ID: 960603286

View in Genome Browser
Species Human (GRCh38)
Location 3:119479262-119479284
Sequence ATGGATGAGCAAAATGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 514
Summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 477}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960603286 Original CRISPR ATGGATGAGCAAAATGAGAA GGG (reversed) Intronic
901228873 1:7630962-7630984 AAGGATAAGCAAAAACAGAAGGG - Intronic
902074802 1:13775807-13775829 CTGGCAGAGCAGAATGAGAATGG - Intronic
902261431 1:15227655-15227677 ATGGATGGAGAAAAGGAGAAAGG - Intergenic
903581914 1:24377399-24377421 TAGGATGAGCAAGAGGAGAAGGG - Intronic
904294080 1:29506526-29506548 ATAGATGAGGAAACTGAGAGTGG + Intergenic
905835739 1:41119141-41119163 ATGTATGGGTAAAATGAAAAGGG + Intronic
905945209 1:41895884-41895906 ATGTTTGAGCAAAGTGAGAAAGG + Intronic
906155146 1:43609633-43609655 GTGGATGAGCACAGGGAGAAGGG - Intronic
907355382 1:53868389-53868411 ATAGATGAGGAAACTGAGACAGG - Intronic
907418455 1:54330421-54330443 AAGGATGAATAAAATGGGAATGG - Intronic
907457284 1:54583823-54583845 ATGTGTGAGAAAAATGAGGAGGG - Intronic
907699485 1:56770022-56770044 ACTGATGAAGAAAATGAGAAAGG + Intronic
907953190 1:59203644-59203666 ATAGATGAGGAAACTGAGAAAGG - Intergenic
907990989 1:59582590-59582612 ATGCCTGAGCTAAATGTGAAGGG - Intronic
909427950 1:75549497-75549519 ATAAATGAATAAAATGAGAAAGG - Intronic
909432732 1:75608307-75608329 ATGGATAAACAAAATGTGAGGGG + Intronic
910244175 1:85121064-85121086 ATGGATGAGAAAACTGAGAGAGG - Intronic
910377615 1:86590474-86590496 TTGGATGAGCTAAATGAAAAGGG - Intergenic
910564680 1:88630394-88630416 GTGTATGAGGAAAGTGAGAAGGG + Intergenic
910635460 1:89403181-89403203 AGGGATCAATAAAATGAGAAGGG - Intergenic
910806184 1:91191632-91191654 AAGGAACAGCAAAAGGAGAAAGG - Intergenic
911151906 1:94604246-94604268 ATTGATGAGCAGCATGAGCATGG + Intergenic
912229812 1:107779612-107779634 AAAGATGTGCAGAATGAGAAGGG + Intronic
912389251 1:109290623-109290645 TTGGCTGAGCAGAATGTGAAGGG - Intergenic
912976143 1:114332005-114332027 AAGGGTGAGCAAAAGGTGAAAGG - Intergenic
915535749 1:156534376-156534398 AGGGATGAGCATAATGAGCGGGG - Intronic
916388884 1:164308352-164308374 AGGGATGAGGAAAAGGGGAAAGG + Intergenic
917352414 1:174091840-174091862 ATGGATCAGCAAAGGAAGAATGG + Intergenic
918157374 1:181862169-181862191 CTGGATCAGGAAAATGAGATAGG + Intergenic
918633932 1:186752207-186752229 ATGGGTGAACAAAATGATGATGG - Intergenic
918987014 1:191644501-191644523 AGGGATGTGCAACTTGAGAAAGG + Intergenic
919537611 1:198807762-198807784 AGGTAAGAGCACAATGAGAATGG + Intergenic
919709934 1:200716370-200716392 AGGGATGAGTTAAAAGAGAAAGG + Intergenic
921254951 1:213330660-213330682 TTGTATGAGTAAAATGAGAAGGG - Intergenic
921780056 1:219152214-219152236 ATGAATGAGCAAGAGGAGAGCGG + Intergenic
924539676 1:244970071-244970093 ATGGATGAGAAATAAGGGAAAGG + Exonic
924883189 1:248186288-248186310 ATAGTTTACCAAAATGAGAAGGG - Intergenic
1063074749 10:2703623-2703645 GTAGATGGGGAAAATGAGAAGGG - Intergenic
1063180302 10:3592229-3592251 ATGGATGAGAAAACTGAGAGTGG - Intergenic
1063572362 10:7227989-7228011 ACAGATGAGCAAAATCAGAAGGG + Intronic
1064419867 10:15181470-15181492 ATAGATGAGCAAATAGAGACTGG + Intergenic
1064470480 10:15630192-15630214 ATGTTTGTGCAGAATGAGAATGG - Intronic
1064615464 10:17150417-17150439 ATGGAAGTCCAATATGAGAAAGG - Intronic
1064739407 10:18416853-18416875 ATGGATGAGCAAACTGATGGTGG + Intronic
1064777054 10:18790288-18790310 ATGAATGAGAAAAATGAGGGAGG - Intergenic
1064886042 10:20113752-20113774 ATGGAGGAAAAAATTGAGAAGGG - Intronic
1065672296 10:28133280-28133302 ATGGATGGGCAACTTTAGAAGGG - Intronic
1066225351 10:33377395-33377417 ATGGATGAGGAAAAAGACAGAGG + Intergenic
1068761874 10:60721280-60721302 CAGGAAGAGAAAAATGAGAATGG + Intronic
1070106734 10:73439931-73439953 ATGAATGAGAGAGATGAGAAGGG + Intronic
1070154046 10:73822650-73822672 AGGGAAGAGCAAAGTGAGACGGG - Intronic
1070313072 10:75287702-75287724 ATGGAGCAGCAGAATGAGGAGGG - Intergenic
1070573459 10:77659290-77659312 AAGGATGACCCAAATGAGTAAGG - Intergenic
1070852885 10:79582389-79582411 AAGGATGAGCCAAATGACCACGG - Intergenic
1070888194 10:79922916-79922938 AAGGATGAGCCAAATGACCACGG + Intergenic
1071021622 10:81064085-81064107 ATGGAAGAACAAGATGTGAAGGG - Intergenic
1071409583 10:85375773-85375795 ATGGATTAGCAATAACAGAATGG - Intergenic
1071542242 10:86496560-86496582 ATGGATAAACAAAATGTGGAAGG + Intronic
1071777572 10:88806341-88806363 CAGGAGGAGCAAAATGAGCAGGG - Intronic
1072476536 10:95766623-95766645 ATATATCAGCCAAATGAGAAGGG - Intronic
1072529281 10:96303455-96303477 ATTGTTTAGCCAAATGAGAAAGG + Intergenic
1073608974 10:104924570-104924592 ATGGTTGAGCAGCATGACAAAGG + Intronic
1075193737 10:120335900-120335922 TTGGCTGAGGAAAATAAGAAGGG + Intergenic
1076053551 10:127353322-127353344 GTGCAGGAGCAAAATGGGAATGG + Intronic
1076443834 10:130498388-130498410 ATGGATGAGGAAACTGAGGCAGG - Intergenic
1078642865 11:13112769-13112791 ATGGATGAGTAAATTGATGATGG + Intergenic
1078674000 11:13392279-13392301 ATGGATGAGCAAGATTGGGATGG + Intronic
1079157416 11:17961090-17961112 GTGGATGAGTACAATGATAAAGG - Intronic
1079309097 11:19348774-19348796 ATAGATGAGAAAACTGAGATTGG + Intergenic
1079915999 11:26369408-26369430 AAGGATGAGGAGAATGAGTAGGG - Intronic
1081495628 11:43607219-43607241 ATGGAAGAGAGAAAAGAGAAAGG + Intronic
1082971752 11:59030159-59030181 ATGGGTGAGAAGGATGAGAAGGG - Intronic
1083564066 11:63698077-63698099 ATTGATGACTAAAATGAGAGTGG - Intronic
1083593711 11:63909370-63909392 ATGTAAGAGAAAACTGAGAAGGG - Exonic
1084543693 11:69803023-69803045 CTGTAAGAACAAAATGAGAAGGG + Intergenic
1087287484 11:96280834-96280856 ATATATGAGATAAATGAGAAAGG - Intronic
1087382024 11:97417393-97417415 ACTGATTAGTAAAATGAGAAAGG - Intergenic
1089809630 11:121121110-121121132 ATAGATGAGGAAATTGAGGATGG - Intronic
1090119587 11:124011402-124011424 ATGGATCAGGAAAATGATCAAGG + Intergenic
1090992005 11:131826210-131826232 ATGGTTGAGGCAAATGAGATGGG + Intronic
1091238202 11:134035482-134035504 ATGGATGAGGAAACTGAGGTAGG + Intergenic
1092589830 12:9942710-9942732 ATGTATTAGAAAAATAAGAAAGG + Intergenic
1093373274 12:18389860-18389882 GTAGATGAGAAAACTGAGAAAGG - Intronic
1093403037 12:18769830-18769852 ATGGATAAGTAAAATGTGACAGG + Intergenic
1093474591 12:19540761-19540783 ATGGATGAAGAAAATAACAATGG - Intronic
1096561142 12:52436785-52436807 ATGGCTGAGAAAAACCAGAATGG - Intergenic
1097495646 12:60328861-60328883 ATGGATGAGCCAGATGCAAAAGG + Intergenic
1097943114 12:65334327-65334349 ATAGATGAGGAAACTGAGAGAGG + Intronic
1098606544 12:72397558-72397580 AGGGGTGAGCACAAGGAGAATGG - Intronic
1099365298 12:81759594-81759616 AGGGATGGGCAAAGTGGGAAGGG + Intergenic
1099867325 12:88299773-88299795 ATGAATCAGCAAAATGGAAATGG - Intergenic
1099871978 12:88360930-88360952 ATGGATAAATAAAATAAGAATGG - Intergenic
1100832596 12:98530486-98530508 TAAGATGAGCAAAATGATAATGG - Intronic
1100879845 12:99004574-99004596 CTGTTTGAGAAAAATGAGAAAGG + Intronic
1101236692 12:102796890-102796912 ATGCTTCAGCAAAATGGGAAAGG - Intergenic
1102203800 12:111076425-111076447 ATGGATGAGGAAACTGAGGCTGG + Intronic
1102264331 12:111469814-111469836 ATTGATGAGGAAGAGGAGAAAGG + Intronic
1102624402 12:114223169-114223191 AATGAAAAGCAAAATGAGAAGGG - Intergenic
1102664555 12:114559840-114559862 AAGAATGAGCAAATTGATAATGG - Intergenic
1102869912 12:116406077-116406099 ATGAATGTGCAAAGTGAGATTGG + Intergenic
1103129102 12:118451424-118451446 AATGATGAGCAAGATAAGAATGG - Intergenic
1103399757 12:120635711-120635733 CTGAATGTGGAAAATGAGAATGG - Intergenic
1103449897 12:121021295-121021317 ATTGATGAGGAAACTGAGCAGGG + Intronic
1103578984 12:121900152-121900174 CTGAATGATGAAAATGAGAATGG + Intronic
1106361594 13:29036227-29036249 ATGGAGGAACAAACTGAGAGTGG - Intronic
1106775881 13:33009122-33009144 AAGGTTAAGGAAAATGAGAATGG - Intergenic
1107216808 13:37931187-37931209 CTGTATCAGCAAAATGAAAAAGG - Intergenic
1107760757 13:43675868-43675890 TGGGATGAGCAAAAAGAAAATGG - Intronic
1108029473 13:46214142-46214164 ATGGAAGAGGAAACTGAGAAGGG - Intronic
1108578066 13:51806112-51806134 ACAGATGAGCAAACTGAGAGAGG + Intergenic
1109327905 13:60891977-60891999 ATGGGTGAGGAAGGTGAGAAGGG - Intergenic
1110745523 13:79049060-79049082 ATGCCTGGGCAAAAGGAGAAAGG - Intergenic
1110792215 13:79599079-79599101 ATAGATGAGGCAAATGAGAAAGG + Intergenic
1111044047 13:82791481-82791503 ATTCATCAGGAAAATGAGAAAGG + Intergenic
1111096223 13:83518544-83518566 ATGGAAAAGAAAAATGAGGAGGG + Intergenic
1111685242 13:91493671-91493693 ATGGAAGAGCAAATGGACAAGGG - Intronic
1111880670 13:93953037-93953059 AAGCATGGGCAAGATGAGAAGGG - Intronic
1112467070 13:99653842-99653864 ATGGATGAGTTGAATGAAAATGG - Intronic
1112722881 13:102265141-102265163 ATGGAGGATGAGAATGAGAAAGG - Intronic
1113349093 13:109510957-109510979 ATAGTTGAGAAAAATGAAAAGGG - Intergenic
1113472261 13:110555440-110555462 ATGGCTGAGCCACCTGAGAAGGG - Intronic
1114943326 14:27644469-27644491 ATGCATGAGGAAATGGAGAAAGG + Intergenic
1115183730 14:30659810-30659832 ATGGATGAGCAAAACGATTGTGG + Intronic
1115771871 14:36672050-36672072 ATGGAAGATCCACATGAGAAAGG + Intronic
1116109765 14:40562860-40562882 ATGAATGAGTAAAATAAGTATGG - Intergenic
1116171047 14:41402887-41402909 ATGGAAGAAGTAAATGAGAAAGG + Intergenic
1116335345 14:43650234-43650256 GTGGATGAGAAAATTAAGAATGG - Intergenic
1117116568 14:52519693-52519715 ATGGTAGAGCAAAATGAGGTTGG - Intronic
1117734727 14:58756902-58756924 ATGGATGACCAAAAGTAAAAGGG - Intergenic
1118012140 14:61620652-61620674 CTTAATGAGAAAAATGAGAAAGG - Intronic
1118510959 14:66472739-66472761 ATTGAAAAGCAAAAGGAGAATGG + Intergenic
1118825015 14:69372094-69372116 ATGGATGAGCAGGATGAGTAGGG + Intergenic
1118924221 14:70177218-70177240 ATGAATGTGCAAAAATAGAAGGG + Intronic
1119556381 14:75556434-75556456 AGGGCTGAGCAGAATGAGCAAGG - Intergenic
1120088541 14:80304421-80304443 ATCAATGATCAAAATGATAATGG - Intronic
1120545566 14:85807463-85807485 ATGGATGACCAAAGTGAGCAAGG - Intergenic
1120571809 14:86127725-86127747 AGGGATGAGAAAACTGAGTATGG - Intergenic
1121802918 14:96790119-96790141 AAGGATGAGCAGAAGGAGTAGGG + Intergenic
1123221434 14:106860490-106860512 ATGAATAAGCAAAAAGATAAGGG - Intergenic
1123722562 15:23072347-23072369 ATGGATTAGAGAAATGAGAGGGG + Intergenic
1123785670 15:23669671-23669693 AAGGATGAGAATAAAGAGAAGGG - Intergenic
1123883611 15:24699959-24699981 ATGTATGAGGAAAATAATAAAGG - Intergenic
1124680823 15:31729314-31729336 GTGGATGAGCAAAAAAAGCATGG + Intronic
1125247505 15:37658256-37658278 ATGGATAAAGAAAATGTGAAGGG + Intergenic
1125426530 15:39554740-39554762 AGAGAAGAGCAAAATGAGACAGG + Intergenic
1130528738 15:84729244-84729266 AGAGATGAGAAAAATGAGGAAGG - Intergenic
1131063457 15:89418371-89418393 ATGAGGGAGCAAAAAGAGAAGGG + Intergenic
1131223412 15:90604228-90604250 AATGATGAGCAAAATGAGCGAGG + Intronic
1131256812 15:90868434-90868456 ATAAATGAGGAAAATGAGAAGGG + Intergenic
1131539314 15:93262825-93262847 ATGAATGGGCAGAATAAGAATGG - Intergenic
1132061129 15:98693217-98693239 CTGGATGAGCAGAATGAGGCAGG + Intronic
1134036350 16:11034095-11034117 ATGGATGAGCGATATGGAAAAGG + Intronic
1134293468 16:12923148-12923170 ATGAATGAGAAAATTGAGATTGG + Intronic
1135037714 16:19091901-19091923 ATGTATTAGCAGCATGAGAACGG + Intergenic
1135857735 16:26027523-26027545 TTGGAGAAGCAAAATGAGATAGG - Intronic
1138193028 16:55032172-55032194 ACAGATGGGGAAAATGAGAAAGG - Intergenic
1138340153 16:56283878-56283900 ATGGAGCAGCAGAATGAGATGGG - Intronic
1138459233 16:57138210-57138232 ATGGAGGTGGAAGATGAGAAAGG - Intronic
1138526125 16:57608307-57608329 TTGGAGGAGCAAAAAGGGAAGGG - Intergenic
1138537938 16:57669679-57669701 ATGAATGCGCAAATGGAGAATGG - Intronic
1138873871 16:60926224-60926246 AGGGGTGAGGAAAAGGAGAAAGG - Intergenic
1139269197 16:65666103-65666125 ATGGATGAGAAATGTGAGACCGG + Intergenic
1140034603 16:71362773-71362795 GTGGATGAGCCAAATGAAAGGGG + Intronic
1140578571 16:76201896-76201918 ATTCATGAGAAAAATGCGAAGGG + Intergenic
1140948089 16:79789649-79789671 ATGGATGAGCTAAACCAGAATGG - Intergenic
1143114733 17:4576123-4576145 ATGGATGATGAAGAGGAGAAGGG - Intergenic
1143857286 17:9861298-9861320 CTAGATGGCCAAAATGAGAAGGG - Intronic
1143936771 17:10494260-10494282 AAAGATGAGTAAAATGAGGAAGG - Intronic
1146483673 17:33225927-33225949 ATGAATGAAAAAAATGAGAGAGG - Intronic
1146933602 17:36795649-36795671 ATGGATAAGCAAAATGTGGTAGG - Intergenic
1146953155 17:36920561-36920583 ATGGAAAAGCAAGAGGAGAAAGG - Intergenic
1148496044 17:48054205-48054227 CTGGATGAGCAAGATGCGACAGG + Intronic
1148614651 17:48991177-48991199 ATGGAGGAACAAAAGGAGAGGGG + Intergenic
1149287935 17:55186816-55186838 ATGAATGGAGAAAATGAGAAAGG - Intergenic
1149374630 17:56031697-56031719 ATGGCTGAGTAAAATGAGGAAGG + Intergenic
1150355466 17:64480824-64480846 AAGGATGAGAAAAAGGAGAGTGG + Intronic
1150429153 17:65101614-65101636 AGTGATGAGCAAAACGAGCATGG + Intergenic
1151698086 17:75728196-75728218 ATGGATGAGGGAAATGGGACTGG - Intronic
1155067127 18:22277597-22277619 AAGGATGAGCTAAATGAAAGAGG + Intergenic
1155998275 18:32356103-32356125 TTTAAGGAGCAAAATGAGAAAGG + Intronic
1156124857 18:33891677-33891699 ATTGATGAGAAAAAGGAAAAAGG + Intronic
1156398170 18:36717799-36717821 ATGGGAGAGAAAAATGAGAAAGG - Intronic
1156708195 18:39909542-39909564 ATGGAGGAGCAGCTTGAGAAAGG - Intergenic
1157314614 18:46577219-46577241 ATGCTTAAGCAAAAAGAGAAAGG + Intronic
1157682591 18:49618631-49618653 ATAGATGAGAAAACTGAGACCGG - Intergenic
1157927051 18:51778185-51778207 ATGGATGATAAAGATTAGAATGG - Intergenic
1158288535 18:55912715-55912737 ATGGATCAGAGAAAGGAGAAAGG - Intergenic
1158459808 18:57636191-57636213 ATGTATTAACAATATGAGAAAGG - Intergenic
1158591762 18:58784470-58784492 ATGGAAGAGCAAGAAGAGCAGGG + Intergenic
1158812018 18:61048875-61048897 ATGGAAGAGCATAAGAAGAAAGG + Intergenic
1159473552 18:68888228-68888250 ATGAATGAGCACAAAGAGAAGGG + Intronic
1160384511 18:78486658-78486680 ATGGATGACCAACAGGAGCAAGG + Intergenic
1161506549 19:4647083-4647105 ATGAATAAACAAAATGAGATCGG - Intronic
1161805824 19:6442379-6442401 ATGGGTGTGCAAGGTGAGAAAGG + Intronic
1163052126 19:14692447-14692469 ATGGATGAGCCAGGTGAGAGAGG + Intronic
1165203968 19:34168248-34168270 AGTGATGAGCATAAGGAGAACGG - Intergenic
1165587730 19:36934783-36934805 ATGGATCAACAAAATCACAATGG - Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166124789 19:40707842-40707864 ATGGATGAATAAAATGTGATAGG - Intronic
1166786848 19:45372658-45372680 ATGGATGAGAGAAGTGAGAAAGG + Intergenic
1167231243 19:48285159-48285181 ATGTATGATAAAAATGTGAAGGG - Intronic
1167276519 19:48543441-48543463 AGGGATGAGCAAGATGAGGGTGG + Intergenic
1167290502 19:48622487-48622509 AGGGAGGAGGAAAAGGAGAAAGG - Intronic
1167515516 19:49921205-49921227 ATAAATGAGCAAACTGAGAAAGG + Intronic
925237786 2:2294138-2294160 AGGAATGAGGAACATGAGAATGG + Intronic
925284231 2:2705467-2705489 TTGGATGGGAAAAAGGAGAAGGG + Intergenic
925639310 2:5972079-5972101 ATGGCTGGGGAAAATGACAAAGG - Intergenic
925818348 2:7775336-7775358 TAGGATGAGCAAAATGTGAAAGG + Intergenic
926449027 2:12979938-12979960 TAGGGTGAGCAAAGTGAGAAGGG - Intergenic
926591007 2:14740285-14740307 ATGGAGGAGGAAAAGGAAAAAGG + Intergenic
926862571 2:17324442-17324464 ATGGATGAGGAGAATGGGGATGG - Intergenic
926931793 2:18048376-18048398 TTGGATGAGGAAGAAGAGAACGG - Intronic
926980504 2:18562128-18562150 ATGGATGGGCAAGATGTGGATGG - Intronic
927766634 2:25815675-25815697 ATGGATGAGCCTACTGAGAATGG + Intronic
928421939 2:31144099-31144121 ATGAATGAGTGAAATGAGATAGG + Intronic
928598218 2:32877518-32877540 ATGGTTGAGAAAAGAGAGAAGGG + Intergenic
928884384 2:36131418-36131440 ATTTATGAGCAAGCTGAGAAGGG - Intergenic
929305218 2:40353757-40353779 ATGGATTGGGAAAATGAAAATGG - Intronic
929438349 2:41946210-41946232 ATGGAGGAGCAACATGAGCAGGG + Intronic
929878991 2:45820447-45820469 AAGGAAGGGCAGAATGAGAAAGG + Intronic
930028427 2:47043931-47043953 AAAGATGAAGAAAATGAGAAGGG + Intronic
930609729 2:53528515-53528537 ATGAAAGAGAAAAATAAGAATGG + Intergenic
930726176 2:54683796-54683818 TTCCATGAGCAAAATGGGAAGGG + Intergenic
931686254 2:64796652-64796674 AGGTAGGAGGAAAATGAGAAGGG + Intergenic
932011870 2:67986574-67986596 ATGAATGTGCAAGTTGAGAAGGG - Intergenic
932706651 2:74031227-74031249 ACGGAGGAGGAAAAGGAGAATGG + Intronic
933148610 2:78887921-78887943 AGAGATAAGCACAATGAGAAAGG + Intergenic
933311582 2:80667805-80667827 CCGGAGGAGCAAAATAAGAAGGG + Intergenic
933540664 2:83637959-83637981 TTGGATGGGTAAAATGATAAAGG + Intergenic
933970901 2:87468964-87468986 ATGGATGAGGAAATGGAGATTGG + Intergenic
934182741 2:89641997-89642019 GAGCATGAGTAAAATGAGAAAGG - Intergenic
935038565 2:99403313-99403335 ATAGATGAGCAACATGCCAAAGG - Intronic
935735294 2:106101956-106101978 ATGGAGGAGGAGAAGGAGAAGGG - Intronic
936322825 2:111481225-111481247 ATGGATGAGGAAATGGAGATTGG - Intergenic
936654271 2:114466692-114466714 ATGGATGATAATAATAAGAATGG - Intronic
936948777 2:117956107-117956129 CTGGATGAGGAAAATGAGGTAGG - Intronic
937309945 2:120895992-120896014 ATGGGTGAGGAAACTGAGATTGG + Intronic
941105806 2:161351463-161351485 ATGGATGAGCAGAATGGTATGGG - Intronic
941684845 2:168437925-168437947 ATGGATCAGGAAAGAGAGAAGGG + Intergenic
941775087 2:169384682-169384704 ATTGAGGAGCCAAATGAGTAAGG - Intergenic
941880675 2:170477108-170477130 ATGGTGGGGAAAAATGAGAATGG - Intronic
942518212 2:176775418-176775440 CAGGATGAGTAAAATTAGAAAGG + Intergenic
944068400 2:195643643-195643665 TTGGATGAGGGAGATGAGAAAGG + Intronic
944121366 2:196244162-196244184 ATGGATGTCCAAAATGAGTAAGG + Intronic
944787296 2:203086353-203086375 AAGGATAAGCAAATTAAGAAAGG - Intronic
945020278 2:205564061-205564083 ATGGATGAAGAAACTGAGACTGG + Intronic
945120533 2:206452748-206452770 ATGGCTGAGAAAGATGAGGAAGG - Intronic
945165664 2:206940986-206941008 ATGGATGAGGAATTTCAGAAAGG - Intronic
945752480 2:213804957-213804979 AGGGAAGAACATAATGAGAATGG + Intronic
946806834 2:223479460-223479482 ACAGATGAGCAAACTGAGATAGG - Intergenic
947765762 2:232636088-232636110 AAGGATGAGCCATCTGAGAACGG - Intronic
947785735 2:232817748-232817770 ATGGATAAACAAAATAGGAATGG - Intronic
1168925556 20:1576059-1576081 AATGATGAGCTACATGAGAAAGG - Intronic
1168929434 20:1609087-1609109 AATGATGAGCTACATGAGAAAGG - Intronic
1169473018 20:5904508-5904530 ATGGATGAGGGAAATGGGCAAGG + Intergenic
1169548945 20:6681486-6681508 ATGAATAAGCAAAGAGAGAAAGG - Intergenic
1170485611 20:16812957-16812979 CTATGTGAGCAAAATGAGAAAGG + Intergenic
1170541410 20:17392052-17392074 AAGGATGAGCTACATGAGACAGG - Intronic
1170824984 20:19785994-19786016 ATACATGTGAAAAATGAGAATGG + Intergenic
1170962241 20:21035768-21035790 ATTGAGGAGCAAAAAGAGGAAGG + Intergenic
1171210088 20:23310295-23310317 GTGGATGAGCTGAAGGAGAAAGG - Intergenic
1172873211 20:38148435-38148457 TTGGCTGAGCAAGAGGAGAAAGG - Intronic
1172924994 20:38525795-38525817 ACGGATCAGTATAATGAGAAAGG - Intronic
1173420952 20:42900627-42900649 ATGGATGAAGAAACTGAGGAGGG - Intronic
1175556549 20:59863381-59863403 AAAGCTGACCAAAATGAGAAGGG + Intergenic
1177008854 21:15707219-15707241 AGGGATGAATAAAATGAGAAGGG - Intergenic
1177691104 21:24508503-24508525 ATTCATGAGCATAATGAGCAGGG - Intergenic
1179502903 21:41821169-41821191 ATGGAGGTGCACAAGGAGAAGGG - Exonic
1181336957 22:22143446-22143468 ATGAGTTAGAAAAATGAGAAAGG - Intergenic
1181612283 22:24024909-24024931 ATAGATGAACAAAATAATAAAGG - Intronic
1181756252 22:25027189-25027211 TTGAGTGAGAAAAATGAGAATGG + Intronic
1182388413 22:29967964-29967986 ATGGACAAACAAAATGTGAATGG - Intronic
1182800962 22:33031636-33031658 TCGGATGTGGAAAATGAGAAGGG - Intronic
1183415862 22:37681511-37681533 ATGGATGAGGAAACTGAGGCTGG - Intergenic
1203290488 22_KI270735v1_random:32498-32520 AGGGATGAACAAAATGGGGAAGG + Intergenic
949705324 3:6809900-6809922 TAGGATGAGTAAACTGAGAATGG + Intronic
949935956 3:9116076-9116098 ATGGATGATCAAAATGAAAGGGG - Intronic
950488470 3:13286640-13286662 ATGGAGGAGGAAACAGAGAAAGG + Intergenic
950524670 3:13516866-13516888 ATGGATGAAGTAAATGAGACTGG - Intergenic
950626140 3:14248540-14248562 TGGGCTGAGCAGAATGAGAACGG - Intergenic
950967695 3:17157263-17157285 ATGGATGAGAAAAAAGCGATAGG + Intronic
951281714 3:20758373-20758395 ATGCAGGAGCAAGATCAGAAGGG + Intergenic
951698769 3:25473247-25473269 ATGGATAAGCAACACCAGAAGGG + Intronic
952485640 3:33807179-33807201 ATGGGTGAGGAAAAGAAGAATGG - Intronic
952774927 3:37036036-37036058 AAGGAAGAGCTTAATGAGAAAGG + Intronic
953518911 3:43622436-43622458 ATGGAAGAGGGAAATGTGAAGGG - Intronic
954778058 3:53037655-53037677 ATCATTGAGCAAAATGAGCAGGG - Intronic
955216874 3:56991265-56991287 ATGAATGAGCAAATGGGGAAAGG - Intronic
955438332 3:58928499-58928521 ATAGATGAGGAAAATGATACAGG + Intronic
956042175 3:65156028-65156050 ATGAGTGAGGAAAATGAGACAGG - Intergenic
956356343 3:68397071-68397093 ATGGAGGAAAAAAAGGAGAAAGG + Intronic
956857900 3:73294096-73294118 ATAGATGAGGAAAATGTGGATGG + Intergenic
956858090 3:73295536-73295558 ATGGATTAGCAACAGGAAAATGG + Intergenic
957640734 3:82850111-82850133 AAGGATGAGGAAAACGGGAAGGG - Intergenic
959296731 3:104544835-104544857 CAGGAAGAACAAAATGAGAAAGG - Intergenic
959650071 3:108742957-108742979 ATGTATTGGCAAAAAGAGAAAGG - Intergenic
960314060 3:116154707-116154729 ATGACTAAGCAAAATGAGTAGGG - Intronic
960545720 3:118912534-118912556 AGGGATGAGCAAAACAGGAAAGG - Intronic
960603286 3:119479262-119479284 ATGGATGAGCAAAATGAGAAGGG - Intronic
964178118 3:153850541-153850563 ATGTAAGAGCCAAATGAAAAAGG - Intergenic
964326804 3:155555743-155555765 TTAGGTAAGCAAAATGAGAAGGG - Intronic
964584582 3:158282760-158282782 ATGGATGAGCAAAATTATGGAGG + Intronic
964892710 3:161556115-161556137 ATTGATTAGCAGTATGAGAAGGG - Intergenic
965857040 3:173101969-173101991 TTTGATGAGAAGAATGAGAAGGG - Intronic
966263471 3:178008434-178008456 ATGGTTGAGAAAAATGCCAAAGG - Intergenic
966330007 3:178801042-178801064 ATGGAGGGAGAAAATGAGAATGG + Intronic
966531640 3:180988275-180988297 AAGAATGGGCAAAATGAGAAAGG - Intronic
966565206 3:181372106-181372128 AAGAAAAAGCAAAATGAGAAGGG + Intergenic
967568676 3:191001673-191001695 ATGGCTGAGGAAGATGAAAAGGG + Intergenic
968927760 4:3558867-3558889 ATTTATCAGCAAAAAGAGAAGGG + Intergenic
969665480 4:8554850-8554872 ATGGATGCGCACAAGGAGCAGGG - Intergenic
969968913 4:11026188-11026210 ACAAATGAGCAAACTGAGAAAGG - Intergenic
970244173 4:14041181-14041203 AGGGCTGAGGAAAATCAGAAAGG - Intergenic
970424915 4:15937211-15937233 ACAGATGCCCAAAATGAGAAAGG + Intronic
971394162 4:26213412-26213434 CTGGCTTAGGAAAATGAGAAGGG + Intronic
971489221 4:27193280-27193302 CTGGATGAGAAAATTGAGATTGG - Intergenic
972215343 4:36891446-36891468 AGGGATGAGCGAAATGGGTAGGG - Intergenic
972779504 4:42274067-42274089 ATTGATAAGCAAAATCAGAGTGG - Intergenic
973130618 4:46643822-46643844 AAAGATGGGCAAAATGTGAAAGG - Intergenic
973619059 4:52709688-52709710 ATGGAGGAGGAGACTGAGAAAGG + Intergenic
974178828 4:58359452-58359474 ATGTATTAGCAGAATGAGAAAGG + Intergenic
974516659 4:62923215-62923237 TTGTATGATCAAAATGAAAATGG + Intergenic
974598209 4:64040405-64040427 ATGGATGTTAATAATGAGAATGG - Intergenic
975998481 4:80343079-80343101 AGGGATGTACATAATGAGAAAGG + Intronic
976209742 4:82655673-82655695 AGGGATTGGCAAAATGAAAAAGG + Intronic
977373839 4:96174350-96174372 AGGGAGGAGAAAAATGAGGAGGG - Intergenic
977691013 4:99910987-99911009 ATGAAAGAGCAACATGAGAGTGG - Intronic
977741512 4:100489479-100489501 ATGCAAGAGCAAGATGATAAAGG + Intronic
978063061 4:104362577-104362599 ATGGAAGAGAAAATTGAGTATGG + Intergenic
978312920 4:107405641-107405663 ATGGAGGAGGAAAATGAAATAGG + Intergenic
978487387 4:109270976-109270998 ATGGATCAGGAAACTGAGACTGG + Intronic
978593670 4:110353945-110353967 AGAGATGAGCAAATTGAGGAGGG - Intergenic
978710061 4:111769416-111769438 ATGAAAGAGAAAAATGAAAAAGG - Intergenic
979217536 4:118183346-118183368 AAGGATGAGAAAGAAGAGAAGGG - Intronic
979662437 4:123272946-123272968 ATCCAAGAGAAAAATGAGAAAGG + Intronic
979733391 4:124052472-124052494 ATGGGTGAGCCAAAGGAGGAAGG + Intergenic
980782953 4:137515247-137515269 AGGGGTGAGTAAATTGAGAAGGG - Intergenic
981195060 4:141909680-141909702 ATGGATGAGCAAACTGAAATGGG - Intergenic
981672184 4:147299557-147299579 ATGGATGTGCTTAAAGAGAAAGG + Intergenic
981927808 4:150158475-150158497 ATGCATGAGCTAATTGATAAAGG + Intronic
982980973 4:162134609-162134631 CTCCATGAGCTAAATGAGAAAGG - Intronic
984114008 4:175656100-175656122 AATAATGACCAAAATGAGAAAGG - Intronic
984265328 4:177491760-177491782 ATTCATGAGAAAAATCAGAATGG + Intergenic
984981864 4:185289825-185289847 ATGGAATAACAAAATAAGAAAGG - Intronic
985013380 4:185606926-185606948 AGAGTTGAGAAAAATGAGAAGGG - Intronic
985095433 4:186408218-186408240 GTGAATGAGCAGAATGAGCATGG + Intergenic
985299612 4:188474118-188474140 ATGGTTGATCAAAATGAAAATGG - Intergenic
985420760 4:189783031-189783053 ACAGAGGAGCAAAGTGAGAAGGG + Intergenic
985649062 5:1098948-1098970 ATGAATGTGCAGAATGACAAGGG - Intronic
987768799 5:22272551-22272573 ATGGTTAAGCTTAATGAGAAAGG - Intronic
988042844 5:25910939-25910961 CAGGATGAGCAGGATGAGAATGG + Intergenic
989813466 5:45707090-45707112 ATGCATAAGCAACATGAAAAAGG + Intergenic
990124240 5:52494834-52494856 GGGGATGAGTAAACTGAGAAAGG - Intergenic
990268355 5:54104975-54104997 ATGGCTGAGACTAATGAGAAGGG - Intronic
990885949 5:60593629-60593651 ATGATTGAGCTTAATGAGAAAGG + Intergenic
991190282 5:63864223-63864245 ATGGATGAGCAAAAAAAAAGTGG - Intergenic
991281654 5:64921485-64921507 ATGGAAGACAAAAAAGAGAAGGG - Intronic
991544344 5:67765015-67765037 GTGGGTGAGCAAAAGGAGAAAGG + Intergenic
991974936 5:72176341-72176363 GTGGATCAGGAAAAGGAGAAAGG + Intronic
991977361 5:72196365-72196387 ATGGATGAGGCCATTGAGAAAGG + Exonic
992442162 5:76806466-76806488 GTGGATGAGCCAAAAGAGGAGGG - Intergenic
992872050 5:81017042-81017064 ATGCATGAGGAAAAGAAGAAAGG - Intronic
993292084 5:86086647-86086669 ATGCTCTAGCAAAATGAGAAAGG - Intergenic
994185485 5:96810471-96810493 ATAGATGAGAAAAATGAGACAGG + Intergenic
994431669 5:99672988-99673010 ATAAATGAGAACAATGAGAATGG + Intergenic
995197478 5:109388285-109388307 ATGGATGAGCAACCTGGAAAGGG + Intronic
995661318 5:114486437-114486459 ATGGATGGGACAAATGAGAAGGG - Intronic
995788762 5:115860726-115860748 AAGGATGAGGAGAATGGGAAAGG - Intronic
995838119 5:116418196-116418218 ATGGATGGCTAAAAGGAGAAGGG + Intergenic
995978530 5:118073051-118073073 ATGGTGGAGCAATGTGAGAAAGG + Intergenic
996229573 5:121044963-121044985 CTGGCAGAGGAAAATGAGAATGG + Intergenic
996676486 5:126181046-126181068 AAGGATGAACAAAATGATAGAGG - Intergenic
997674415 5:135702014-135702036 ATGGATGAGAAAGATGAGCCTGG + Intergenic
998308228 5:141100752-141100774 GTGGCTGAGGAAAAAGAGAAGGG + Exonic
998329562 5:141312474-141312496 ATAGAAGAGCAAAAGGGGAAAGG - Intergenic
998416096 5:141947050-141947072 ATAGATAAACAAAAAGAGAATGG - Intronic
998874402 5:146584757-146584779 TTGGATGAACAAAAGGAAAAAGG + Intronic
999325002 5:150638464-150638486 ATGGTGAAGCAAAATGTGAAGGG + Intronic
1000771371 5:165358676-165358698 ATAGATGAGGAAAATGTAAAAGG + Intergenic
1000957016 5:167555364-167555386 ATAAATGAGCAAAAAGAAAAGGG - Intronic
1001121748 5:168986526-168986548 ATGGACGAGGACACTGAGAATGG - Intronic
1001429536 5:171648362-171648384 GTGGATGAGAAAAGTGAGACTGG + Intergenic
1001734113 5:173984802-173984824 CTGTATGAGCAGTATGAGAATGG - Intronic
1001872867 5:175171882-175171904 ATGGATGAATAAATTGATAATGG - Intergenic
1002399333 5:178982758-178982780 ATGAATGAACAAAGTAAGAAGGG + Intronic
1002866569 6:1127218-1127240 CTGGATGGGCAAAGTGAGCAAGG - Intergenic
1004138783 6:12994631-12994653 ATGGAGGAGGAAAAGGGGAATGG + Intronic
1004415188 6:15416824-15416846 ATAAAAGGGCAAAATGAGAAAGG - Intronic
1005208849 6:23436753-23436775 ATGGCAGATCAAAATAAGAAAGG - Intergenic
1006006131 6:31003185-31003207 ATGGAAGAGAAGAATTAGAAGGG + Intergenic
1006066433 6:31465630-31465652 ATGGATGAGTAAGAGGAGGAAGG - Intergenic
1007183383 6:39947023-39947045 ATTGATTAGCAAAATGAGATGGG - Intergenic
1007197023 6:40071081-40071103 TTGGATGAACAAAATCAGATGGG - Intergenic
1007235615 6:40389716-40389738 ATGAATGAGAAAGATGAGGAGGG + Intergenic
1007264525 6:40586768-40586790 AAGGATGGGCGAAAAGAGAAGGG + Intronic
1007509195 6:42362522-42362544 ATGGAGGGACAAACTGAGAATGG + Intronic
1007898451 6:45386703-45386725 ATGGTTTAACAAAATGAGGAAGG + Intronic
1008425833 6:51355081-51355103 AGAGTTGGGCAAAATGAGAAGGG + Intergenic
1010016081 6:71105904-71105926 TTGGATGAGCAAATGTAGAAAGG + Intergenic
1011055053 6:83194888-83194910 ATGGGTGAACAAAATAATAATGG - Intronic
1011872617 6:91915384-91915406 AGCCATGAGGAAAATGAGAAGGG + Intergenic
1012606257 6:101161452-101161474 ATAGATGAGGAAATTGAGACTGG + Intergenic
1014878871 6:126696740-126696762 ATGGATGAAAAAATTGAAAAAGG - Intergenic
1015446604 6:133312829-133312851 ATGGAAAAAAAAAATGAGAAGGG - Intronic
1016741271 6:147531574-147531596 ACTGATGGGCAAAATGAAAATGG - Intronic
1018336763 6:162799974-162799996 ATGAGTGAGCCAAATGTGAAAGG - Intronic
1018468102 6:164070707-164070729 TTGGAAGAGGAAAATGACAATGG - Intergenic
1019137512 6:169920116-169920138 CTCGATGACCAAGATGAGAATGG + Intergenic
1020786374 7:12578251-12578273 ATGGATGGACAAGAGGAGAAAGG - Intronic
1021239022 7:18177964-18177986 ATGAATAAGCAAAAAGAAAAGGG - Intronic
1021833731 7:24645895-24645917 AAGGAAGAGCCAAATCAGAAAGG - Intronic
1021906987 7:25344299-25344321 ATGAAGGAGCAAAATTAAAAGGG - Intergenic
1022287876 7:28972828-28972850 ATTGATGAGAGAAAGGAGAAAGG - Intergenic
1022657642 7:32335034-32335056 ATGCATGGGCAAAATGAAAGTGG - Intergenic
1022897949 7:34771777-34771799 ATAGATGAACAAAATAAGAAAGG - Intronic
1023181503 7:37488380-37488402 AAGGATGACCAAAATGCGTAAGG - Intergenic
1023761882 7:43471795-43471817 ATGAATAAATAAAATGAGAAGGG + Intronic
1024829849 7:53437913-53437935 GTGGATCACCAATATGAGAAAGG + Intergenic
1025807110 7:64844532-64844554 CTGCATCCGCAAAATGAGAAAGG + Intergenic
1025918995 7:65892616-65892638 ATTGTTGATCTAAATGAGAAAGG - Intronic
1026012845 7:66650262-66650284 GTGGGTGACCAAAATGAGGAAGG + Intronic
1026375932 7:69750944-69750966 ATGGAAGAAGAAAAGGAGAAGGG + Intronic
1026525182 7:71147094-71147116 ATGCATGTGTAAAATGAGACCGG + Intronic
1027631501 7:80611331-80611353 ATGGGTGTGCAAAATGACACGGG - Intronic
1028089853 7:86685587-86685609 ATAGATAAGGAAACTGAGAAAGG - Intronic
1028829355 7:95310578-95310600 GAGGATGAGGAAAATGAGATTGG - Intronic
1030490547 7:110227936-110227958 AAGGATGATGAAAATAAGAAGGG - Intergenic
1031137966 7:117906559-117906581 ATGGGAGAGAAAAATGAAAAGGG - Intergenic
1031150493 7:118048515-118048537 AGGAATGAGAAAAATGAGAGTGG - Intergenic
1031939786 7:127776199-127776221 TGGGATGAGCTAAATGAGATGGG + Intronic
1032063317 7:128743831-128743853 GTGGGTGAGGAAAATGAGAAGGG + Intronic
1032095459 7:128936178-128936200 ATGGATGGGGAAAATGTGAATGG - Intergenic
1032114325 7:129103934-129103956 ATGGGTGATAAAAATGACAATGG - Intergenic
1032539426 7:132690975-132690997 ATGGATGCCCTAAAGGAGAACGG + Intronic
1032576375 7:133059411-133059433 ATGGAGGAGGAAAGTGAGGAGGG + Intronic
1033577090 7:142695851-142695873 ATGGATGATCAAATAGAGACAGG - Intergenic
1036223456 8:6939758-6939780 ATGTAGAGGCAAAATGAGAAGGG + Intergenic
1036236327 8:7042501-7042523 ATGTAGAGGCAAAATGAGAAGGG + Intergenic
1037103025 8:15071581-15071603 ATGAATGGGTAAGATGAGAATGG - Intronic
1037512568 8:19598699-19598721 CTGGATCACCAAAATGGGAAAGG + Intronic
1038249084 8:25886021-25886043 TTGGATGGGCAAAGAGAGAAAGG - Intronic
1038397506 8:27257899-27257921 ATGTGTGATCAAAATGGGAATGG + Intronic
1038615843 8:29093897-29093919 AAGGATGAGAAAAATAAGAGAGG + Intronic
1038713812 8:29973677-29973699 ATGGATGAGATCAATGATAAGGG + Intergenic
1039027500 8:33273513-33273535 TTGTAAAAGCAAAATGAGAAAGG + Intergenic
1039839549 8:41284198-41284220 ATGGAAGAGGAGAAGGAGAACGG + Intronic
1040424081 8:47266895-47266917 ATGGATGAGGGAAGAGAGAATGG - Intronic
1040663973 8:49608943-49608965 AAGGAGGAACAAAATAAGAAAGG - Intergenic
1041484685 8:58362067-58362089 ATGCTTGAGACAAATGAGAATGG + Intergenic
1041534145 8:58907171-58907193 ATGGATGACCCCAATAAGAATGG - Intronic
1041689096 8:60671925-60671947 ATGGAAGGGCCAAGTGAGAAAGG - Intergenic
1042155879 8:65842777-65842799 ATGGGTGAAAAGAATGAGAAAGG + Intergenic
1042194445 8:66220549-66220571 ATTGATGAGGAAAATAAGGAGGG + Intergenic
1042463995 8:69105392-69105414 ATGGATGAGAAATATGAAATTGG - Intergenic
1043167156 8:76917634-76917656 ATTGCTGAGCAAAATGAAAGGGG + Intergenic
1043379651 8:79688941-79688963 ATGGATGAGCTCAAGGAAAAAGG - Intergenic
1043689236 8:83129676-83129698 GTGGATGAGTAAAATAAGGAAGG + Intergenic
1044297933 8:90549840-90549862 AGAGAGGAGAAAAATGAGAAAGG + Intergenic
1044970900 8:97618667-97618689 ATGGATGATCAGAAAGTGAAAGG - Intergenic
1045977416 8:108145539-108145561 ATAAATGAGGAAACTGAGAAAGG - Intergenic
1046275109 8:111948939-111948961 GTGGATGAAGGAAATGAGAAAGG - Intergenic
1046376785 8:113393604-113393626 CTGGAGAAGGAAAATGAGAAAGG + Intronic
1046568838 8:115936669-115936691 ATGGATGAGCCAAGTTGGAAAGG - Intergenic
1046679342 8:117151158-117151180 AAGAATTAGCAAAAAGAGAAGGG - Intronic
1046860374 8:119085082-119085104 TTGGATGAGAAAACTGAGATTGG + Intronic
1047009784 8:120659348-120659370 ATGGATGAGCAAAAAAAAAGTGG - Intronic
1047897934 8:129387163-129387185 ATGGAAGAGCAAAGAGAGAGTGG - Intergenic
1048079187 8:131106447-131106469 ATGGAGAAGCAATAAGAGAAGGG - Intergenic
1048155851 8:131950234-131950256 CTGAAGTAGCAAAATGAGAATGG + Intronic
1048457112 8:134588195-134588217 ATGGAAGCACAAAATTAGAAAGG + Intronic
1048657154 8:136553141-136553163 ATGGATGAAGAAAGTGAGGAAGG - Intergenic
1048676688 8:136791903-136791925 ATGGATGTGCAATGTGTGAAAGG + Intergenic
1048873074 8:138814722-138814744 ATGGATGAGGAATCTGAGAGTGG - Intronic
1049137630 8:140918239-140918261 ATTAATGAGCAAAAGGACAACGG + Intronic
1050712403 9:8480485-8480507 CTGTATGAGAACAATGAGAAAGG + Intronic
1051304683 9:15696993-15697015 ATGGATCAGCAAGGGGAGAAGGG - Intronic
1051777640 9:20653720-20653742 ATGGATGAGCAAAGAAAGCAGGG - Intergenic
1052720251 9:32165282-32165304 ATGGATGAGTAGTTTGAGAATGG + Intergenic
1052986030 9:34488754-34488776 ATGGATGAACAAAATGACCTGGG + Intronic
1053437357 9:38084961-38084983 ATGGATTAGCAAAATTAGTTAGG - Intergenic
1054462372 9:65472273-65472295 ATCTATCAGCAAAAAGAGAAGGG - Intergenic
1055011634 9:71572914-71572936 ATGGAAGACCAAGCTGAGAATGG + Intergenic
1055279036 9:74653000-74653022 AGGGATTAGAAAAATCAGAAAGG + Intronic
1055792235 9:79935203-79935225 ATGGGTAAGCAAAAGGAGCAGGG + Intergenic
1055858607 9:80722616-80722638 ATGTATTAGCAGCATGAGAATGG - Intergenic
1056804718 9:89719719-89719741 ATGTATGAACAAAATAAAAATGG + Intergenic
1057604515 9:96489456-96489478 ATGGATGAGCAAAGGGAACAAGG - Intronic
1058478669 9:105368489-105368511 ATAGATGAGAAAATTGAGACTGG + Intronic
1059441716 9:114311081-114311103 ATTGATGTGCAATATTAGAAAGG + Exonic
1060497267 9:124127742-124127764 ATGGATGAGGAAAGTGAGGCCGG + Intergenic
1061906172 9:133699981-133700003 ATGGATGAGTAAAATATGATGGG + Intronic
1185891590 X:3826981-3827003 ATGAATGAGCAAAATGTGGTAGG + Intronic
1187105690 X:16239194-16239216 ATGGATGAAGAAACTAAGAAAGG - Intergenic
1187249761 X:17586293-17586315 CTGGATGTGCCAACTGAGAATGG + Intronic
1187371972 X:18716854-18716876 ATTGAGGAGGAAAATGAGGACGG - Intronic
1187678017 X:21737309-21737331 AAGGATGATCAGAAAGAGAATGG + Intronic
1189023637 X:37369116-37369138 ATGAATGAAGAAAATCAGAAAGG - Intronic
1189038692 X:37519312-37519334 ATAGAGGGGAAAAATGAGAAAGG - Intronic
1191007404 X:55724324-55724346 ATGGATGAGGAAAAAGGGATTGG - Intronic
1191870178 X:65739063-65739085 CAGGATGAGCAGGATGAGAATGG + Exonic
1193041283 X:77006465-77006487 ATGGTAGAGCACAATAAGAAGGG + Intergenic
1193629506 X:83865173-83865195 ATGGATGAGCAGGTTTAGAAGGG - Intronic
1194027541 X:88771197-88771219 ATGAATGAGGAAAATGAGAAAGG + Intergenic
1195433250 X:104812966-104812988 AAGAATTAGCAAAATGAGCAAGG + Intronic
1195884392 X:109624541-109624563 AGGGATGAGCGAGATGAGGAGGG + Exonic
1195966565 X:110434826-110434848 CTGGATGAGTAAAATGGGAGAGG - Intronic
1196016874 X:110948987-110949009 TTGGATGATGAAAATGAGGATGG + Intronic
1196706487 X:118721732-118721754 AAGGATGACCAGAATGAGAGAGG - Intergenic
1197560093 X:128010489-128010511 ATGGAAGAGAAAAGTAAGAAGGG + Intergenic
1198270644 X:135052820-135052842 TTGAAAGAGGAAAATGAGAATGG + Intergenic
1199057338 X:143313392-143313414 ATGGATGAACTATATCAGAATGG + Intergenic
1199489713 X:148384844-148384866 ATTGATGAGAAAACTGAGGATGG - Intergenic
1199895652 X:152125154-152125176 AAGAATGAACATAATGAGAATGG + Intergenic
1201907572 Y:19101337-19101359 ACTGATGAGAAAGATGAGAAAGG - Intergenic