ID: 960598727

View in Genome Browser
Species Human (GRCh38)
Location 3:119433650-119433672
Sequence AATGGCCTAGAGAATTCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 154}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960598726_960598727 -8 Left 960598726 3:119433635-119433657 CCAACAGAAGTCATTAATGGCCT 0: 1
1: 0
2: 0
3: 5
4: 115
Right 960598727 3:119433650-119433672 AATGGCCTAGAGAATTCAGCTGG 0: 1
1: 0
2: 1
3: 12
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960598727 Original CRISPR AATGGCCTAGAGAATTCAGC TGG Intronic
900074967 1:806887-806909 GATGTCCTAGAGAAAGCAGCTGG + Intergenic
901735269 1:11308410-11308432 GATGGTCTAGGGACTTCAGCTGG - Intergenic
903580170 1:24364914-24364936 AATGTCTTAGAGGACTCAGCAGG + Intronic
903710691 1:25321706-25321728 AATAGGCTACAGAATTAAGCTGG + Intronic
903716401 1:25370703-25370725 AATAGTCTACAGAATTAAGCTGG - Intronic
904339347 1:29824119-29824141 GATGGCCTGGAGAACTCAGGAGG - Intergenic
904406998 1:30297928-30297950 ACAGGCCTGGAGAATTCAGAAGG - Intergenic
906884248 1:49627493-49627515 AATGGCCAGGACAATTCATCAGG - Intronic
906970220 1:50505408-50505430 AATGGTCTAGAGAATTTTGGGGG + Intronic
910145051 1:84070203-84070225 TATGGCTTATAGAATTCTGCAGG + Intergenic
910453276 1:87369032-87369054 TGTGGCCAAGAGAATTCAGGAGG - Intergenic
913133208 1:115862172-115862194 ATTGGTCTAGAGAGTTAAGCAGG + Intergenic
913324303 1:117613359-117613381 ACTGGCCTAGATATTACAGCAGG - Intronic
915440940 1:155945112-155945134 AATGGCTTTGAAACTTCAGCAGG + Intergenic
918511798 1:185320549-185320571 AGTGGCCTAGAGCCTTCAGAGGG - Intergenic
919090036 1:192967377-192967399 AATAGCCTGGAGTCTTCAGCAGG + Intergenic
921157598 1:212450378-212450400 CAGGGCCCAGAGAATGCAGCTGG + Intergenic
922270808 1:224031786-224031808 GATGTCCTAGAGAAAGCAGCTGG + Intergenic
922426812 1:225504752-225504774 AATGGCCTAGATAATACATGTGG + Intronic
923234703 1:232021292-232021314 AATTTCCTAGAAAATTCCGCAGG - Intronic
1063144261 10:3282473-3282495 ACTGGCCAAGAGAATGCAGTAGG - Intergenic
1063755699 10:9005095-9005117 AATGGCTCAGAGAATGCAGCAGG + Intergenic
1063861377 10:10311440-10311462 AATGGCCAAGGGAATTAACCGGG + Intergenic
1064140475 10:12785858-12785880 AAAGGCCGGGTGAATTCAGCAGG + Intronic
1069680429 10:70281124-70281146 ATTGGCCCAAAGATTTCAGCTGG + Intronic
1070080672 10:73183453-73183475 AATGGATGAGAGAATTCACCTGG - Intronic
1070711630 10:78687233-78687255 TATGGCCTACAGGATTCAGCAGG - Intergenic
1072716263 10:97754635-97754657 AATGCCCTGCAGAAGTCAGCAGG - Intronic
1073518962 10:104107255-104107277 AATGGCCAAGAGAATTGAATAGG - Intergenic
1074233745 10:111563917-111563939 AGAGGCCTAGAGAATTCCTCAGG + Intergenic
1074542135 10:114373810-114373832 AAAGGCCTAGAGACTTCAAGAGG - Intronic
1078769485 11:14335077-14335099 AATGGCTTTGAGTGTTCAGCAGG - Intronic
1079245531 11:18749672-18749694 AATGGCCTTCAGATTTCACCTGG + Intronic
1079466919 11:20739820-20739842 AATGGCCTAGAAAACTCAAGTGG + Intronic
1086930659 11:92689521-92689543 AATAGCCTAGAGACTTCTTCAGG + Intronic
1087739601 11:101872231-101872253 TATGGCCTGGAGGATTCACCAGG + Intronic
1091979249 12:4852389-4852411 AGGGGGCTAGAGAATACAGCAGG + Intergenic
1096332238 12:50723806-50723828 AATCGCCTAGATAATTTTGCAGG - Intronic
1096435489 12:51587235-51587257 AATTGCCTAGTGAAATCATCTGG - Intergenic
1096449539 12:51726571-51726593 AATGGCTTAGAGAATTTCCCAGG - Intronic
1096779753 12:53985045-53985067 AATGGCCTTGATGATTCAGACGG - Intronic
1098267660 12:68738699-68738721 AATGGCAGAGAGAATGGAGCAGG + Intronic
1101241490 12:102843833-102843855 AATGGCCTATGGGATGCAGCAGG - Intronic
1102799675 12:115721000-115721022 AAGGTCATAGAGAATTCACCAGG - Intergenic
1103087226 12:118070905-118070927 ACTGGCCTAGGGATTTCATCAGG - Intronic
1103219454 12:119231709-119231731 GATGGGCTAGAGAAATAAGCAGG - Intergenic
1103892322 12:124249327-124249349 AATGGCCTAGGGAATGAAGGAGG + Intronic
1104312461 12:127665911-127665933 AATGCACCAGAGAATCCAGCTGG + Intergenic
1105625143 13:22105666-22105688 ATTGCCCAAGAGAATGCAGCAGG - Intergenic
1106975821 13:35212836-35212858 AATGGACTAGAGACTTCAACAGG - Intronic
1107039176 13:35931419-35931441 AAAGCCCCAGAGAGTTCAGCTGG + Intronic
1108943241 13:55984987-55985009 AATGTCTAAGAGAATCCAGCAGG - Intergenic
1109145162 13:58770565-58770587 AATGGCCAAGAGATTTGAGCAGG - Intergenic
1111654537 13:91135550-91135572 AATGGCCTGGAGTAATTAGCTGG + Intergenic
1112056630 13:95694684-95694706 GATGGTCTGGAGAATTAAGCAGG - Intronic
1113051997 13:106222723-106222745 AATGGATTAGATAATTCAGAAGG - Intergenic
1115393440 14:32879355-32879377 ATTTGCCTAGAGAAATCTGCAGG - Intergenic
1115427945 14:33282575-33282597 AATGGACTGGATAAATCAGCCGG + Intronic
1116192591 14:41679782-41679804 AATGGAGTAGAGAATCAAGCAGG + Intronic
1118543844 14:66862384-66862406 AATGTTCTGTAGAATTCAGCAGG - Intronic
1118888817 14:69889715-69889737 AATGGGCTAAAAAAATCAGCAGG + Intronic
1119979901 14:79068446-79068468 CATGGTCTAGAGAATTAAGTAGG - Intronic
1125478176 15:40061856-40061878 CAAGGCCTACAGAATTGAGCTGG + Intergenic
1127555291 15:60081745-60081767 AATGCCCTAGAGAATTGATATGG + Intergenic
1128360325 15:66957238-66957260 AATGGCCTGGAAAAGCCAGCTGG + Intergenic
1132265664 15:100468428-100468450 CATGGTCTAAAGAATGCAGCTGG + Intronic
1133164933 16:3939522-3939544 TATGGCCTAGAGACTTCATAGGG + Intergenic
1134072392 16:11268890-11268912 AATGGCCAAGAGGATCCAGCAGG - Exonic
1134269992 16:12724706-12724728 AATGGCATGGACACTTCAGCTGG - Intronic
1135945476 16:26861151-26861173 AAGAGCTCAGAGAATTCAGCAGG - Intergenic
1136405241 16:30041870-30041892 AATGGTCTAGAAAATTCCACAGG - Intronic
1138305531 16:55971212-55971234 AATGGCTTAGAGAATTAACCAGG + Intergenic
1139800940 16:69522199-69522221 AAAGGCCCAGAGAAATGAGCCGG + Intergenic
1140666975 16:77236652-77236674 AATCACCTAGAGTATTAAGCGGG - Intergenic
1140926244 16:79587005-79587027 AGCAGCCTAGAGAATTCAGCAGG - Intronic
1142182347 16:88677398-88677420 AATGGCCAAGAGGCTCCAGCTGG - Intergenic
1148246232 17:46032532-46032554 AAGTGCCTAGTGAATTCAGGAGG + Intronic
1149383909 17:56123207-56123229 CATGGGCTACAGAATGCAGCTGG - Intronic
1150271933 17:63872423-63872445 AAGGGCCTGGAGGATTCACCAGG + Intronic
1150275480 17:63895319-63895341 AAAGGCCTGGAGGATTCACCAGG + Intronic
1157228160 18:45887336-45887358 ACTGGCCTAAAGAATTCAGCTGG - Intronic
1162249162 19:9428047-9428069 AGTGGTCTAGAGACTCCAGCAGG - Intronic
1164189950 19:22905137-22905159 ATTGGCTTATAGAATTCACCTGG + Intergenic
1164589220 19:29497119-29497141 ATTAGCCTTGAGAATTGAGCAGG - Intergenic
1164692486 19:30222026-30222048 AGTGGCCTTGAGGATTCCGCAGG + Intergenic
929714442 2:44296132-44296154 AATGGGCTAGAGAAGTCTGGTGG - Intronic
929930294 2:46250270-46250292 AAAAGCCTAGAGAATTCATCAGG - Intergenic
930188954 2:48438546-48438568 AATGGCTAAGAGACTTCAACAGG - Intergenic
931617138 2:64171147-64171169 AATTGCCTACAGTATTCAGTAGG + Intergenic
931825929 2:66001010-66001032 ATTGGCCTAGATAATTTGGCTGG - Intergenic
935007397 2:99092805-99092827 AATGTCTGATAGAATTCAGCTGG - Intronic
935189793 2:100767993-100768015 CATGGCCTTGTGAATTCACCGGG + Intergenic
935247428 2:101231150-101231172 AATGGGCAAGAGACTTCAGTGGG + Intronic
936501233 2:113067953-113067975 AATGCCCTGGAGAAATCAGTTGG + Intronic
936865549 2:117072595-117072617 AGTGGCCTATGGAAGTCAGCTGG - Intergenic
946312089 2:218887722-218887744 AATGGCCCAAAAAATGCAGCAGG + Intronic
946537460 2:220647199-220647221 ACTGTCCTAGGGAATACAGCTGG - Intergenic
948005196 2:234602568-234602590 CATGGCCTTGAGCTTTCAGCTGG + Intergenic
949082756 2:242117897-242117919 GATGTCCTAGAGAAAGCAGCTGG - Intergenic
1174277929 20:49417172-49417194 AAAGGCCTAGGGGATCCAGCTGG + Intronic
1175040317 20:56043520-56043542 AATGGCCTTGAGTACACAGCTGG + Intergenic
1175067253 20:56299890-56299912 ACTGGCCTGAAGAAATCAGCAGG - Intergenic
1175156290 20:56973701-56973723 CATGTCCTTGAGATTTCAGCAGG + Intergenic
1181387076 22:22554203-22554225 AATGGCCTGGAGAATTCTTTGGG - Intronic
1181624916 22:24116733-24116755 GATGGCCTAGTGAACTCAGGGGG - Intronic
949328883 3:2899164-2899186 AAGGGCCTAGAGACCTCTGCTGG + Intronic
951088859 3:18547964-18547986 AATGGCTTAAAGAGTTTAGCTGG + Intergenic
953687495 3:45089540-45089562 GATGGCTTGGAGAATTCAACTGG - Intronic
956042733 3:65162648-65162670 TTTGGACTATAGAATTCAGCAGG + Intergenic
959765850 3:110027099-110027121 AAAGGCCTACATAATTCTGCAGG - Intergenic
960598727 3:119433650-119433672 AATGGCCTAGAGAATTCAGCTGG + Intronic
963364578 3:144319082-144319104 AATTGCAGGGAGAATTCAGCTGG - Intergenic
964024401 3:152054694-152054716 AATGGCCTACAGTCTTCAGGGGG + Intergenic
964110709 3:153084475-153084497 AATGGCTTAGAGAATTCTGTAGG + Intergenic
971403458 4:26298092-26298114 AATGGCCTACGGCATTCAGTTGG - Intronic
971885036 4:32433687-32433709 AATGGCAAAGAGAAATCAGCAGG + Intergenic
972722130 4:41710580-41710602 AAAGGCCTACACAATTCTGCAGG + Intergenic
972752133 4:42000656-42000678 AATGGCTCAGAGAATTCATCAGG - Intronic
975138504 4:70897570-70897592 AATGACCTATAGGATTCAGATGG + Intergenic
978470288 4:109058770-109058792 AATGGCCCAGATATTTAAGCGGG + Intronic
982910154 4:161130980-161131002 AATGGCTTACAGAATTGAGATGG + Intergenic
983893090 4:173051431-173051453 AATGTCCTAGAGGAAGCAGCAGG + Intergenic
985968423 5:3355505-3355527 AATTGCTTAGAGAATGCACCTGG - Intergenic
995355892 5:111237364-111237386 GATCGCCCAGAGAATTCAACTGG - Intronic
996498799 5:124192849-124192871 AATGACTTATAAAATTCAGCAGG + Intergenic
996521469 5:124431144-124431166 AATGTCTGATAGAATTCAGCAGG - Intergenic
1000441592 5:161270348-161270370 AATGGCCTAGAGAGTTCTGAAGG - Intergenic
1013210228 6:107980328-107980350 AATGGTCTAGAGCTTTCATCAGG - Intergenic
1015162376 6:130168019-130168041 AATGGCAAAGAGAATGCAGTGGG + Intronic
1016459306 6:144265440-144265462 AATCCCATAGAGAAATCAGCAGG + Intergenic
1017528102 6:155260580-155260602 AATGACATGGAGAAATCAGCCGG + Intronic
1018034261 6:159867832-159867854 CATTCCCTAGAGACTTCAGCGGG + Intergenic
1022419013 7:30202875-30202897 ATTGGCCCAGAGAAGGCAGCAGG + Intergenic
1022438405 7:30411915-30411937 AATGGACTAGAGGATTCAAGTGG + Intronic
1027337169 7:77163696-77163718 AATAACCTAGAGAGTTCAGAGGG + Intronic
1027419549 7:78006033-78006055 AATGGAGTAGAGACTTCAGAGGG - Intergenic
1028158414 7:87458169-87458191 AATAGTCTAGAAAATTCTGCGGG - Intronic
1028314200 7:89379613-89379635 ATTTGCCTAGACAGTTCAGCTGG + Intergenic
1028997821 7:97120897-97120919 AATAGTAGAGAGAATTCAGCTGG + Intronic
1029007913 7:97229935-97229957 TATCACCTAGAGAATTCAGAGGG - Intergenic
1030257518 7:107527777-107527799 ACTGGCCTAGAGAAGAAAGCTGG - Intronic
1031868931 7:127071331-127071353 GATATCCTAGAGTATTCAGCAGG + Intronic
1034020731 7:147639359-147639381 AATTGCCTAAAGAATCCAACAGG + Intronic
1034908338 7:154971107-154971129 ATTGGCCAAGAGGACTCAGCAGG + Intronic
1035540680 8:434600-434622 GATGTCCTAGAGAAAGCAGCTGG - Intronic
1037044878 8:14286414-14286436 AATGACATAGATAACTCAGCTGG + Intronic
1039748209 8:40451914-40451936 AATGTCTGATAGAATTCAGCTGG + Intergenic
1050988768 9:12119028-12119050 AAAGTCCTAGAAAATTCATCTGG + Intergenic
1051080300 9:13286302-13286324 AATGGCCAAGAGAAGCCACCAGG + Intergenic
1055806513 9:80100827-80100849 ATTGACCTAGAGATTTTAGCGGG - Intergenic
1056517806 9:87371730-87371752 AAAGGCCTAGAGCATCCTGCAGG + Intergenic
1057496618 9:95566093-95566115 AATGGCCCAGACCATACAGCAGG + Intergenic
1058173921 9:101716045-101716067 AATGGACTTGAGAATTCTTCTGG - Intronic
1058433622 9:104941395-104941417 AAAGGCATAGTAAATTCAGCAGG + Intergenic
1059449055 9:114358617-114358639 CAAGGCCTAGAGCATTTAGCAGG - Intronic
1185741458 X:2536333-2536355 AATGACATACAGAAATCAGCAGG + Intergenic
1185795498 X:2961058-2961080 AAAGGCCTAGAGGACTCTGCAGG + Intronic
1189081543 X:37978129-37978151 AATGGACCAGAGAAACCAGCAGG + Intronic
1189795143 X:44638784-44638806 AATGACCTGGAGAATGGAGCTGG + Intergenic
1190640505 X:52479435-52479457 AAGTGCCAAGAGAATTCAGTGGG - Intergenic
1190647167 X:52533430-52533452 AAGTGCCAAGAGAATTCAGTGGG + Intergenic
1192113258 X:68386789-68386811 ATTGGCTAAGAGAAGTCAGCTGG - Intronic
1193872150 X:86812930-86812952 AATGGTCCAGGGAATCCAGCGGG - Exonic
1194231325 X:91328020-91328042 GATGGCCTAGGAAATACAGCAGG + Intergenic
1197569029 X:128126886-128126908 TATAGCCAAAAGAATTCAGCGGG + Intergenic
1200768378 Y:7101038-7101060 ACTGGCCTAGAAAATTCTGTAGG - Intergenic
1201794621 Y:17881680-17881702 CATGGCCAAGAAAATTCAGGAGG + Intergenic
1201806934 Y:18024305-18024327 CATGGCCAAGAAAATTCAGGAGG - Intergenic