ID: 960601343

View in Genome Browser
Species Human (GRCh38)
Location 3:119462048-119462070
Sequence ACTAGGGCCCCTCCTTCCAC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 157}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960601336_960601343 27 Left 960601336 3:119461998-119462020 CCAACCAAAGTCTGCAAAGAAGG 0: 1
1: 0
2: 0
3: 14
4: 180
Right 960601343 3:119462048-119462070 ACTAGGGCCCCTCCTTCCACCGG 0: 1
1: 0
2: 1
3: 15
4: 157
960601335_960601343 30 Left 960601335 3:119461995-119462017 CCACCAACCAAAGTCTGCAAAGA 0: 1
1: 0
2: 0
3: 19
4: 175
Right 960601343 3:119462048-119462070 ACTAGGGCCCCTCCTTCCACCGG 0: 1
1: 0
2: 1
3: 15
4: 157
960601338_960601343 23 Left 960601338 3:119462002-119462024 CCAAAGTCTGCAAAGAAGGTAAA 0: 1
1: 0
2: 1
3: 35
4: 650
Right 960601343 3:119462048-119462070 ACTAGGGCCCCTCCTTCCACCGG 0: 1
1: 0
2: 1
3: 15
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960601343 Original CRISPR ACTAGGGCCCCTCCTTCCAC CGG Exonic
900808560 1:4784097-4784119 TCTGGGGCCCCTGTTTCCACTGG - Exonic
901150183 1:7096155-7096177 TCTAGACCCCCTCCTTCTACTGG - Intronic
903306451 1:22416589-22416611 GCTCTGGCACCTCCTTCCACAGG + Intergenic
904037112 1:27564893-27564915 TCTAGGGCCCCTCGTTTTACAGG + Intronic
906886408 1:49653159-49653181 ACTTGGGTCCCTCCTGCCCCTGG - Intronic
910251065 1:85200451-85200473 AGGAAGGCCCCTCCTTCCTCAGG - Exonic
911855374 1:102869348-102869370 ACAAGAGCCCCTCCTATCACAGG - Intergenic
912529405 1:110309434-110309456 TCTAGGCTCTCTCCTTCCACAGG - Intergenic
913133642 1:115865592-115865614 ACTAAGGTCCTTCCTTCCTCCGG - Intergenic
914927195 1:151898543-151898565 TCTAGGGCCCCGCCCACCACCGG + Intronic
917159326 1:172040043-172040065 ACAAGGTCCTCTCCTACCACAGG - Intronic
919811725 1:201412936-201412958 GGGAGGTCCCCTCCTTCCACAGG - Intronic
920581235 1:207109728-207109750 ACTGGTTCTCCTCCTTCCACAGG - Intronic
920676116 1:208039849-208039871 GCTAAAGCCCTTCCTTCCACTGG - Intronic
921727337 1:218538372-218538394 ACAAGGGCCCCACCTCCCAAAGG - Intergenic
922096212 1:222445118-222445140 ACAAGGGCCCCGCCTTCCTTGGG + Intergenic
922891115 1:229062527-229062549 ACTCGGACCCCGCTTTCCACGGG - Intergenic
924302300 1:242652037-242652059 TCTAGGGCCCCACCTACCACTGG - Intergenic
1065473501 10:26108900-26108922 ACTAGGGCCCTGCCTTACAAGGG + Intronic
1065749330 10:28871214-28871236 ACTAGGGTCCCTCCTTCTGGGGG + Intronic
1067128518 10:43540829-43540851 AGTTTGGCCCCTCCTTCCTCAGG + Intergenic
1067208336 10:44238503-44238525 AGGAGGGTCCCTCCTTCAACTGG - Intergenic
1070820163 10:79349707-79349729 ACAAAGGCTCCACCTTCCACAGG + Exonic
1075372458 10:121949552-121949574 ACTTGGGCCCCTTCTACCTCAGG - Intergenic
1078547524 11:12256879-12256901 CCGAGGGCCACTTCTTCCACCGG + Exonic
1087171079 11:95050680-95050702 ACAAGGACCCCACCTTCCAGTGG - Intergenic
1089116941 11:116103026-116103048 CCTAGGGCCACTCCTGCCCCTGG + Intergenic
1096535919 12:52274608-52274630 ACTAGGGCCTCTTCTTCCTGGGG - Intronic
1102159461 12:110756833-110756855 CCTAGAGCCATTCCTTCCACAGG + Intergenic
1106041414 13:26097092-26097114 GCGTGGGCCCCTCCTTACACAGG - Intergenic
1107549225 13:41458831-41458853 ACTGTGCCCCCTCATTCCACTGG - Intronic
1113558280 13:111255807-111255829 ACCATGACCCCACCTTCCACAGG - Intronic
1113808308 13:113122662-113122684 ACTCTGGCCCCACCTTCCCCAGG - Intergenic
1118319929 14:64747120-64747142 ACTAGAGCCCTTCCTTTCTCGGG + Exonic
1118350382 14:64969575-64969597 TCTAGGGTCCCCCTTTCCACAGG - Intronic
1119998635 14:79279250-79279272 GCTCTGGCCCCTCCTTCCTCCGG + Intronic
1120078575 14:80188409-80188431 CATAGGGCCCTTCCTTCCTCTGG + Intergenic
1120759367 14:88272064-88272086 ACGATGGCCCCACCCTCCACAGG + Intronic
1121429969 14:93879586-93879608 GTTAGGGCCCCTCCCTCCTCTGG - Intergenic
1122048406 14:99039332-99039354 ACTCTGGCCCCTCATTCCTCAGG - Intergenic
1122079416 14:99256707-99256729 TCTAGGGCCCCTCTGTCCCCAGG - Intronic
1122819629 14:104334987-104335009 CCTGTGGCCCCTCCTGCCACAGG + Intergenic
1124674103 15:31669186-31669208 TCTAGGGCCCCACCCACCACTGG - Intronic
1127922022 15:63501910-63501932 ATTAGGGCCCCTGCTCCCAAGGG + Intergenic
1129452150 15:75657225-75657247 CCTGGGCCCCCTCCTTCCCCTGG + Exonic
1129921392 15:79322229-79322251 TCTAGGGCCCCTCATGCCCCAGG + Exonic
1130043343 15:80424485-80424507 AGTCAGGTCCCTCCTTCCACGGG + Intronic
1136296561 16:29307371-29307393 ACATGGGGCCCTCCTTGCACAGG + Intergenic
1136736864 16:32474339-32474361 CCTAGGGCCCCGGCTCCCACTGG - Intergenic
1137500139 16:49004770-49004792 ACTTGGGACCCTCATTCCAGAGG + Intergenic
1137619981 16:49869739-49869761 TCCAGGGCCCCTCCCTCAACAGG - Intergenic
1138619302 16:58198359-58198381 ACAGGAGCCCCCCCTTCCACTGG + Intergenic
1141587122 16:85041741-85041763 CCCAGGGTCCCTCCTTCCCCGGG - Intronic
1141701089 16:85642471-85642493 CCTGGGGACCCTCCTTCCAAGGG + Intronic
1142058185 16:88013682-88013704 ACATGGGGCCCTCCTTGCACAGG + Intronic
1203016205 16_KI270728v1_random:355238-355260 CCTAGGGCCCCGGCTCCCACTGG + Intergenic
1203034540 16_KI270728v1_random:628396-628418 CCTAGGGCCCCGGCTCCCACTGG + Intergenic
1143509920 17:7389844-7389866 ACTAGGGCCCTGCCTTCAGCTGG - Exonic
1144619463 17:16807790-16807812 CCTGTGGCCCATCCTTCCACTGG + Intergenic
1144623513 17:16832866-16832888 AGGAGGGCCCCGCCTTCCCCAGG - Intergenic
1144882918 17:18439850-18439872 AGGAGGGCCCCGCCTTCCCCAGG + Intergenic
1145149313 17:20504536-20504558 AGGAGGGCCCCGCCTTCCCCAGG - Intergenic
1147040110 17:37711889-37711911 GCTAGAGCCCCACCTTCCAGAGG + Intronic
1147055729 17:37833444-37833466 CCTGTGGCCCATCCTTCCACCGG - Intergenic
1147157397 17:38551153-38551175 ACCTGAGCCCCTCCTCCCACTGG + Exonic
1147257669 17:39191776-39191798 ACTAGGGCCACACTTTCCCCAGG - Intronic
1147367795 17:39970778-39970800 AAAAGGGCCACTCCTTCCCCCGG + Intronic
1151967659 17:77439812-77439834 CCTGGGGCGCCTCCTTCCCCTGG + Intronic
1158203637 18:54966829-54966851 CCTAGGGCCCTTCCCTCAACAGG + Intergenic
1160630541 18:80244220-80244242 ACTTTGGCCTCTCCTTCCACAGG - Intronic
1161021659 19:2014149-2014171 TCCAGGACCCCTCCTTCCCCAGG - Intronic
1161267996 19:3373920-3373942 CCTTGGGCCGCTCCTTCCCCTGG - Intronic
1161801275 19:6417921-6417943 ACCCCGGCCCCTCCCTCCACTGG + Intronic
1163086042 19:14980047-14980069 ACTAGAGCCGCGCCTTCCCCAGG - Intronic
1163650716 19:18516151-18516173 AGTAAGGCTCCTCCTGCCACCGG + Intronic
1164411845 19:28012697-28012719 ACCAGGACCCCTCCTGCCATGGG + Intergenic
1164516864 19:28944007-28944029 ACCTGGACCCCTCCTGCCACGGG + Intergenic
1165832942 19:38738181-38738203 ATTAGGACCCATCCTTCAACTGG + Intronic
1165900793 19:39168375-39168397 ACCTGGGCCCCTCCTCCCACAGG + Intronic
1166052370 19:40267999-40268021 ACCAGGCCCCCTCCTGCCTCAGG - Intronic
925065075 2:923121-923143 ACCAGGGCTCTTCCTTCCACGGG + Intergenic
925291443 2:2751084-2751106 ACCAGGGCCCCTTTCTCCACTGG + Intergenic
927105510 2:19820185-19820207 ACTGTGGCCCCTGCTTGCACTGG + Intergenic
927214014 2:20656029-20656051 AGTAGGGCCCCCTCTTCCAGAGG + Intergenic
932100632 2:68896477-68896499 TCTAGGGCCCCACCCACCACTGG - Intergenic
933240971 2:79919779-79919801 GCTGGGGCCCCTCCTTGCTCAGG + Intronic
935830017 2:106992253-106992275 ACTGGGGCCCCTTCTTGCATAGG + Intergenic
940592631 2:155748752-155748774 ACTATGGCCACCCCTCCCACTGG - Intergenic
941987847 2:171525477-171525499 ATTACTCCCCCTCCTTCCACTGG - Intronic
942421125 2:175809032-175809054 TCTAAGTTCCCTCCTTCCACAGG - Intergenic
944518217 2:200533859-200533881 TCTAGGGCCACTCCTTACACTGG + Intronic
946135723 2:217645406-217645428 GCTAGGGTCCCTCCTTCCAGAGG - Intronic
1168836557 20:881533-881555 ACTAGGGCCCTTCCTACCTTGGG - Intronic
1169447996 20:5688426-5688448 ATAAGGGCCCCTACTTCCAAGGG - Intergenic
1173210274 20:41026975-41026997 ACTACTGACCCTGCTTCCACTGG - Intergenic
1174756099 20:53160074-53160096 ACTATGTGCCCTCCTACCACTGG - Intronic
1175342413 20:58242021-58242043 ACACAGGCCCCGCCTTCCACTGG + Intergenic
1175479648 20:59301959-59301981 GGGAGGGCTCCTCCTTCCACAGG - Intronic
1176143003 20:63553463-63553485 ACTACGGCCCCTCCCACCACAGG - Intronic
1176143025 20:63553525-63553547 ACCACGGCCCCTCCCACCACAGG - Intronic
1177845520 21:26283719-26283741 GTTAGTGCTCCTCCTTCCACTGG + Intergenic
1181333206 22:22110806-22110828 ACCCGGGCAGCTCCTTCCACAGG - Intergenic
1184602764 22:45553190-45553212 TCTAGGCCCCCTCCTTCTCCTGG - Intronic
1184781869 22:46653687-46653709 ACTTTGGCCCCTCCCTGCACGGG - Intronic
1184865291 22:47198845-47198867 CTTGGAGCCCCTCCTTCCACAGG - Intergenic
1184916819 22:47575028-47575050 TATAGGTCCCCTCCTTCCTCTGG + Intergenic
954904894 3:54052714-54052736 ACTATGGTTCCTGCTTCCACAGG - Intergenic
955461594 3:59189541-59189563 TCTAGGGCCCCACCCACCACTGG - Intergenic
960601343 3:119462048-119462070 ACTAGGGCCCCTCCTTCCACCGG + Exonic
961654788 3:128435289-128435311 ACAAGCCCCCCACCTTCCACTGG - Intergenic
962065994 3:131981227-131981249 TCTAGGGCCCCACCCACCACCGG - Intronic
962717309 3:138137743-138137765 GCTGAGGCCACTCCTTCCACAGG - Intergenic
963515397 3:146301803-146301825 ACTAGGGCTCCACAATCCACAGG - Intergenic
964601229 3:158503422-158503444 TCTAGGGCCCCGCCCACCACTGG - Intronic
968272989 3:197419001-197419023 ACTAGGGACTCCCTTTCCACCGG - Intergenic
968333087 3:197887962-197887984 ACAAAGGCCCCTCTTTCCATGGG - Intronic
969535942 4:7756158-7756180 ACTGGGCTCCCTCCCTCCACGGG - Intergenic
971725510 4:30307013-30307035 ACAAGGGCCTTCCCTTCCACAGG + Intergenic
973782428 4:54300888-54300910 TCTAGGGCTCCGCCCTCCACTGG + Intergenic
977229199 4:94431686-94431708 ACATGGGCCCAGCCTTCCACTGG - Intergenic
982075025 4:151730381-151730403 TCTAGGGCCCCGCCCACCACTGG + Intronic
984608012 4:181806817-181806839 ACTAGGGCCTTTGCTTCCATGGG + Intergenic
984721719 4:182978564-182978586 TCTAGGGCCCCGCCCACCACCGG + Intergenic
984734331 4:183097300-183097322 ACCAGGGCGTCTCATTCCACCGG + Intergenic
985216152 4:187656454-187656476 AATAGGGCCCTGCCTCCCACTGG - Intergenic
985959017 5:3285746-3285768 ATTAGGGACCCTCCCCCCACAGG + Intergenic
986243153 5:5979651-5979673 ACAAGGGCCCCTCCTGGTACAGG + Intergenic
987577755 5:19752634-19752656 TCTAGGGCCCCACCTGCCATGGG + Intronic
989608889 5:43272863-43272885 AGTAGAGCCACCCCTTCCACTGG + Intronic
991496996 5:67236576-67236598 ACTGGCATCCCTCCTTCCACAGG - Intergenic
991923903 5:71684531-71684553 TCTAGGGCCCCACCCACCACCGG + Intergenic
996010783 5:118479299-118479321 TCTAGGGCCCCACCTGCCACTGG + Intergenic
996657843 5:125962864-125962886 AATAAGGCCCCTCCTTCTAAAGG + Intergenic
1002348084 5:178561898-178561920 ACCAGGGCACCTCCAGCCACCGG + Intronic
1003029403 6:2589107-2589129 TCTAGGGCCCCTCCCACCACTGG - Intergenic
1004177805 6:13355265-13355287 CCTAGGGTCCCTCCTTCCCAGGG + Intergenic
1005372799 6:25153064-25153086 ACTATGTCCCCTCCTTGCCCAGG - Intergenic
1005844078 6:29763715-29763737 ACTGGTGCCCAGCCTTCCACAGG + Intergenic
1005873670 6:29995540-29995562 ACTGGTGCCCAGCCTTCCACAGG + Intergenic
1006058738 6:31404171-31404193 AGTAGGGGCCCTCCTTTCTCGGG + Intronic
1006134675 6:31888307-31888329 ACTGGGGCCCCCTCTGCCACAGG + Intronic
1006378236 6:33683578-33683600 ACTGGGGAACCTCCTTCCAGAGG + Intronic
1006614784 6:35318716-35318738 ACCAGGCCCCATCCATCCACGGG - Intronic
1006643697 6:35501983-35502005 ACCAGGGCCCCTCCTGCCACAGG + Intronic
1018450270 6:163901167-163901189 ACCAGGACCTCTCATTCCACAGG - Intergenic
1018472739 6:164111208-164111230 GCTCGGGCCCATCTTTCCACTGG + Intergenic
1019649694 7:2150173-2150195 ACTGGGACCTCTCCTTCCAGGGG - Intronic
1024398382 7:48894705-48894727 ACTATGGCCCCTTCTGCCAGGGG + Intergenic
1025638856 7:63349276-63349298 CCTTGAGCCCCTCCTTCCTCAGG + Intergenic
1025643843 7:63398816-63398838 CCTTGAGCCCCTCCTTCCTCAGG - Intergenic
1027950075 7:84804132-84804154 ACCAGGCCCACTCCTCCCACAGG - Intergenic
1028684322 7:93575257-93575279 ACTACCGACCCTCCCTCCACAGG - Intergenic
1029149129 7:98467724-98467746 ACCAGGTCCTCTCATTCCACTGG + Intergenic
1035203971 7:157282591-157282613 ACTCGGGCCCTGCCTTCCAGGGG - Intergenic
1035483040 7:159202547-159202569 CTTAGGGCCCCTTGTTCCACTGG - Intergenic
1036093149 8:5691255-5691277 ACTAGGCCACCTCCTAACACAGG + Intergenic
1039083261 8:33755208-33755230 TCTAGGGCCCCACCCACCACTGG - Intergenic
1039641490 8:39227785-39227807 TCTAGGGCCCCACCCACCACTGG + Intronic
1049263149 8:141650616-141650638 ACAAAGGCCACTCCTGCCACAGG - Intergenic
1051210344 9:14735619-14735641 TCAAGGGCCACTCCTTCCACTGG - Exonic
1052246905 9:26347177-26347199 TCTAGGACCCCACCTTCCACCGG + Intergenic
1052276572 9:26683318-26683340 ACAGGGGACCCTCCTTCCACAGG - Intergenic
1056568141 9:87792899-87792921 ACTATGGGCCCTGCTTCCTCAGG - Intergenic
1058064527 9:100534102-100534124 ACTAGGGACACTCCTGCCTCAGG - Intronic
1058976185 9:110127442-110127464 ACACGGGCCCCTAGTTCCACAGG + Intronic
1059609577 9:115878188-115878210 TCTAGGGCCCCGCCCACCACTGG - Intergenic
1062493708 9:136821813-136821835 ACGAGGGCCCAGCCTTCCGCGGG + Intronic
1187219167 X:17307607-17307629 TCTAGGGCCCCACCTACCACTGG - Intergenic
1189179603 X:38991199-38991221 ACTAGAGCCACTCCTTCCTCAGG - Intergenic
1191067595 X:56367024-56367046 TCTAGGGCCCTGCCTACCACTGG - Intergenic
1192979022 X:76318985-76319007 TCTAGGGCCCCACCAACCACTGG - Intergenic
1195795484 X:108642343-108642365 TCTAGGGCCCCACCTACCACTGG + Intronic
1196176473 X:112644219-112644241 TCTCTGGCCCCTCCTTCCATGGG + Intronic
1200018388 X:153182046-153182068 CCAAGGGCCCCACCTGCCACAGG + Intronic