ID: 960601357

View in Genome Browser
Species Human (GRCh38)
Location 3:119462104-119462126
Sequence TTAACCTGGGTTGCAACTAC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 60}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960601357 Original CRISPR TTAACCTGGGTTGCAACTAC AGG (reversed) Exonic
903597740 1:24508661-24508683 TGACACTGGGTTTCAACTACAGG + Intronic
905150849 1:35926241-35926263 TTAACTTGAGTAGCAACCACAGG - Exonic
917469151 1:175311255-175311277 ACAACCTGGGTTGCAATTAAAGG - Intergenic
918862677 1:189852196-189852218 TTAACCAGGCATGCAACCACAGG - Intergenic
1069682613 10:70296071-70296093 TTAAACTGGGTTGCAAGTTCCGG - Intergenic
1075464893 10:122643795-122643817 TTAACATGGGTGACAACAACAGG - Intergenic
1080338887 11:31233399-31233421 TTAACCAGTGTTGAAAATACAGG - Intronic
1080639282 11:34149403-34149425 TGAGCATGGGTTGCATCTACAGG - Intergenic
1083465503 11:62842883-62842905 TTAACCTGGGTTGGAAATAGAGG + Intergenic
1083821005 11:65171388-65171410 TCTACCTGGGTGGTAACTACAGG - Exonic
1084333179 11:68441570-68441592 TTAAGCTGGGTTGCAGCAGCAGG - Intronic
1087328186 11:96748480-96748502 TTTACCTGGGCTGCAACTATGGG + Intergenic
1089592951 11:119556492-119556514 TTAAGCTGGGAGGCAACTAGGGG + Intergenic
1091590425 12:1839497-1839519 TGAACCTGGGTTCCAACGAGAGG + Intronic
1108590671 13:51910555-51910577 TAACCCTGGGTAGCAACTGCAGG + Intergenic
1108701182 13:52945591-52945613 TTCTCCTGGTTTGCAACTTCTGG - Intergenic
1121155027 14:91675141-91675163 TCAACCTGGTTTGCAACGAGTGG + Intronic
1126343461 15:47668778-47668800 TCAACCTGGGTGGGAACTGCAGG - Intronic
1128620237 15:69142794-69142816 TCAACCTTGGTTGCAGCTAAGGG - Intergenic
1128792106 15:70441086-70441108 TTCACCTGGGTAGCAATCACAGG + Intergenic
1133488289 16:6241624-6241646 TTAAATAGAGTTGCAACTACAGG + Intronic
1133605136 16:7379690-7379712 TTAAGCTGGGTAGTAACTACAGG + Intronic
1149353101 17:55811877-55811899 TTAACTTGGGTTTCAACTAAAGG - Intronic
1149784044 17:59420841-59420863 CTAACCTGGGTTCTACCTACAGG - Intergenic
1153480397 18:5542697-5542719 TAACCCTGGGCTGCAACTAACGG + Intronic
929482202 2:42320575-42320597 TGAGCCTGGGTTGTACCTACGGG + Intronic
936023709 2:109015222-109015244 ACAACCTGGGTTTGAACTACTGG + Intergenic
940247439 2:151634702-151634724 TTCTCCTCGGTTGCTACTACAGG - Intronic
940765522 2:157785922-157785944 TTAACCTGGCCTACAACTGCTGG + Intronic
942024302 2:171897203-171897225 AAAACTTGGGTTGCAGCTACAGG + Intronic
946900303 2:224365869-224365891 TTGGCCTGGTTTGCAACCACGGG - Intergenic
1169350829 20:4866695-4866717 TTAACCTTGATTGCAAATCCAGG - Intronic
1176931552 21:14817707-14817729 TTAACCTGTGTTTGAAGTACTGG - Intergenic
955555642 3:60134239-60134261 TGAACCTGTTTTGCAAATACTGG - Intronic
955975444 3:64475551-64475573 GTTACCTGGGTTGCTAATACTGG + Intergenic
957194129 3:77046104-77046126 TTAACCTGGGATGGAAATGCTGG + Intronic
960601357 3:119462104-119462126 TTAACCTGGGTTGCAACTACAGG - Exonic
962718446 3:138149396-138149418 GTAACCTGGGTGGTAATTACAGG + Intergenic
964835430 3:160933004-160933026 ATAACCTGTGTTGCAAATACTGG - Intronic
970061520 4:12039371-12039393 TTTACATGGGTTGGACCTACAGG + Intergenic
973316676 4:48767823-48767845 TAATCCTGGATTGCAGCTACGGG + Intronic
974412298 4:61557058-61557080 TTTACCAGTGTTGAAACTACTGG - Intronic
977402938 4:96557268-96557290 TTATCCTGGTTTGCAATTAAAGG - Intergenic
978670359 4:111241182-111241204 TGCACCTGGCCTGCAACTACTGG + Intergenic
982260540 4:153490447-153490469 TTAACCTGGGTTGTAAATTCAGG + Intronic
982329506 4:154165476-154165498 TTCACGTGTGTTGCCACTACAGG + Intergenic
992777333 5:80099960-80099982 TTAACCTGGGGTCCAAGGACTGG - Intergenic
997747801 5:136314962-136314984 TTAATCTGAGTAGCCACTACAGG + Intronic
998987469 5:147776620-147776642 TTAACCAAGGTTAAAACTACAGG + Intronic
999709364 5:154302694-154302716 TGAACCTGTGTTGCAACAAAAGG + Intronic
1002821044 6:724790-724812 TTGAGCTGGGTTGCCACTATGGG - Intergenic
1005377538 6:25199316-25199338 TGAACATGGGATGCAACTGCTGG - Intergenic
1008495245 6:52126180-52126202 TTAGGCTGGATTGCAACTCCTGG - Intergenic
1019181381 6:170189054-170189076 TTAACATAGATTGCAACTCCAGG + Intergenic
1023332315 7:39131358-39131380 TTAACCTGGGTTAATACTTCAGG + Intronic
1024750786 7:52462695-52462717 TTAACCTGGGTAGTAACTCAGGG + Intergenic
1030416898 7:109256664-109256686 TTAAACTGGGTTTTAACTCCAGG + Intergenic
1031615979 7:123880057-123880079 TTAATTTGGGCTGCTACTACTGG + Intergenic
1032920745 7:136543729-136543751 TTAACTGAGGTTGCAACTAGAGG + Intergenic
1046615750 8:116475332-116475354 TTACCCTGGGTTGCAACAGATGG - Intergenic
1048238716 8:132719110-132719132 TTGATCTGGGTAGCAATTACAGG - Intronic
1050508116 9:6368546-6368568 ATAACTTAGGTTCCAACTACTGG - Intergenic
1053394506 9:37760672-37760694 TTAACAAGGGTTGCCACTAGAGG + Intronic
1055090182 9:72356456-72356478 TTATCCTGCGTTGCATCTACAGG - Intronic
1061348613 9:130045991-130046013 TTAATCTGGGTTGCAGATACTGG + Intergenic
1061752284 9:132787824-132787846 TTAACTTGGGAAGCAACTAGAGG + Intronic
1191715040 X:64188405-64188427 TTAAACTAGGTTGGAAATACTGG - Exonic
1195323869 X:103742579-103742601 TTAACCTGTTTTGCCACTCCAGG + Intergenic
1195955095 X:110319889-110319911 TTAACCTCGGTTCCACCTGCTGG - Intronic
1199502425 X:148522186-148522208 GAAACATGGGTTGCACCTACTGG + Intronic