ID: 960602126

View in Genome Browser
Species Human (GRCh38)
Location 3:119468982-119469004
Sequence CAGATTCCCCGCTGCGGCGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 82}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960602126_960602129 -8 Left 960602126 3:119468982-119469004 CCAGCGCCGCAGCGGGGAATCTG 0: 1
1: 0
2: 0
3: 6
4: 82
Right 960602129 3:119468997-119469019 GGAATCTGCAGTAGGTCTGCCGG 0: 1
1: 0
2: 0
3: 11
4: 134
960602126_960602133 7 Left 960602126 3:119468982-119469004 CCAGCGCCGCAGCGGGGAATCTG 0: 1
1: 0
2: 0
3: 6
4: 82
Right 960602133 3:119469012-119469034 TCTGCCGGCGATGGAGTGGTGGG 0: 1
1: 0
2: 0
3: 2
4: 67
960602126_960602135 24 Left 960602126 3:119468982-119469004 CCAGCGCCGCAGCGGGGAATCTG 0: 1
1: 0
2: 0
3: 6
4: 82
Right 960602135 3:119469029-119469051 GGTGGGCTAGCTCGCCGCTTCGG 0: 1
1: 0
2: 0
3: 0
4: 25
960602126_960602130 -2 Left 960602126 3:119468982-119469004 CCAGCGCCGCAGCGGGGAATCTG 0: 1
1: 0
2: 0
3: 6
4: 82
Right 960602130 3:119469003-119469025 TGCAGTAGGTCTGCCGGCGATGG 0: 1
1: 0
2: 0
3: 1
4: 29
960602126_960602131 3 Left 960602126 3:119468982-119469004 CCAGCGCCGCAGCGGGGAATCTG 0: 1
1: 0
2: 0
3: 6
4: 82
Right 960602131 3:119469008-119469030 TAGGTCTGCCGGCGATGGAGTGG 0: 1
1: 0
2: 0
3: 5
4: 40
960602126_960602136 30 Left 960602126 3:119468982-119469004 CCAGCGCCGCAGCGGGGAATCTG 0: 1
1: 0
2: 0
3: 6
4: 82
Right 960602136 3:119469035-119469057 CTAGCTCGCCGCTTCGGCTCTGG 0: 1
1: 0
2: 0
3: 8
4: 35
960602126_960602132 6 Left 960602126 3:119468982-119469004 CCAGCGCCGCAGCGGGGAATCTG 0: 1
1: 0
2: 0
3: 6
4: 82
Right 960602132 3:119469011-119469033 GTCTGCCGGCGATGGAGTGGTGG 0: 1
1: 0
2: 0
3: 3
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960602126 Original CRISPR CAGATTCCCCGCTGCGGCGC TGG (reversed) Exonic
901361365 1:8703429-8703451 CAGACTCCCCGCGACGGCGGCGG + Intronic
902510943 1:16966590-16966612 CAGATTCCCCGTCGCCCCGCTGG - Intronic
908534636 1:65066702-65066724 CGGAGTCCCCGCGGCGGCGGCGG - Intergenic
1065099549 10:22320702-22320724 CAGGTTCCGCGCCGCGGCGCCGG + Intronic
1067077852 10:43198254-43198276 CAGATGCCCCTCTGCAGAGCAGG + Intronic
1067478035 10:46579028-46579050 CTGGTGCCCAGCTGCGGCGCGGG - Intronic
1067616705 10:47762759-47762781 CTGGTGCCCAGCTGCGGCGCGGG + Intergenic
1067907429 10:50308129-50308151 CAGATTCCCCTCGGCGACTCTGG - Exonic
1072469072 10:95694754-95694776 CCGATTCCCCACAGCAGCGCGGG + Intergenic
1076754703 10:132563141-132563163 CAGATTCCAGGCTGTGGAGCTGG + Intronic
1077503127 11:2918136-2918158 CAGAGTCCCAGCTGCGGCCAGGG + Intronic
1097492716 12:60290809-60290831 CAGAGTCCCCACTGGGGCACTGG + Intergenic
1100260579 12:92929081-92929103 GAGAGTCACCGCGGCGGCGCCGG - Exonic
1105058984 12:133130382-133130404 CAGAGTGGCGGCTGCGGCGCCGG + Exonic
1107605240 13:42049233-42049255 CGGATTCCCGGCGGCTGCGCGGG + Intronic
1108622199 13:52195413-52195435 CAGATTCCCCGCGGGCGCGCGGG + Intergenic
1115651383 14:35404699-35404721 CTGCTTCCTCGCTGGGGCGCTGG + Exonic
1118892379 14:69921116-69921138 CAGACTTCCCGCTGCAGGGCTGG + Intronic
1119468942 14:74881790-74881812 CAGTATCCCGGCTGCAGCGCAGG - Intergenic
1119615501 14:76096227-76096249 CAGGTTCCCCACTGCGCCCCAGG + Intergenic
1119860030 14:77929596-77929618 CAGATTCCCTGCTGGGGCCAGGG + Intronic
1122427623 14:101620958-101620980 GAGATTCCCCGCTGGGGCTTGGG + Intergenic
1129033894 15:72638429-72638451 CAGCTTCCCTGCTGCAGCTCAGG - Intergenic
1129215988 15:74098787-74098809 CAGCTTCCCTGCTGCAGCTCAGG + Intergenic
1129540859 15:76346302-76346324 CCAATTCCCCGCAGCGGCGGCGG - Intergenic
1134249514 16:12564630-12564652 CAGAGTCCCTGCTGGGGAGCAGG + Intronic
1138459205 16:57138094-57138116 CTGATTCCCCGTCACGGCGCTGG - Intronic
1142560396 17:806044-806066 CAGGTTCCCCCCGGCGGCACTGG - Intronic
1144695372 17:17300869-17300891 CAGTTGCCCTGCTGCGGCTCTGG + Intergenic
1144950618 17:18991731-18991753 CAGATTCCAGGCTGCTGGGCTGG - Intronic
1151297038 17:73193271-73193293 CAGATGCGCCGCTGCGCCGTGGG + Exonic
1151966807 17:77435823-77435845 CAGATCCCGCAGTGCGGCGCTGG - Intronic
1151974688 17:77477753-77477775 CTGACTCCCAGCTGCGGAGCCGG + Intronic
1153201902 18:2655725-2655747 CACAGTCCCGGCGGCGGCGCTGG + Exonic
1157580602 18:48771814-48771836 CAGATTCCCCGCGGCGGCTGGGG - Intronic
1158351148 18:56566021-56566043 CAGAGTCCCCCCTGAGGGGCAGG + Intergenic
1161219098 19:3109800-3109822 CACAGTCCCAGCTGCGGGGCCGG + Intronic
1162246623 19:9406864-9406886 CAGACTCCCACCTGCGCCGCTGG - Intergenic
1163015980 19:14454936-14454958 CAGATTCTCCTCTGCTGCCCAGG + Intronic
1164649389 19:29881049-29881071 CAGGCTCCCCGCTGCTGGGCAGG - Intergenic
927787083 2:25981756-25981778 CAGCTCCCCCGGGGCGGCGCGGG + Exonic
929581536 2:43084487-43084509 CAGGTGCCCAGCTGCGGCTCAGG - Intergenic
931079473 2:58753040-58753062 CAGAGTCCCCACTGGGGCACTGG + Intergenic
932216405 2:69969125-69969147 CAGATGCCCCACTGTGGGGCAGG + Intergenic
938181436 2:129188621-129188643 CAGATGCCCCTCTGCTGAGCAGG - Intergenic
944114224 2:196170894-196170916 CCGAGTCCCAGCTGCGGCGTGGG - Intronic
947792573 2:232876549-232876571 CGAATTCCCCGCAGGGGCGCCGG + Intronic
948271968 2:236681189-236681211 CAGATTCCCCTCTCCTGTGCTGG - Intergenic
948461995 2:238134284-238134306 CAGTTTCCCAGCTGAGGAGCTGG + Intergenic
948642661 2:239385419-239385441 GAGCTTCCCCGCTGCTGAGCTGG - Intronic
1172458050 20:35092943-35092965 CACCTACCCCGCTGCCGCGCAGG - Intergenic
1172583169 20:36064532-36064554 CAGAGTCCCCGCTACGGGGTCGG - Intergenic
1175942483 20:62543956-62543978 CAGATTCCGCGGTGCGGGGGCGG - Intergenic
1176016624 20:62937405-62937427 CGGAGTCCCGGCGGCGGCGCGGG - Intronic
1176112637 20:63417599-63417621 CAGATTCCCACCTGCGGCCCCGG + Intronic
1180232308 21:46434511-46434533 CTGATTCCCAGCAGCGCCGCTGG - Intronic
1184461236 22:44639408-44639430 CACATTCCCCGATGAGGCCCTGG - Intergenic
955111998 3:55958884-55958906 CAGCTTCCCAGCTGTGGCTCTGG - Intronic
957765712 3:84621677-84621699 CAGAGTCCCCACTGGGGCACTGG - Intergenic
960602126 3:119468982-119469004 CAGATTCCCCGCTGCGGCGCTGG - Exonic
961013085 3:123448671-123448693 AAGATGCCCCGCTGCAGCGCAGG - Exonic
966512155 3:180776318-180776340 CAGAGTCCCCACTGGGGCACTGG - Intronic
967493776 3:190120986-190121008 CAGGCTCCCCGCTGCAGCGGCGG + Intronic
968881052 4:3300429-3300451 CAGATTCCTCCCTGCGAGGCTGG + Intronic
969686342 4:8676595-8676617 CATATTACCCGCAGAGGCGCTGG + Intergenic
982257585 4:153466071-153466093 CAGAGTGCGCGCTGCGGGGCGGG + Intergenic
982985785 4:162203811-162203833 CAGCTGCCCCGCCGCGGGGCAGG + Intergenic
988109941 5:26807439-26807461 CAGATGCCCAGCTGCGGCTCTGG + Intergenic
996674504 5:126158471-126158493 CAGAGTCCCCACTGAGGCACTGG + Intergenic
1006446027 6:34080178-34080200 CAGATCCCCAGCTGCAGCGAGGG - Intronic
1007752021 6:44076597-44076619 CAGAGTCCCCGCCACGCCGCCGG - Intergenic
1011044372 6:83065812-83065834 CGGCAGCCCCGCTGCGGCGCAGG + Exonic
1022950484 7:35333443-35333465 CAGATTCCACGGTGTGGAGCAGG + Intergenic
1023773746 7:43583520-43583542 CAGCCTCGCCGCCGCGGCGCCGG - Intronic
1034560556 7:151877045-151877067 CAGATTCCCCACTTGGGCACAGG - Exonic
1035023437 7:155811792-155811814 CACATTCCACGCCCCGGCGCTGG + Intronic
1040107917 8:43550549-43550571 CCAATTCCCGGGTGCGGCGCAGG + Intergenic
1042773620 8:72405385-72405407 CAGATTCCAGGCTGCTGTGCTGG - Intergenic
1047501545 8:125445654-125445676 CTCTTTCCCCGCTGCTGCGCAGG + Intergenic
1051267569 9:15323505-15323527 CAGAGTCCCCACTGAGGCACTGG + Intergenic
1053603095 9:39630697-39630719 CAGTTTCCCCGATGCTGTGCTGG + Intergenic
1053860740 9:42384456-42384478 CAGTTTCCCCGATGCTGTGCTGG + Intergenic
1054250443 9:62711721-62711743 CAGTTTCCCCGATGCTGTGCTGG - Intergenic
1054564551 9:66746256-66746278 CAGTTTCCCCGATGCTGTGCTGG - Intergenic
1061487204 9:130925967-130925989 CAGTTTCCCCTCTGCTGAGCAGG + Intronic
1061518340 9:131102678-131102700 CACATTCCCCACTGCAGCCCTGG - Intronic
1185458645 X:323318-323340 CAGATTCGCCGGGGCAGCGCGGG + Intergenic
1194982355 X:100453426-100453448 CAGAGTCCCCACTGGGGCACTGG + Intergenic
1199083741 X:143606112-143606134 CAGAGTCCCCACTGGGGCACTGG + Intergenic