGGACCCTGGAAGG + Intergenic
903049090 1:20587665-20587687 GTTTGGATGGGGAATGGGGAAGG - Intergenic
903367398 1:22813552-22813574 CTGTGGAGGGGCCATCTGGGAGG + Intronic
904051226 1:27640216-27640238 CTGTGGAAGGAAAAGCTGGATGG - Intergenic
904814006 1:33181855-33181877 CTGGGGATGGGGAATCCTGGGGG + Intronic
905347339 1:37319866-37319888 CTGGGGATTGGGAATGAGGAAGG + Intergenic
906690728 1:47791228-47791250 CTGTGGTTCTGGAGTCTGGATGG - Intronic
908353441 1:63308746-63308768 CTGTGGATCGGGAATTCAGAAGG - Intergenic
908391446 1:63687123-63687145 GTGCGGATGAGGAATCTGAATGG - Intergenic
908867432 1:68566111-68566133 CTGTGGATGCGGAATCTACCTGG - Intergenic
912320610 1:108709302-108709324 CTCTGGAGGGGAGATCTGGATGG - Intergenic
914790394 1:150872451-150872473 CTGTGGATGAAGAATGTAGAAGG - Intronic
915649208 1:157295192-157295214 CTTTGGATGGGGATTCTGTGTGG - Intergenic
915740982 1:158118223-158118245 CTGGGGGTGGGGGATATGGAAGG - Intergenic
915848654 1:159297361-159297383 CTGAGGATGAAGAACCTGGAAGG - Intronic
916629194 1:166593577-166593599 CTGTGGATGGGGTCTCAGAAAGG - Intergenic
917515327 1:175702424-175702446 CTGTGGGTCTGGAAGCTGGAAGG - Intronic
917719979 1:177778085-177778107 CTGTGGAAGAGGAATGTGTATGG - Intergenic
918457107 1:184732323-184732345 GTGGGGATGGGGAATAGGGAGGG + Intronic
920003596 1:202816085-202816107 ATGTGGATGAGGAACCTGGGTGG + Intergenic
920045629 1:203130421-203130443 CTGGGCATGGGGAATCAGGAAGG - Intronic
920960952 1:210663663-210663685 CTGTTGTAGGGGAATCTGCAGGG - Intronic
921119924 1:212127385-212127407 CTCTGCATGGGGAATCTGTCAGG + Intergenic
923284047 1:232474073-232474095 CTGTGAATGGGGAAAAGGGATGG + Intronic
924604549 1:245521575-245521597 CTGTGGCTGGGAAGACTGGAAGG + Intronic
1065011825 10:21427816-21427838 CAGTGGATGGGAGAGCTGGAGGG + Intergenic
1065145902 10:22767832-22767854 AAGTTGATGGGGAATTTGGAAGG + Intergenic
1065511753 10:26486272-26486294 ATATTGATGGGGAGTCTGGAAGG + Intronic
1065945045 10:30598562-30598584 ATGTGGATGGTGGATCTTGAGGG + Intergenic
1066225741 10:33381444-33381466 ATTTGGATGGGGAATTTTGAGGG + Intergenic
1066265759 10:33774385-33774407 CTGCAGATGGGGAAGCCGGAAGG - Intergenic
1066387786 10:34955438-34955460 TGGTGGAGGGGGAGTCTGGAAGG - Intergenic
1066393299 10:34996119-34996141 CTGGTGGTGGGGAATGTGGAGGG + Intergenic
1067473825 10:46553705-46553727 TTGTGGAGGGGGAATGGGGAAGG - Intronic
1069054369 10:63829503-63829525 CTGTGGCTGGGCAATTTGTAAGG + Intergenic
1069370924 10:67746940-67746962 CTGGTGCTGGGGAAACTGGATGG + Intergenic
1070770050 10:79077032-79077054 CTGTGTATGGGGAAGCAGGGAGG + Intronic
1071465280 10:85934131-85934153 CTGTGGATGGGCAAGCTGTCTGG + Intronic
1072089322 10:92111662-92111684 CCTAGGATGGGGAAGCTGGAGGG + Intronic
1072789019 10:98304029-98304051 ATAAGGATGGGGAAGCTGGAGGG - Intergenic
1072984947 10:100131089-100131111 CTGTGGGTCAGGAATCTGAACGG - Intergenic
1073213978 10:101826554-101826576 TTGTGGTGGGGGAATGTGGATGG - Intronic
1075240600 10:120775059-120775081 CTGTAGATGGGGAAACTGCCAGG + Intergenic
1078462268 11:11523162-11523184 CTGTGGGTGGCAAAACTGGAAGG - Intronic
1078600633 11:12727294-12727316 CTGTGGGTGGGGATGCTGGATGG + Intronic
1079139534 11:17798859-17798881 CTGTGGATGAGGAAACAGGCTGG + Intronic
1079170356 11:18088315-18088337 CTGAGGTTTGGGAATATGGATGG + Intronic
1080373586 11:31681268-31681290 TTGTGAATGGGGTTTCTGGAAGG + Intronic
1080460866 11:32453740-32453762 CTGAGGAGGGGAAAACTGGAGGG + Intergenic
1081456043 11:43223908-43223930 GTGTGGATGTGGAAGCTGCAAGG - Intergenic
1083564968 11:63706441-63706463 CTGTGGATGGCTAAGGTGGAAGG - Intronic
1083580015 11:63818794-63818816 CTGGCGATGGGGGCTCTGGAAGG - Exonic
1084404386 11:68962658-68962680 CTGGTGATGGAGAATCTTGAAGG + Intergenic
1084689324 11:70715963-70715985 CTGTGGACAGGGCGTCTGGAGGG + Intronic
1084751075 11:71204836-71204858 CTGTGGATGGGCCATTGGGAAGG - Intronic
1085127971 11:74014809-74014831 GTGTGGATGGGAAACCTTGAGGG + Intronic
1085180605 11:74532649-74532671 CACTGGATGGAGAATCAGGAAGG - Intronic
1085235931 11:75015510-75015532 TTGTGGAGGGGGAAGCTTGAGGG - Intronic
1085256231 11:75175120-75175142 CTGGGGATGGGGAGTGGGGAGGG + Intronic
1085304253 11:75476256-75476278 CTGAGGCTTGGGCATCTGGAAGG + Intronic
1086278698 11:85161084-85161106 CTGGGGAAGGGGTATGTGGATGG + Intronic
1088667486 11:112107972-112107994 CTGTGGATAGGGAATGTCAATGG - Intronic
1089289059 11:117426863-117426885 CTGTGGATCAGGAACCTGGAAGG - Intergenic
1089760740 11:120721272-120721294 ATGTGGATGAGGCATCTGGTTGG + Intronic
1090125953 11:124084307-124084329 CTGGGGATGGGGAAGGTGGATGG + Intergenic
1091157288 11:133385312-133385334 CTGTGGGTCGGGAATCTGAGAGG - Intronic
1091502504 12:1032550-1032572 CAGTGGATGGGGCATGTGTAGGG + Intronic
1091845767 12:3655314-3655336 CTGTGGATGGGGAAATGGGGAGG + Intronic
1092134748 12:6139011-6139033 CTGTGGTTGGGGAAATTGCACGG + Intergenic
1092797260 12:12124632-12124654 CTGTGGCTGGGGATGGTGGAGGG + Exonic
1093089104 12:14901788-14901810 CTGTAGATGGGAAATGTGGCAGG + Intronic
1094057932 12:26285576-26285598 CTGGGGATGGGGCATCGGCATGG - Intronic
1096255315 12:50058656-50058678 CTGGAGATGAGGATTCTGGATGG + Intronic
1096773332 12:53950056-53950078 CTGGGGACGGGGAATCCAGAAGG + Intergenic
1098814072 12:75135133-75135155 CTGTGGATAGGGATTCTGAAAGG - Intronic
1099253614 12:80289067-80289089 CTTTGGATGGGGATTTTGTATGG + Intronic
1102727363 12:115077498-115077520 CTGTGGGTCAGGAATTTGGATGG - Intergenic
1103532488 12:121612047-121612069 CTGTGAAAGGGGAATATTGATGG - Intergenic
1103572581 12:121854892-121854914 CTGGGGCTGGAGAAACTGGAGGG - Intronic
1104070251 12:125338495-125338517 CTGAGGATGGGGGCACTGGAAGG + Intronic
1104787268 12:131457728-131457750 CTGTGGATGGAGAACCTGGCTGG - Intergenic
1106682622 13:32023930-32023952 CTGTAGATGGCGAATCTAAAGGG + Intergenic
1109202891 13:59450662-59450684 CTGTGGATGGGGAATTAGAATGG - Intergenic
1109394343 13:61736123-61736145 CTGTGGATCAGGAGTCTGAAAGG + Intergenic
1110135606 13:72063259-72063281 CTTTGGATGGGGTCTCTGGGTGG - Intergenic
1110369681 13:74726064-74726086 CAGAGGAGGGGGTATCTGGAAGG - Intergenic
1112809286 13:103199099-103199121 CTGTAGATGGGCAAGCGGGAGGG + Intergenic
1113447097 13:110377552-110377574 CTTTCCATGGGGAATCAGGAGGG + Intronic
1113711203 13:112466664-112466686 CTGTGCATGGAGAAGCTGGGAGG - Intergenic
1114566903 14:23639569-23639591 CTGTGGAGGAGGAGTCTGAAGGG + Intronic
1118240037 14:64047172-64047194 CAGTGGAGAGGGAAGCTGGAGGG + Intronic
1118398370 14:65356575-65356597 GTGTGGGTGGGGAATTGGGAGGG + Intergenic
1119330794 14:73792105-73792127 CTAAGGAGGGAGAATCTGGAAGG - Intergenic
1119925470 14:78489424-78489446 CTGTGGATGTGCAATTTAGAGGG + Intronic
1120820790 14:88910244-88910266 CTGTGGAAGGGGAAAGTGGCTGG - Intergenic
1121322381 14:92999522-92999544 CAGTGGGTGGGGAGGCTGGAAGG + Intronic
1122117729 14:99536074-99536096 AGGTGGATGAGGGATCTGGAAGG + Exonic
1122352386 14:101103601-101103623 CTGTGTGTGGGGCATGTGGAAGG + Intergenic
1122805972 14:104257153-104257175 CGGTGGCTGGGGCACCTGGAGGG + Intergenic
1127270634 15:57398344-57398366 CTGTTAATGGGGATTTTGGATGG + Intronic
1127469060 15:59274189-59274211 CTCTGGAAAGGGATTCTGGAAGG + Intronic
1127784008 15:62340263-62340285 CTATGGATGGGGACTTTGGGAGG - Intergenic
1128778828 15:70344655-70344677 CTGGGGATGGGCAATGGGGAAGG - Intergenic
1129825884 15:78634740-78634762 CTGTGGATGGGGACATGGGAAGG + Intronic
1130144071 15:81259304-81259326 ATGTGGATAGGGAGCCTGGAAGG - Intronic
1130849126 15:87776757-87776779 CTATGGATTGGGAAACTGCAGGG + Intergenic
1130985399 15:88841732-88841754 GTGTGGATGGGGTATCTGCCAGG - Exonic
1131990529 15:98088742-98088764 CTGCGGGTGGCGAATCAGGAGGG - Intergenic
1132204256 15:99975738-99975760 CTGTGCATGAGGAATGTGAAGGG - Intronic
1132296176 15:100736387-100736409 CTGGGGACGGGGAATGGGGATGG - Intergenic
1132519481 16:380919-380941 CTGTGGCCTGGGACTCTGGAGGG - Intronic
1132568518 16:634155-634177 CTGGGCATGGGGCACCTGGAAGG - Intergenic
1133017304 16:2949985-2950007 CTGGGGTTGGGGCCTCTGGAAGG + Exonic
1133402983 16:5502331-5502353 CAGTGGATGGGGACACTGTAAGG + Intergenic
1137481675 16:48856965-48856987 GTGTGCATGGGGAAGATGGAAGG + Intergenic
1137563319 16:49516821-49516843 CCCTGGAGGGGGAATCTGGTAGG - Intronic
1138304137 16:55958598-55958620 CTGTGGAGGGGGTTCCTGGAAGG + Intergenic
1138718142 16:59047415-59047437 CTGTAGATGAGTAATCTGGAGGG - Intergenic
1138718355 16:59049605-59049627 CTGTAGATGAGTAATCTGGAGGG + Intergenic
1139037472 16:62965217-62965239 CTGTGGGTGAGGATTTTGGAAGG + Intergenic
1139371254 16:66470868-66470890 CTGTGGATGGTGATTTGGGAAGG - Intronic
1139429608 16:66904118-66904140 CTCAGCAGGGGGAATCTGGAGGG + Intergenic
1140094820 16:71865901-71865923 CTGTGGCTGGGGAGTCTGCAAGG + Intronic
1140877081 16:79162700-79162722 CTCTGAATGGGGACTCAGGAAGG - Intronic
1141401638 16:83752801-83752823 CTTTTGATGGAGAATCTAGAGGG - Intronic
1141863788 16:86735934-86735956 CTGTTGGTGGGGACTCTGCAAGG + Intergenic
1142342680 16:89534156-89534178 CTGGGGATGGAGAATGGGGAGGG - Intronic
1142360107 16:89621959-89621981 CTGTGGATGGGGCTTCTGTGTGG + Intronic
1142890592 17:2940261-2940283 CTCTGGGTGGGGGATGTGGAGGG + Intronic
1143299516 17:5899308-5899330 TTTTGGCTGGGGCATCTGGAAGG + Intronic
1144076376 17:11723226-11723248 CTGATGGTGGGGAATCTGGCAGG - Intronic
1144816871 17:18040614-18040636 CTGGGGGTGGAGAAGCTGGAAGG - Intronic
1147169086 17:38607612-38607634 CAGTGGGTGAGGAATCTGAACGG - Intergenic
1148178794 17:45588560-45588582 CTGTGGGTCAGGAATCTGGGAGG - Intergenic
1148247249 17:46041518-46041540 CAGTGGATAGGGACTCTGGCGGG - Intronic
1148835936 17:50465773-50465795 CTGTCGAAGGGGAAGTTGGAGGG + Exonic
1149231980 17:54545023-54545045 CTTTGGATGGGGTTTCTGTAGGG - Intergenic
1149545379 17:57499657-57499679 CTGTGGAGCGGGAATTTGGGCGG + Intronic
1150281345 17:63931199-63931221 CTGGGGATGGGAATCCTGGATGG + Intronic
1151770023 17:76154696-76154718 CTGTCAATGGAGGATCTGGATGG - Intronic
1152314613 17:79572857-79572879 GGGTGGGTGGGGAATCCGGAAGG - Intergenic
1152755385 17:82084980-82085002 CTGGGGATGGGGAGGCTGGTGGG + Intronic
1152762797 17:82118199-82118221 GGGTGGCTGGGGAGTCTGGAGGG + Intronic
1155117393 18:22783413-22783435 CTTTGGATGGGGTTTTTGGAGGG + Intergenic
1155153508 18:23140178-23140200 CGGTGAATGGTGCATCTGGAAGG + Intronic
1157517585 18:48321666-48321688 CTAGGGGTGGGGAAACTGGATGG + Intronic
1158721952 18:59933009-59933031 CTGGGGATGGGGACTGGGGAGGG - Intergenic
1159889951 18:73943811-73943833 CTGTGGATGGGCCCTCTGGGAGG - Intergenic
1162205900 19:9055801-9055823 CTGGGGATGGGGAAGCCGGGAGG - Intergenic
1162361398 19:10222709-10222731 CTGTGGATTTGGGCTCTGGATGG + Intronic
1163376156 19:16931736-16931758 CTGGGGATGGGGAAGCCAGATGG - Intronic
1163538961 19:17895324-17895346 CTGAGGAAGGAGAATCTGGGAGG - Intergenic
1163751064 19:19078136-19078158 CTGTATATGGGGAGGCTGGAGGG + Intronic
1163844489 19:19630523-19630545 CTGTGGAGTTGGAATCTGCAGGG + Exonic
1165317425 19:35065399-35065421 CTGGGGATGGGCAGTCTGGCTGG + Intronic
1165974758 19:39665982-39666004 ATGTGGAAGGGAAATGTGGAAGG - Intergenic
1166338542 19:42123122-42123144 ATGTGGATGGGGAAAGTGGTGGG - Intronic
1167499649 19:49837881-49837903 CTGTGGATGGGGAAGACGGTGGG + Intronic
1167668823 19:50838413-50838435 CTGTGCTGGGGGAAGCTGGAGGG + Intergenic
925361994 2:3286170-3286192 CTGAGGGTGGGGAATCAGGCAGG - Intronic
926309865 2:11667761-11667783 CCGTGGATGTGGAGTATGGAGGG - Intronic
926483339 2:13426956-13426978 CTTTGGATGGGGATTTTGGGTGG + Intergenic
926997775 2:18756826-18756848 ATGAGCATGGGGCATCTGGAAGG + Intergenic
927202437 2:20586358-20586380 CTCTGGGTGGAGAAACTGGACGG - Intronic
927772050 2:25871348-25871370 CTGTGGATGGGGAAGCAGAAAGG + Intronic
927963486 2:27255164-27255186 CTGAGGCTGGGGAAACTGGCAGG + Exonic
928134678 2:28679466-28679488 CTGTGAGTGGGGCATGTGGATGG - Intergenic
928880284 2:36089365-36089387 CTTTGGATGGGGTATTTGTAGGG - Intergenic
930361286 2:50383307-50383329 CTGATGATGGTGAATCTGAATGG - Intronic
930888878 2:56359888-56359910 CTGTTCATTGGGAATCTGCAAGG + Intronic
932448257 2:71793855-71793877 GCATGGAGGGGGAATCTGGAGGG - Intergenic
934164252 2:89280043-89280065 ATGTGTATGTGAAATCTGGAGGG + Intergenic
934203022 2:89902481-89902503 ATGTGTATGTGAAATCTGGAGGG - Intergenic
934539662 2:95163259-95163281 CTGTGGGTCGGGAACTTGGATGG - Intronic
937017757 2:118621203-118621225 ATCTGGTTGGGGAAACTGGATGG - Intergenic
937288689 2:120768879-120768901 CTGGGGATGGGCTCTCTGGAAGG + Intronic
937381429 2:121380900-121380922 CTCTGGAGGGGCAATCTTGATGG + Intronic
937686039 2:124698588-124698610 CTGGGCATGAGGACTCTGGAAGG + Intronic
939572486 2:143856851-143856873 CTGTGGAAGGGGACTCTACATGG + Intergenic
939678677 2:145104123-145104145 CTGGGGGTGGGGAAGCTGGATGG - Intergenic
939717955 2:145609376-145609398 AGGTGGATGGGAGATCTGGAGGG + Intergenic
939921944 2:148126555-148126577 GTGTGTATGGAGAATATGGAAGG - Intronic
940895866 2:159081439-159081461 CTGTGGATTGAGAATGTGGCAGG + Intronic
941023580 2:160436486-160436508 CTGTGGCTCAGGAATTTGGAGGG - Intronic
941852805 2:170201036-170201058 CTGTGAAGAGGGAATCTGAAGGG + Intronic
941928377 2:170917532-170917554 CTGTGGATGGTGAGACTGAAAGG - Intergenic
942301888 2:174570999-174571021 CTGTGGATGGGGGCATTGGAAGG + Intronic
943561500 2:189468830-189468852 ACGAGGATGGGGAATATGGAGGG - Intronic
943836937 2:192525448-192525470 CTTTGGATGGGGTTTCTGTATGG - Intergenic
945148935 2:206767676-206767698 CTGGGGATGGTAAATGTGGAAGG - Intronic
945945317 2:215989368-215989390 CTGTGGATGGGGTTTCTGTGTGG - Intronic
946405245 2:219488901-219488923 GTGAGGATGGGGCAGCTGGAGGG + Intronic
946732640 2:222724050-222724072 TTCTGGCTGAGGAATCTGGAAGG + Intergenic
946919691 2:224566065-224566087 CTGTAGATGGGGAAGGTGGGGGG - Intronic
947018888 2:225652470-225652492 TTGTGGATGGGGAATTAGTATGG + Exonic
948482673 2:238260166-238260188 CTGTGGATGAGAAATCTGACAGG + Intronic
948644849 2:239398059-239398081 CTGGGGATGGGGGAACTGAAGGG - Intronic
948807306 2:240458628-240458650 CTGAGGATGGGGAAGGAGGAAGG - Intronic
1169176752 20:3522886-3522908 CTTTGGATGGGGTTTCTGTATGG - Intronic
1170113769 20:12834677-12834699 CTGGAGATGGGAAATCTGTATGG + Intergenic
1170455680 20:16530644-16530666 CTGTGGGTCAGGAATCTGGGTGG - Intronic
1171317801 20:24210784-24210806 CTTTCCATGGGGTATCTGGAGGG + Intergenic
1171346635 20:24470336-24470358 CTTGGGATGGGGAATCCCGACGG + Intronic
1171394095 20:24819867-24819889 CTGTGGGTAAGGAATTTGGAAGG - Intergenic
1173310865 20:41894963-41894985 CGGTGGATGGGGAAGAGGGATGG + Intergenic
1173589996 20:44217241-44217263 TTGTGGATGGGGAATAGGCAAGG + Intergenic
1173929598 20:46807627-46807649 GGGTGGATGGGGAAGCAGGAGGG + Intergenic
1175998635 20:62822224-62822246 CTGGGGAGGGGGAATGGGGAGGG - Intronic
1177261308 21:18733300-18733322 GTGTGGAAGGGAAATATGGAGGG + Intergenic
1180991928 22:19942038-19942060 CTTGGGGTGGGGAATCTGGATGG + Intronic
1183013554 22:34967637-34967659 GTGTGGATGGGGCCTCTGGAGGG - Intergenic
1183024286 22:35052426-35052448 CTGGGGATGGGGATGGTGGATGG - Intergenic
1183394624 22:37564255-37564277 GTGGGGGTGGGGAATCAGGAAGG + Intronic
1183503344 22:38194428-38194450 GTGGGCATGGGGATTCTGGAAGG + Intronic
1185000514 22:48242680-48242702 GTGGGGATGGGGCATGTGGAGGG - Intergenic
1185131841 22:49043740-49043762 CTGGGGCTGGGCAATCTGAAGGG + Intergenic
1185133652 22:49055995-49056017 TTGTGGATGGGGCCTTTGGAAGG + Intergenic
949428541 3:3946406-3946428 CTGTGGATGGGTCTTCTTGAGGG - Intronic
949602743 3:5618491-5618513 CAAGGGATGGGAAATCTGGAAGG - Intergenic
949949112 3:9214654-9214676 CCATGGATGGAGAAGCTGGAAGG + Intronic
950650893 3:14406015-14406037 CTGTGGGTGGAGAAACAGGATGG + Intronic
950969014 3:17167967-17167989 CTGCGGATGGGGAAGCTGCAGGG + Intronic
953582896 3:44173180-44173202 CAGTGAATGGTGAAGCTGGATGG - Intergenic
953642289 3:44720256-44720278 CTGTGGATGTTGAATATGCAAGG + Exonic
953746663 3:45579567-45579589 CTATTGGTGGGGGATCTGGAAGG - Intronic
954529261 3:51304231-51304253 CTGGTGCTGGGGAAACTGGACGG - Intronic
954584297 3:51720462-51720484 CTTGGGATGGGGAAGCTGGCGGG - Intergenic
954603146 3:51887921-51887943 CTGTTGAAGGGGAGTCTGAATGG + Intergenic
955326935 3:58015822-58015844 CTGGGTATGGGTAATCTAGAAGG + Intronic
956722015 3:72126351-72126373 TTCTTGAAGGGGAATCTGGAAGG - Intergenic
958257357 3:91340564-91340586 CTTTGGATGGGGTCTCTGAATGG + Intergenic
960404015 3:117238002-117238024 CTGCTGATGGGGAATGTGGGAGG - Intergenic
960593845 3:119390711-119390733 CTGTGGATGGGGAATCTGGATGG + Intronic
962368968 3:134805109-134805131 CTGGGGATGGGGGATTGGGAAGG + Intronic
964909069 3:161755890-161755912 CTGTGAGTCGGGGATCTGGAGGG + Intergenic
965702364 3:171471106-171471128 CAGTATATGGGGAATCTGGTGGG - Intergenic
968241632 3:197093843-197093865 CTGTCGATGGGGAAATTGCAAGG - Intronic
969470862 4:7388546-7388568 CTGTGGGTGGGGAAGCGGGGAGG - Intronic
969595114 4:8144335-8144357 GGGTGGATGCGGATTCTGGAAGG - Intronic
969967072 4:11007990-11008012 CTGTGGAGGTGGCATTTGGATGG + Intergenic
970471872 4:16387095-16387117 TGGTGGATGGGGCAGCTGGATGG + Intergenic
971484603 4:27146402-27146424 CTGAGGATGAGGAATTTGGGGGG + Intergenic
971593459 4:28497911-28497933 CTGTAGGTGGGGAATCCTGATGG - Intergenic
971672521 4:29581171-29581193 CTGTAGATCAGAAATCTGGAAGG - Intergenic
973926881 4:55747877-55747899 CTGGGGATGGGGAGTATGGAAGG + Intergenic
973931153 4:55793926-55793948 CTGGGGATGGGGAAGAGGGACGG + Intergenic
974499690 4:62684149-62684171 CTGTAGCTGGGGAGACTGGATGG + Intergenic
975286834 4:72631197-72631219 CAGTGGCTGGGGGATATGGATGG + Intergenic
976326024 4:83772665-83772687 CTGTGGTTCAGGAACCTGGATGG + Intergenic
978210446 4:106129775-106129797 CAGTGGAGAGTGAATCTGGAGGG - Intronic
978744935 4:112182167-112182189 CTTTGGATGTGGCATATGGATGG + Intronic
979721856 4:123909647-123909669 CTGTGGCTCAGGAATTTGGAAGG + Intergenic
981425881 4:144602511-144602533 TTGTGTACGGGGAGTCTGGAGGG + Intergenic
981578571 4:146229954-146229976 CTGGGGATAGGTAAGCTGGACGG - Intergenic
982452237 4:155566805-155566827 CTGTGGGTGGGGAGTGTGGCTGG - Intergenic
984292595 4:177814107-177814129 CTCTGAAAGGGGAATCTGGCAGG - Intronic
984886430 4:184454148-184454170 CTGTGGATGTGGAGTGTGGGAGG - Intronic
985175425 4:187194995-187195017 GCGTGGATGGGGAAACTGGGGGG + Intergenic
985199906 4:187474211-187474233 TCGTGGCTGGGGTATCTGGAGGG - Intergenic
985884891 5:2670153-2670175 CAGTGGAAGGGGAGGCTGGAGGG - Intergenic
990662308 5:58029771-58029793 CTGGAGATGGGGAAGCTGTATGG + Intergenic
991258588 5:64642598-64642620 CAGTTGAAGAGGAATCTGGAAGG - Intergenic
991402925 5:66273126-66273148 CTGCTGAAGGGGAAGCTGGAAGG - Intergenic
991974006 5:72168208-72168230 CTGTTGCTGGAGAAGCTGGAAGG - Intronic
994303353 5:98173297-98173319 ATGTGCATGTGGAATTTGGAAGG - Intergenic
996547868 5:124699859-124699881 GAGTGGATGGGGAATATTGAGGG - Intronic
998104452 5:139459549-139459571 CTGTGTATGTGGAACCTGAAAGG + Intronic
998152782 5:139766487-139766509 CTGTGTATGGGGGAAATGGATGG + Intergenic
998188325 5:140000365-140000387 CTGCGGCAGGGGAAGCTGGAAGG - Intronic
998501506 5:142636835-142636857 CTGTGGCTGGGGAAGCTGGCAGG + Intronic
999200249 5:149811186-149811208 CTGTGGGTGTGGACTATGGAGGG - Intronic
999499881 5:152136234-152136256 CTGTGTTTGGGGAATGTGGGTGG - Intergenic
999529294 5:152444574-152444596 ATCTGGATGGGGAATCAGGCAGG + Intergenic
1000160046 5:158588448-158588470 CTGAGGATATGGAATCTAGAAGG - Intergenic
1002703224 5:181142103-181142125 CTGTGGATGGAGTCTTTGGAAGG + Intergenic
1003523037 6:6874821-6874843 CTGTAGCTGGGAAATCTGGGAGG - Intergenic
1009727760 6:67557523-67557545 CTTCGGATGGGGTATCTGGGTGG + Intergenic
1011268206 6:85548160-85548182 CTGGAGATGGGGAATGGGGATGG + Intronic
1011511211 6:88103355-88103377 ATGTGGGTGGGGAAGCAGGATGG - Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013744841 6:113333567-113333589 GTGTGCATGGGGAAACTGGAAGG + Intergenic
1014544359 6:122715934-122715956 TTGTGGATGTGGAAACTGGGGGG - Intronic
1017507870 6:155085020-155085042 CTGTAAATGGAGACTCTGGAGGG + Intronic
1019057873 6:169236060-169236082 GTGTGGATGGTGAGTGTGGATGG - Intronic
1019057935 6:169236346-169236368 GTGTGGATGGGGAGTGTGGATGG - Intronic
1019057942 6:169236375-169236397 GTGTGGATGGGGAGTGTGGATGG - Intronic
1019057987 6:169236604-169236626 GTGTGGATGGCGAGTGTGGATGG - Intronic
1019057992 6:169236633-169236655 GTGTGGATGGCGAGTGTGGATGG - Intronic
1019768871 7:2870922-2870944 CTGTGGAGGGTGACTCTGGGAGG + Intergenic
1020526502 7:9266650-9266672 ATCTGGATGGGAAATCTGTAGGG - Intergenic
1021205676 7:17777021-17777043 CTGGGGATAGGGAATGAGGAGGG - Intergenic
1022419493 7:30207096-30207118 CTGTGCCTGGGGAATGTGAAAGG - Intergenic
1024512659 7:50215759-50215781 ATGTGAATGGGGAGTCTGGGAGG - Intergenic
1028458537 7:91064765-91064787 GTTTGGATGGGGGATTTGGAAGG + Intronic
1028622096 7:92836368-92836390 CTGTGGGTGGGGTAAGTGGAGGG - Intronic
1028796867 7:94912426-94912448 CTCTCCTTGGGGAATCTGGAAGG + Intronic
1028829447 7:95311527-95311549 CTGTGGACTTGGCATCTGGATGG + Exonic
1029581583 7:101439911-101439933 ATGTGGCTGGGGACTCTGCAGGG + Intronic
1034676998 7:152899028-152899050 CTGTGGTTGAGGAATCTACAGGG - Intergenic
1035057136 7:156043267-156043289 CTGTGGCTGGGAAGTTTGGAAGG - Intergenic
1035060639 7:156066797-156066819 CTGCGGAGGGAGAATCAGGAAGG + Intergenic
1035185983 7:157125999-157126021 CCGTGGATGGCGACTCCGGATGG - Intergenic
1037769399 8:21789751-21789773 CTGGGGAAGGGGCATCTCGAAGG - Intronic
1038160403 8:25031642-25031664 CTGTAGATGGGGAGTCTGCACGG - Intergenic
1040649108 8:49429910-49429932 CATTGGAAGGGCAATCTGGAAGG + Intergenic
1042871712 8:73405656-73405678 TTGGGGAAGGGGAAGCTGGAAGG - Intergenic
1044237284 8:89845579-89845601 CTGTGGGTCGGGAATTTGAAAGG - Intergenic
1044753678 8:95439958-95439980 CTGAGGATGGTGAATCTTGAGGG + Intergenic
1044928660 8:97231197-97231219 CAGTGGCTGGGGAGTCTTGAGGG + Intergenic
1046359630 8:113132773-113132795 CTGTGCATTGGGAATAGGGAAGG + Intronic
1047513387 8:125532487-125532509 CTGTGGGTCAGGAATCTGGGTGG + Intergenic
1048010828 8:130454635-130454657 CTGTGGATTGGTGATTTGGATGG + Intergenic
1048134786 8:131738086-131738108 CTATGGTCTGGGAATCTGGATGG - Intergenic
1048208053 8:132431394-132431416 CTGAGGAGGTGGAATCTGGATGG - Intronic
1048767005 8:137855630-137855652 CTCAGGATGGAGAGTCTGGAGGG - Intergenic
1049174377 8:141182646-141182668 CTGTGGCTGCCGATTCTGGAAGG + Intronic
1049308982 8:141923441-141923463 CTGAGGATGGGGCATGTGCATGG - Intergenic
1049365240 8:142233897-142233919 CTGTGCAGGGGGAAGCTGGGAGG - Intronic
1049397330 8:142407201-142407223 CAGTGGCTGTGGAATCTGGGGGG - Intergenic
1051416850 9:16850624-16850646 CTGTGGAAGGTGAAGGTGGAAGG + Intronic
1051553265 9:18354562-18354584 CTTTTGAAGAGGAATCTGGAAGG + Intergenic
1051745575 9:20291910-20291932 CTCTGGGTGGGGAAAATGGAGGG + Intergenic
1052805823 9:33012402-33012424 ATGTGGAAGGGGACTATGGAAGG - Intronic
1054696468 9:68364637-68364659 CTGGGGATGGGGATTCAGAAAGG - Intronic
1056879828 9:90380517-90380539 CTGGGGGTGGGGAAGTTGGAAGG - Intergenic
1059626563 9:116073384-116073406 CTGTGGATGGGGAAGCAGAAAGG + Intergenic
1061917034 9:133760666-133760688 CTGAGGATGAGGGATCAGGAAGG + Intergenic
1061917051 9:133760728-133760750 CTGAGAATGGGGGATCAGGAAGG + Intergenic
1062703116 9:137918435-137918457 CTGTGGGTCAGGAATCTGGGAGG + Intronic
1185656587 X:1690446-1690468 CTGTGGGAGGGGAATGAGGAGGG - Intergenic
1185824226 X:3234240-3234262 TTGTGGATGGAGACACTGGAGGG - Intergenic
1186741029 X:12518037-12518059 CTGAGGCTGGGGAGACTGGATGG - Intronic
1186941299 X:14510481-14510503 AGGTGGAGAGGGAATCTGGAGGG + Intergenic
1186997658 X:15140862-15140884 CTGGGGATGGGGAACCCAGAAGG + Intergenic
1189083308 X:37996251-37996273 GTGTGGAAGGGGGATCTGGCAGG - Intronic
1189498894 X:41535676-41535698 CTGTGTATGGTGGATCAGGATGG + Intronic
1189586869 X:42470766-42470788 CTGTTGAAGGGGAATCTGGGTGG - Intergenic
1191872301 X:65758460-65758482 CAGAGGATGGGGAATGTGGATGG + Intergenic
1193909070 X:87280210-87280232 CTTTGGATGGGGTTTCTGCAGGG + Intergenic
1194635544 X:96342126-96342148 CTGTGGATGGAGACCCCGGATGG + Intergenic
1195235696 X:102896056-102896078 CTTTGGAAAGGGAACCTGGATGG - Intergenic
1195820766 X:108943568-108943590 CTTTGGATGGGGTTTTTGGATGG + Intergenic
1196273064 X:113735170-113735192 CTTTGGATGGGGTTTCTGAATGG + Intergenic
1199849549 X:151715623-151715645 CCGTGTCTGGGGACTCTGGATGG + Intergenic
1200084033 X:153594177-153594199 CTGGGGACGGGGACTCTGGCCGG + Intronic
1200146578 X:153929442-153929464 CTGTTGATGGGGCATCTGGCTGG + Exonic
1201256563 Y:12113335-12113357 CTGGGAATGGATAATCTGGAGGG - Intergenic
1201737704 Y:17287248-17287270 CTATGGATGGGGAAACAGGATGG + Intergenic