ID: 960603741

View in Genome Browser
Species Human (GRCh38)
Location 3:119483808-119483830
Sequence ATCAAAAATGTCTACAGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 536
Summary {0: 1, 1: 9, 2: 45, 3: 105, 4: 376}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960603738_960603741 -8 Left 960603738 3:119483793-119483815 CCCCTAGTAGTAACAATCAAAAA 0: 1
1: 2
2: 12
3: 145
4: 597
Right 960603741 3:119483808-119483830 ATCAAAAATGTCTACAGACATGG 0: 1
1: 9
2: 45
3: 105
4: 376
960603739_960603741 -9 Left 960603739 3:119483794-119483816 CCCTAGTAGTAACAATCAAAAAT 0: 1
1: 1
2: 22
3: 214
4: 819
Right 960603741 3:119483808-119483830 ATCAAAAATGTCTACAGACATGG 0: 1
1: 9
2: 45
3: 105
4: 376
960603735_960603741 14 Left 960603735 3:119483771-119483793 CCCACTAAATGCCAGTAGCAGTC 0: 1
1: 10
2: 125
3: 450
4: 1127
Right 960603741 3:119483808-119483830 ATCAAAAATGTCTACAGACATGG 0: 1
1: 9
2: 45
3: 105
4: 376
960603736_960603741 13 Left 960603736 3:119483772-119483794 CCACTAAATGCCAGTAGCAGTCC 0: 1
1: 9
2: 91
3: 370
4: 932
Right 960603741 3:119483808-119483830 ATCAAAAATGTCTACAGACATGG 0: 1
1: 9
2: 45
3: 105
4: 376
960603737_960603741 3 Left 960603737 3:119483782-119483804 CCAGTAGCAGTCCCCTAGTAGTA 0: 1
1: 0
2: 1
3: 7
4: 59
Right 960603741 3:119483808-119483830 ATCAAAAATGTCTACAGACATGG 0: 1
1: 9
2: 45
3: 105
4: 376
960603740_960603741 -10 Left 960603740 3:119483795-119483817 CCTAGTAGTAACAATCAAAAATG 0: 1
1: 3
2: 105
3: 468
4: 1205
Right 960603741 3:119483808-119483830 ATCAAAAATGTCTACAGACATGG 0: 1
1: 9
2: 45
3: 105
4: 376

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960603741 Original CRISPR ATCAAAAATGTCTACAGACA TGG Intronic
900884885 1:5408103-5408125 ACCAAAAGTGTCTCCAGACATGG + Intergenic
901782827 1:11605349-11605371 TCCAAAAATGTCTCCAGTCATGG + Intergenic
902039114 1:13480047-13480069 ATCAAAACTGTCTCCAGTCCGGG + Intronic
902175442 1:14646688-14646710 AACAAAAATGTCTCCAGACATGG + Intronic
903025360 1:20426396-20426418 ATCAAAAAGGCATACACACACGG - Intergenic
903710647 1:25321358-25321380 AAAAAAAATGTCTACAGAATCGG + Intronic
905217152 1:36416870-36416892 ATGTAAAATGTCTCCAGCCAGGG - Intronic
905302744 1:36996892-36996914 ACCAAAAATGTCTTCCGTCATGG - Intronic
905506896 1:38486905-38486927 ATAAAAAATGTATACAGTTAAGG + Intergenic
905751136 1:40465090-40465112 GTCAAAAATGTCTCCAGACATGG + Intergenic
905775795 1:40666301-40666323 ACCAAAAATGTCTCCAGACATGG - Intergenic
906816337 1:48883760-48883782 ATCAAAATAGTCTACAGAGTTGG + Intronic
907211502 1:52827693-52827715 ATTAAAAATGTCTGCAGGCTGGG - Intergenic
907851402 1:58258508-58258530 ATGAAAAATGAGTCCAGACAGGG - Intronic
909068904 1:70969254-70969276 TTTAAAAATGTCTACATCCAGGG - Intronic
909116515 1:71544254-71544276 ATCAAAAGTGTCTAGGGGCAAGG + Intronic
909789925 1:79663252-79663274 ACCAGAAATTTATACAGACAGGG - Intergenic
910368952 1:86495916-86495938 ATCAAAAATGTCTCCATATGTGG + Intronic
910485029 1:87703709-87703731 ATTAAAAATGTCTAAATAAATGG + Intergenic
910938525 1:92507370-92507392 ACCCAAAATGTCTCCAAACATGG - Intergenic
911333463 1:96552583-96552605 ATCAAACACATCTGCAGACATGG + Intergenic
911589947 1:99735666-99735688 CTCAAAAATGTTTACAAAAAAGG - Intronic
911693528 1:100862325-100862347 ACCAAAAATCTCTCCAGACGTGG + Intergenic
912139717 1:106708647-106708669 ATAAAAACTGTCAACAGACTAGG - Intergenic
912702005 1:111885010-111885032 ACCAAAAATGTCTCCAGACATGG + Intronic
914202256 1:145496064-145496086 ATCAAAAATGTCTACAGGCTGGG + Intergenic
914236186 1:145813979-145814001 ATCAAAAATGTCTACAGGCTGGG + Intronic
914481382 1:148069206-148069228 ATCAAAAATGTCTACAGGCTGGG + Intergenic
915607467 1:156961850-156961872 ACTAAAAATGTCTCCAGACATGG - Intronic
917713871 1:177713847-177713869 AGCATAAGTGTCTTCAGACATGG - Intergenic
918417504 1:184326818-184326840 ACCAAAAATGTCTCTAGACATGG + Intergenic
918565498 1:185925762-185925784 ATCAAAAAGGTATCCAGAGAAGG + Intronic
918584852 1:186174502-186174524 TTCATCAATATCTACAGACATGG - Exonic
919492043 1:198216282-198216304 ATCAAAACTGTATAAATACATGG + Intronic
919683661 1:200460389-200460411 AACAAAAATTTGTAGAGACAGGG + Intergenic
921028915 1:211319199-211319221 ATCAAAAATGTCTCCAGACATGG + Intergenic
921584184 1:216928525-216928547 ATAAAAAATGTCCACGAACATGG - Intronic
923915163 1:238494207-238494229 GTCAAAAATTTCTACAAAAATGG + Intergenic
924164582 1:241268445-241268467 ATGAAAAATGTCTCTAGATATGG + Intronic
1063770053 10:9186751-9186773 AGAAAAAATGTCTACATACTTGG - Intergenic
1063913941 10:10861974-10861996 CTCCAAAATGCTTACAGACAAGG + Intergenic
1064698453 10:17991785-17991807 CTGATAAATGTCTACAGATATGG + Intronic
1065093304 10:22255929-22255951 AACAAAAATGTTTTCAAACAAGG - Intergenic
1065152519 10:22836743-22836765 AACAACAATGTCAACAGAAAAGG - Intergenic
1065446136 10:25802952-25802974 AAAAAAAATGTCTCTAGACATGG + Intergenic
1065808244 10:29415515-29415537 AAATAAAATGTCAACAGACATGG - Intergenic
1066367080 10:34787725-34787747 ATGAAAAATGTCCACACCCAAGG + Intronic
1066474499 10:35731818-35731840 ATCCAAAACCTTTACAGACAGGG - Intergenic
1068165500 10:53326673-53326695 AACAAAAATGACTCCTGACACGG - Intergenic
1068406067 10:56590580-56590602 AACTAAAATGTCTTCAGACTTGG + Intergenic
1068984417 10:63094085-63094107 AACAAAAATGTCCCCAAACATGG + Intergenic
1069417405 10:68213135-68213157 GCCCAAAATGTCTTCAGACATGG + Intergenic
1069520660 10:69117570-69117592 ATCAAAACTGTCTCCAGGCCGGG + Intergenic
1069924272 10:71837505-71837527 ATCATAAAGCTCTACAGGCAAGG + Intronic
1071415449 10:85437050-85437072 ATCCAAAATGTCTGCAGGAATGG - Intergenic
1071552533 10:86577987-86578009 ATCAAAAATGTGAAAAGTCAAGG - Intergenic
1072328242 10:94319713-94319735 GTCAAACATGTACACAGACAAGG + Intronic
1072772846 10:98156970-98156992 ACCAAAAATATTTTCAGACATGG - Intronic
1074119325 10:110481742-110481764 ACCCAAAATGTTTCCAGACATGG + Intergenic
1074313375 10:112341404-112341426 ATGAGAAATGTCTCCAGACATGG - Intergenic
1075511523 10:123076403-123076425 ATAAAAAAGGTCCAGAGACAAGG - Intergenic
1075538890 10:123295708-123295730 AACTAAAATGTCTCCAGACATGG + Intergenic
1076095626 10:127733297-127733319 ACCAAAAATGTCTTCAGACATGG - Intergenic
1077590568 11:3487803-3487825 ACCAAAATTGTCTCCAGACATGG - Intergenic
1078070677 11:8107444-8107466 ATCTTAAATGGCTATAGACAGGG + Intronic
1078182764 11:9026618-9026640 AAAAAAAATGTATAGAGACAGGG + Intronic
1078347099 11:10560001-10560023 ATCATAAAGGGCTACAGAGAAGG - Intronic
1078459194 11:11500475-11500497 ACCAAAAACATCTCCAGACATGG - Intronic
1078872711 11:15363890-15363912 ATAAAAAATGTCTATGGACATGG - Intergenic
1079032676 11:16997272-16997294 ATCAGAAATGTCCATGGACAAGG + Intronic
1079415011 11:20225887-20225909 TTCTAAAATGTCTACAGATAAGG + Intergenic
1079894809 11:26104933-26104955 AGCTGAAATGTCTAGAGACAAGG - Intergenic
1080322799 11:31033843-31033865 AGTAAAAATGTCTACAGGCCGGG + Intronic
1081591271 11:44424904-44424926 ATCAAAAATGTCTCCAGCCATGG - Intergenic
1082190712 11:49240073-49240095 ATAAAAATTGTATACAGTCATGG - Intergenic
1082922427 11:58510063-58510085 GTCAAAAATGTCTCCAGACGTGG + Intergenic
1082989026 11:59191532-59191554 ACCAAAAATGTCTCCAGACATGG - Intronic
1083693788 11:64429006-64429028 ACCAAAGATGTCTCCAAACATGG - Intergenic
1084044508 11:66560984-66561006 ATAAAAGATGTCCACACACAAGG - Intronic
1084246289 11:67859584-67859606 ACCAAAATTGTCTCCAGACATGG - Intergenic
1084568057 11:69942810-69942832 ATCAAAAATGTACACAAACGTGG - Intergenic
1084826393 11:71734916-71734938 ACCAAAATTGTCTCCAGACATGG + Intergenic
1085353966 11:75818986-75819008 ATCAAAAATGAGTTCAGACATGG + Intronic
1085700837 11:78744670-78744692 CTCAAAAATGTTTACAGAAAGGG - Intronic
1086388998 11:86341215-86341237 AACAAAAATGTATACTGATAAGG - Intronic
1086496747 11:87411902-87411924 CCAAAAAATGTCTCCAGACAAGG + Intergenic
1086675410 11:89600870-89600892 ATAAAAATTGTATACAGTCATGG + Intergenic
1088353826 11:108920867-108920889 ACTAAAAATGTCTTCAGACATGG + Intronic
1089473976 11:118743502-118743524 ACCAAAAATATCTACAGATAAGG + Intergenic
1089575000 11:119435649-119435671 ACCAAAAATGTCTCCAGACATGG - Intergenic
1089948559 11:122503943-122503965 ATGAAAAATGTCCAAATACATGG + Intergenic
1090378280 11:126306885-126306907 ATCAAAAATGTCTTCACCGATGG - Intronic
1091390457 12:123107-123129 ATCAAAGATGTCTAGAGGCTGGG + Intronic
1092416855 12:8296708-8296730 ACCAAAATTGTCTCCAGACATGG - Intergenic
1092770787 12:11894694-11894716 TTCAAAAATGTATTCAGACTTGG - Exonic
1092968314 12:13667162-13667184 ATGAAAAATGCAGACAGACATGG + Intronic
1093710827 12:22328015-22328037 ACCAAATATGTCTCCAGACTTGG - Intronic
1093791758 12:23259623-23259645 CTCAATAATTCCTACAGACAAGG + Intergenic
1094165075 12:27435316-27435338 ACCAAAAATGTCTGCAGACAGGG + Intergenic
1094824103 12:34254580-34254602 AACAAAAATGTCAACATATATGG - Intergenic
1095087069 12:38068628-38068650 AACAAAAATGTCAACATATATGG + Intergenic
1097427179 12:59460579-59460601 TTTAAAGATGTCTACAGAAAAGG - Intergenic
1097789915 12:63804146-63804168 ATCAAAAACGTCTCCAGGCCAGG - Intronic
1098971589 12:76862756-76862778 ATGAAAAATGTTTACATAGAAGG + Intronic
1099254376 12:80297631-80297653 ATCAAAAATGTACATATACAAGG - Intronic
1099827909 12:87802271-87802293 AGCAAAAATGTTTCCAGAAATGG - Intergenic
1100281232 12:93120175-93120197 ATCATGAATGCCTCCAGACAAGG - Intergenic
1100833005 12:98536334-98536356 ATGATAAATGTCTACAAAAAGGG + Intronic
1100860669 12:98802851-98802873 ATAAAAAATACCAACAGACAGGG - Intronic
1101268116 12:103113538-103113560 ACCCAAAATGTCTCCAGACATGG - Intergenic
1101349404 12:103914737-103914759 ATCATAAATGTTTTCAGACTTGG + Intergenic
1101878631 12:108611452-108611474 ACCAAACACGTCTCCAGACATGG + Intergenic
1102401392 12:112632694-112632716 ATCAAAATTGTCTCCAGGCATGG - Intronic
1102596502 12:113996821-113996843 ATAAAAAATGTCTCCAGGCCAGG + Intergenic
1102630870 12:114278429-114278451 CTCAAAAATGTTAAAAGACATGG - Intergenic
1103722861 12:122983884-122983906 ACCAAAAATGTTTACAGAGTTGG - Exonic
1103844632 12:123892871-123892893 AGCAGAAATATCTCCAGACATGG + Intronic
1104615919 12:130268495-130268517 ACCAAAAATGTCTCCAGACATGG - Intergenic
1106951622 13:34890822-34890844 CTAAAAAATGTCTACAGACTGGG - Intergenic
1107106295 13:36646799-36646821 ATAAAACATGTCTATGGACAGGG + Intergenic
1107377122 13:39815934-39815956 ATCAAAAATATCTCCAGACATGG + Intergenic
1108669953 13:52675896-52675918 ACCCACAATGTCTCCAGACATGG + Intronic
1108698527 13:52924326-52924348 ACCAAAAATGTCTCTAGACATGG - Intergenic
1108780544 13:53825801-53825823 AATAAATATGTCTAGAGACAAGG - Intergenic
1108915738 13:55608680-55608702 ACCAAAAATATTTCCAGACATGG - Intergenic
1108977634 13:56468562-56468584 AATAAAAATGTCTCCACACAAGG + Intergenic
1109556116 13:63977591-63977613 TTCTAAAATGTCTACAGATGTGG - Intergenic
1109718624 13:66248434-66248456 ATAATAAATGTCTTCAGAAAAGG - Intergenic
1109736762 13:66496321-66496343 ATCAAAAATGAAAACAGACCTGG - Intronic
1109996385 13:70132977-70132999 CTCTAAAATCTCTACAGCCAGGG + Intergenic
1111176033 13:84597485-84597507 ACCAAAAATGGCCACATACAGGG - Intergenic
1112359590 13:98705451-98705473 ACAAAAAATGTCTCCAGAGATGG + Intronic
1112501706 13:99947923-99947945 GTCAAAAATGTCTCCAGGCTGGG - Intergenic
1113103473 13:106746696-106746718 TTCCAAAATGTCTACAGCCCTGG + Intergenic
1114295568 14:21326069-21326091 ATCAAAAACATGTATAGACAAGG - Exonic
1114501536 14:23172687-23172709 ACCAAAAGTGTCTCCAGATACGG - Intronic
1114786112 14:25601424-25601446 TTCAAAAATGTTTAGAAACATGG + Intergenic
1115112070 14:29836112-29836134 ATCAAAACAGACTACAGAGAAGG + Intronic
1115466152 14:33716560-33716582 ATGAAAAAGTTCTAGAGACAGGG - Intronic
1115575335 14:34705457-34705479 ATGAAAAATGTCTAGATAAAGGG + Intergenic
1116352895 14:43888137-43888159 ACCATAAATGTCTTCAGACATGG + Intergenic
1117263027 14:54056360-54056382 ATCATAAATGTCAATAGATAAGG - Intergenic
1117552935 14:56853937-56853959 TTCAAAAATGTCAACAGCAAGGG + Intergenic
1119822399 14:77628768-77628790 ATCAGCAATGTCTACAAAAAAGG - Intergenic
1120210211 14:81626803-81626825 ACCAAAAATGTCTTCAGTCATGG + Intergenic
1120810887 14:88802452-88802474 ATCTAGAATGTCTACACAGAAGG - Intergenic
1121520340 14:94581791-94581813 ACCAAATGTGTCTGCAGACATGG - Intronic
1123712554 15:22999554-22999576 ATACAAAATGTATCCAGACATGG - Exonic
1125276417 15:37996773-37996795 GTCCAAAATGTCTTCAGACCTGG + Intergenic
1126617387 15:50598594-50598616 CTCTAAAATGGTTACAGACAAGG - Intronic
1127414687 15:58746602-58746624 AAGAAAAATGTCTTAAGACAAGG + Intronic
1127545418 15:59990158-59990180 CTCAGAAATGTATACAGAAAAGG + Intergenic
1129918522 15:79296782-79296804 ACCAAAAATGTCTCTAGACGTGG + Exonic
1130044464 15:80432959-80432981 AGTAAAAATGTTTACACACAAGG - Intronic
1130092678 15:80834105-80834127 TCCCAAAATGTCTCCAGACATGG + Intronic
1130385358 15:83406749-83406771 ATCACAACTCTCTCCAGACAAGG - Intergenic
1130774471 15:86964420-86964442 ACAAAAAATGTGTCCAGACATGG + Intronic
1130935170 15:88464060-88464082 ACCAAAAATATCTCTAGACATGG - Intronic
1130980444 15:88808586-88808608 ACAAAAAATGTCTCCAGACATGG - Intronic
1131156389 15:90078610-90078632 ACCATAAATGTCTCCAAACATGG - Intronic
1131394191 15:92073795-92073817 AGCAAAACTGTCTTCAGACATGG + Intronic
1132029576 15:98428936-98428958 ACCAAAAATATCTCCAGACATGG + Intergenic
1133174811 16:4006142-4006164 ACCAAAAATGTCTCCAGACATGG - Intronic
1133274836 16:4631464-4631486 ATCACAAATGTCTCCAGACATGG - Intronic
1133355937 16:5136888-5136910 ACCAAAACTGTCTCCAGACATGG - Intergenic
1133583532 16:7169488-7169510 CTGAGAAATGTCTATAGACATGG + Intronic
1133755377 16:8758679-8758701 ACCAAAAATGTCTGCAGACATGG + Intronic
1133826244 16:9280707-9280729 ACCAAAAATGTCTCTAGATATGG - Intergenic
1134009218 16:10838875-10838897 ATGCAGAATGTCTCCAGACATGG + Intergenic
1134161998 16:11898861-11898883 ATTAAAAATATCTGCAGAAAAGG + Intronic
1134213406 16:12297014-12297036 ATCACAAATGTCTCCAGACATGG + Intronic
1134394194 16:13848095-13848117 AGCCAAAATGTCTCCAGACATGG + Intergenic
1134827411 16:17295707-17295729 AACAAAAATGTCTCCAGACATGG - Intronic
1134860430 16:17555670-17555692 ATCAAAAATGTCTCCAGACATGG + Intergenic
1135078653 16:19415386-19415408 ACCAAAAATGTCTTCAGGAATGG - Intronic
1135142441 16:19933171-19933193 TCCAAAAATGTCTCCAGACATGG - Intergenic
1135350064 16:21721375-21721397 ACCAAAAATGTTTGCAGACATGG - Intronic
1135886626 16:26315773-26315795 ATCAAGAATGTATATAGACCAGG - Intergenic
1137294064 16:47073409-47073431 AGCAAAACTGTCCCCAGACATGG - Intergenic
1137356205 16:47767589-47767611 ATCAAAAGTGTCTACATGTAGGG + Intergenic
1137893180 16:52183605-52183627 AACATAAATGTGTACAGACATGG - Intergenic
1138959004 16:62006771-62006793 ATCTAAAATGGCCACAGAAAAGG - Intronic
1138969111 16:62123576-62123598 ATCAAAAAAGTATCCAGGCATGG - Intergenic
1139255227 16:65534663-65534685 ACCAAGAATCTCTTCAGACAGGG + Intergenic
1139285762 16:65812537-65812559 GGAAAAAATGTCTACTGACAGGG - Intergenic
1140556293 16:75925224-75925246 ACCCAAAATGTCTCAAGACATGG + Intergenic
1140700189 16:77574536-77574558 ACCAAAAATGAATCCAGACATGG + Intergenic
1140954117 16:79846742-79846764 AACAAAAATGTCTCCATGCATGG - Intergenic
1141440007 16:84024124-84024146 ACCCAAAATGTCTGCAGACATGG + Intronic
1141746713 16:85931070-85931092 ACCAAAAATGTCTCCAGACATGG - Intergenic
1141756132 16:85992200-85992222 ACAAAAAATGTCCCCAGACATGG + Intergenic
1143965009 17:10750879-10750901 ATCAAAAATGTTTCCAGATGTGG + Intergenic
1144662544 17:17080555-17080577 ATCAAGGATGACTCCAGACATGG - Intronic
1144757867 17:17691185-17691207 ACCAAAAATGTCTCCTGACATGG - Intronic
1146171839 17:30640525-30640547 ATCAACCACGTCTACAGACGTGG + Intergenic
1146345294 17:32056550-32056572 ATCAACCACGTCTACAGACGTGG + Intergenic
1146720096 17:35118157-35118179 ATCAAAAATGTCTCCTGACATGG - Intronic
1147855119 17:43473932-43473954 ACCAAAAATGTCTCCAGACATGG - Intergenic
1147909083 17:43844071-43844093 ATCAAAAATGTCTCCAGGCTGGG - Intergenic
1147978275 17:44260159-44260181 ATCAAGAGTGGCTACAGAAAAGG + Intronic
1148832768 17:50445497-50445519 ATCAAAAGTGTCTACAGGCTGGG + Intronic
1150383625 17:64740278-64740300 ACCAAAAATGTCTCCAGGCCAGG + Intergenic
1151179119 17:72312903-72312925 AGCAAAACTGTCTCCAGACATGG + Intergenic
1151227984 17:72660868-72660890 AACCAAAACGTCTCCAGACATGG + Intronic
1152217011 17:79039209-79039231 ACAAAAAATGTCTCCAAACATGG - Intronic
1153516506 18:5907620-5907642 TTAAAAAATGTCTGCAGACTGGG - Intergenic
1153619523 18:6964054-6964076 CTCTAAAATGTCTAGAGAGAGGG + Intronic
1156272739 18:35551901-35551923 AACAAAAATTACTACAGGCAAGG - Intergenic
1156839088 18:41590172-41590194 ACCAAAAATGTATATAGAGATGG + Intergenic
1157775389 18:50391437-50391459 ACCAAAAATGTCTCCAGACATGG - Intronic
1158449324 18:57549643-57549665 ATTAAAAATATCTACAGGAAAGG + Exonic
1158927991 18:62290109-62290131 ATAAAAATTGTTCACAGACATGG - Intronic
1159050256 18:63415183-63415205 ATGAAAAATGCTAACAGACATGG - Intronic
1159158252 18:64610535-64610557 AACAAAAATGTCTCCAGATGTGG + Intergenic
1159987313 18:74858253-74858275 ATAAAAAATATTTACAGAAAAGG - Intronic
1160400164 18:78604698-78604720 ATTAAAAATGGATACAGTCACGG - Intergenic
1160443856 18:78912671-78912693 TTCAAAAATCTCCACAGACTTGG + Intergenic
1161328660 19:3675861-3675883 ACCACAGATGTCTCCAGACATGG + Intronic
1161523049 19:4736558-4736580 ACCACAAATGTCCCCAGACATGG - Intergenic
1161880665 19:6949470-6949492 ATCAAAAATGCCTCCAGAGGGGG - Intergenic
1161938060 19:7384294-7384316 ATCAAAAATGTCTCCAGACATGG + Intronic
1162264586 19:9561028-9561050 ATGAAAGATAGCTACAGACAAGG + Intronic
1163399491 19:17083498-17083520 ACCAGAAATGTCTCCAGACATGG + Intronic
1163540205 19:17904336-17904358 ATCAAAATTGTTTCCAGACATGG + Intergenic
1164144511 19:22503745-22503767 CTCAAAAATGTTGGCAGACATGG + Intronic
1164154911 19:22587578-22587600 ACCCAAAATGTGTACACACAAGG + Intergenic
1164449420 19:28347613-28347635 ATCAAAAATTTTTCCAGAAAGGG + Intergenic
1164946239 19:32295422-32295444 GTCCAAAATGTCCAAAGACAAGG + Intergenic
1165292401 19:34897992-34898014 GTCAAAAATATCTACAGAATAGG + Intergenic
1165375259 19:35437377-35437399 ATCCAGAATGTTTAGAGACAGGG + Intergenic
1165526868 19:36363550-36363572 ACCAAAATTGTCTCCAGATATGG - Intronic
1168416948 19:56175344-56175366 AACAAAACTGTCTCCAGACTTGG + Intergenic
1168421586 19:56207679-56207701 AACAAAAATGTCTCTAGACATGG - Intronic
1168504895 19:56925333-56925355 ATCACAAATTTCTCCAGACATGG - Intergenic
926039056 2:9658166-9658188 ATGAGAAATGTCTATAAACAAGG - Intergenic
926176651 2:10598920-10598942 GTCAAAAATGTTTAAAGGCATGG + Intronic
926177892 2:10612833-10612855 ATAAAAAATGTGTAGAGACAAGG - Intronic
927324204 2:21784528-21784550 ATCAATAAGATCTACAGAAAGGG - Intergenic
927823759 2:26292658-26292680 ATCTAAGATGCCTACAGACGAGG + Intergenic
929083514 2:38145704-38145726 GTCAGAAATTTCTACAGAGATGG + Intergenic
929085714 2:38165314-38165336 AACCAAAAAGTCTCCAGACATGG - Intergenic
929607312 2:43243290-43243312 ACCAAAAATGTCTCCAGACACGG - Intronic
930886952 2:56336863-56336885 ATCAAGAATATCTAAAGTCAGGG + Intronic
931159986 2:59678577-59678599 ATCTAAAATTTATATAGACATGG - Intergenic
933227958 2:79772735-79772757 AAAAAAAATGTGTAGAGACAGGG + Intronic
934890034 2:98059339-98059361 ATCAAGAATCACTAGAGACAAGG + Intergenic
935483636 2:103624641-103624663 ATAAAAACTGTCTACAGATTAGG + Intergenic
935671829 2:105562556-105562578 ATCAAAAATGTCTTCAGGCGGGG + Intergenic
936864938 2:117066636-117066658 ACCAAATATGTCTCCAGACCTGG - Intergenic
936882220 2:117267274-117267296 ATCAAAAAAGATGACAGACATGG + Intergenic
937115677 2:119403483-119403505 ACCAAAAATGTAAGCAGACAGGG - Intergenic
937330252 2:121022179-121022201 ACCAAAAATGTCTATGGACATGG - Intergenic
937336301 2:121064415-121064437 ATCAAAACTGGCTCCAGACCAGG - Intergenic
937524780 2:122754955-122754977 ACCAAAAATGTCCCTAGACATGG + Intergenic
938178387 2:129157309-129157331 ATGGAAAATGTGTACAGACATGG - Intergenic
938663373 2:133509675-133509697 ATGAAAACTGTCTCCAGACATGG - Intronic
940150253 2:150592226-150592248 ACCAAAAATGTCTGGAGACATGG + Intergenic
940742968 2:157533005-157533027 AGAAAAAATGTCAACAGATATGG + Exonic
941052192 2:160747635-160747657 ATAAAAAATGTCTGCAGTCATGG - Intergenic
941562294 2:167061920-167061942 ATAAAAAATGATTACAGACTTGG - Intronic
941937795 2:170999931-170999953 TTAAAAAATTTATACAGACAGGG + Intronic
943176309 2:184478997-184479019 ATCAGCAATGACTACAAACAAGG + Intergenic
943695474 2:190925007-190925029 TTCAAAAATGTCTTCATAAAAGG + Intronic
943708540 2:191062208-191062230 ATAAAAAATGTATCCAGGCATGG - Intronic
944471744 2:200060840-200060862 ATCAACAAAGTAAACAGACAAGG + Intergenic
945037088 2:205713514-205713536 ATGAACAATGGCGACAGACATGG - Intronic
945459676 2:210091012-210091034 ATGAAAAATGTCTAAAGGAAAGG - Intronic
945915063 2:215695058-215695080 ATCACAATTGTATACATACATGG - Intergenic
946477647 2:220024082-220024104 ATCACAAGTGTCTTCAGAAAAGG - Intergenic
946632865 2:221690113-221690135 CTCTAAAATGTCAAAAGACACGG - Intergenic
946647417 2:221852586-221852608 ATCAAATATTTCTACACAAAGGG - Intergenic
947131361 2:226929460-226929482 ATAAAAAATGTCAACAAACTAGG + Intronic
947257083 2:228179220-228179242 ACCAAAAATGTTTTCAGACTTGG + Intronic
947704386 2:232262506-232262528 ATCAAAAATGTCTCCAGACATGG - Intronic
948576301 2:238952553-238952575 AACCAAAATGTCCACTGACATGG - Intergenic
1170472645 20:16683623-16683645 ATCAAAAATGTCTCCAGACCAGG - Intergenic
1171163906 20:22954000-22954022 AACAAAAAAAGCTACAGACAGGG + Intergenic
1172301327 20:33852571-33852593 ACCAAAAATGTCTTCAGACATGG + Intronic
1172938276 20:38636631-38636653 ATCAAAAATGTCCACTAATAGGG - Intronic
1174177551 20:48654526-48654548 AACAAAAATGTCTCCGGGCAGGG + Intronic
1174204750 20:48830066-48830088 ATCAAAAATGTCTCCAGGCTGGG + Intergenic
1174498722 20:50968486-50968508 AATCAAAATGTCTCCAGACATGG - Intergenic
1174565032 20:51458361-51458383 ACCAAGATTGTCTCCAGACAAGG + Intronic
1174910176 20:54599687-54599709 ATTAAAGATGGCCACAGACAAGG - Intronic
1175154339 20:56959554-56959576 ACCAAAAATGTCTCCGGACATGG + Intergenic
1175266339 20:57705777-57705799 GCCAGAAATGTCTCCAGACATGG - Intronic
1175545619 20:59775974-59775996 ATCTAAAATGTCTCCAGACTTGG + Intronic
1177040638 21:16105685-16105707 ATCAAAGATTTCTATATACAGGG - Intergenic
1177421478 21:20863566-20863588 ATCAACATTGACTACAGAAAGGG + Intergenic
1179025700 21:37676705-37676727 ATCAAAAATGTCTCCAGACATGG - Intronic
1179117972 21:38511889-38511911 ACCAAAACTGTCTTTAGACATGG + Intronic
1179143623 21:38748905-38748927 AGCAAAAATGACTGCAGGCAAGG - Intergenic
1180134330 21:45852116-45852138 ATCATAAATGTTTACAGTGATGG + Intronic
1180781861 22:18524976-18524998 ATCAAAAATGTCTTCAGATCGGG - Intergenic
1181238747 22:21464320-21464342 ATCAAAAATGTCTTCAGATCGGG - Intergenic
1181775017 22:25153329-25153351 ACCAAAAATGTCTCCAGACAAGG - Intronic
1183396744 22:37575998-37576020 ACCAAGAATGTCTCCAGACAGGG + Intronic
1183725807 22:39589120-39589142 ACCAAAAATGTCTCCAGACACGG + Intronic
949843046 3:8340743-8340765 GACAAAAATGTCTACATTCACGG - Intergenic
950374478 3:12559334-12559356 ATTATCAATGTCTAGAGACAAGG - Intronic
951171244 3:19544335-19544357 ATGAAAAATGTGTATGGACATGG - Intergenic
952000144 3:28775698-28775720 ATCAAAAATGTCTCCAGGCATGG - Intergenic
953000704 3:38930760-38930782 GTTAAAAATGTCTTCATACAAGG - Intronic
953394640 3:42558024-42558046 ACCAGAAATGACTCCAGACATGG - Intronic
955063925 3:55518119-55518141 ATCAAAAATGTCTCAGGACATGG + Intronic
955506065 3:59634433-59634455 ATTTAAAATCTCTCCAGACATGG - Intergenic
955540502 3:59971305-59971327 CTCAAAAATGTGAACACACATGG + Intronic
955738836 3:62067867-62067889 ACCAAAAATGTCTCTAGACATGG + Intronic
955744952 3:62131257-62131279 ACGAAAAACGTCTCCAGACATGG + Intronic
955761784 3:62292670-62292692 AGCAAAAAAGTCTCCAGACATGG - Intronic
955775435 3:62427595-62427617 ACCAGGAATGTCTCCAGACATGG + Intronic
956067846 3:65415787-65415809 ACCAATAATGTCTTCAGACAGGG - Intronic
956328027 3:68074527-68074549 AACAAAAATGCCTACAGCAAAGG + Intronic
956339632 3:68208048-68208070 ATGAAAAATATAAACAGACAGGG - Intronic
956955106 3:74329401-74329423 ATAAAGAATGTCTAGAGCCAAGG - Intronic
957355142 3:79073738-79073760 AGCACAAATGTGTTCAGACAAGG - Intronic
960501267 3:118441836-118441858 ATTAAAAATGTATAGACACAGGG - Intergenic
960603741 3:119483808-119483830 ATCAAAAATGTCTACAGACATGG + Intronic
961894407 3:130155309-130155331 ACCAAAATTGTCTCCAGACATGG - Intergenic
961967561 3:130921629-130921651 ATAAAAACTCTCTACAAACAAGG - Intronic
962399689 3:135047800-135047822 AACCAAAATGTCTCCAGACATGG - Intronic
963151610 3:142051242-142051264 ATCAAAAATGTCTCCAGGCCTGG + Intronic
963437292 3:145288173-145288195 ATCAAAAACTTCTACAGCCTAGG - Intergenic
963646064 3:147915910-147915932 ATCAAAAATGTCTCCAGGCCGGG - Intergenic
963897460 3:150702569-150702591 ATCAAAAATGTCTCCAGGCCGGG - Intronic
964054914 3:152442167-152442189 ATGAAAAATGCCTATAGTCATGG + Intronic
964249330 3:154692363-154692385 ACCAAAAATGTCTACAGACATGG - Intergenic
966752053 3:183331476-183331498 AACACAAATGTATACAGAAAAGG - Intronic
967232208 3:187350606-187350628 ACCAAAACTGACTCCAGACAAGG + Intergenic
969004497 4:4008388-4008410 ACCAAAACTGTCTCCAGACATGG - Intergenic
969249716 4:5959036-5959058 ACCAAAAATGTCTCCAGACATGG + Exonic
969748371 4:9091760-9091782 ACCAAAACTGTCTCCAGACATGG + Intergenic
969809402 4:9636319-9636341 ACCAAAACTGTCTCCAGACATGG + Intergenic
971641567 4:29139858-29139880 TTCAAAAATGTTTACTGAAAAGG - Intergenic
971950463 4:33338947-33338969 ATTAAGAATGTCTAAAGTCAAGG - Intergenic
972980083 4:44687282-44687304 TTCAATAATTTCTACAGACAAGG - Intronic
973239634 4:47943841-47943863 ATGAAAAATGACTTCAGTCAGGG - Intronic
973700625 4:53533693-53533715 ATCAAAAATGTCTCCAGGCTGGG - Intronic
974188187 4:58466942-58466964 ATCAATAAAGACTACAGAAAAGG - Intergenic
974591820 4:63959295-63959317 ATCAAATATGTCTACATATTAGG - Intergenic
974616515 4:64290619-64290641 ATGAAAAATGCATACAGAAATGG - Intronic
974629652 4:64469033-64469055 TATAAAAATGTCTAAAGACATGG + Intergenic
974633052 4:64520065-64520087 ATAAAAAATGTCCACACAAAGGG + Intergenic
974906119 4:68059603-68059625 GTCATAAATGTCTACATGCAAGG + Intronic
975266444 4:72374781-72374803 ATCAAAAATGACAACAGAAATGG + Intronic
976047803 4:80973149-80973171 ATCAAAATTTACTAGAGACATGG + Intergenic
976155174 4:82136294-82136316 ATGAAAAATGCCTTTAGACATGG - Intergenic
976337393 4:83906162-83906184 ACCAAAAATGTCTCCAGACATGG + Intergenic
976456716 4:85256456-85256478 ATCACACCTGTCTTCAGACAAGG - Intergenic
978271754 4:106899469-106899491 AAAAAAAATGTGTAGAGACAGGG + Intergenic
978403757 4:108358685-108358707 ACCAAAAATGTCTTAAGTCATGG - Intergenic
978627381 4:110702663-110702685 GTAAGAAATTTCTACAGACATGG - Intergenic
981735840 4:147949457-147949479 ATCAGTAATGTCTCCAAACATGG - Intronic
982014307 4:151138176-151138198 ATGAAAAAAGTTTATAGACATGG + Intronic
982519000 4:156389481-156389503 TTTAAAAATGATTACAGACATGG - Intergenic
983122224 4:163900582-163900604 ATCAAAAATGTTTACATATTAGG - Intronic
983507558 4:168571645-168571667 CTAAAAATTGTCAACAGACAAGG - Intronic
983646828 4:170000010-170000032 ACCAAAAATGTCTCCAGACTTGG + Intronic
983700559 4:170588283-170588305 CTCAAAAATGTCTAATGAGAGGG + Intergenic
984041311 4:174737665-174737687 ATACAAAATTTCTCCAGACATGG - Intronic
984498736 4:180532013-180532035 ACCAAAAATGTCTCCAGAAATGG - Intergenic
985118058 4:186611504-186611526 AACAAGAATGTCCTCAGACACGG + Exonic
986688225 5:10292382-10292404 ATAAAAATTTTATACAGACAAGG + Intronic
986704831 5:10446361-10446383 ATCAAAAATGTCTCCAGGCCGGG + Intronic
986732554 5:10645906-10645928 ACCAAAAATGTCTACAGACGTGG - Intronic
987259726 5:16190910-16190932 ACCAAAAATGTCTCCAGACATGG - Intergenic
987417025 5:17672540-17672562 ATTGAATATGTCTACAGAGAGGG + Intergenic
988575598 5:32420658-32420680 ATCAAAAATATATGCAGATATGG - Intronic
988745424 5:34130778-34130800 ACCCAAAATGTATACACACAAGG + Intergenic
989133917 5:38134648-38134670 ACCAAAAATATCAGCAGACATGG - Intergenic
989371725 5:40717617-40717639 AACAAAAATGTCTCTAGACATGG + Intronic
989652584 5:43709612-43709634 CTCAGGAATGTCTACAGTCAGGG + Intergenic
990334983 5:54763843-54763865 ATCAAAAACGTCTTCTGACAAGG - Intergenic
990669526 5:58112558-58112580 ACTAAAAATGTCTCCAGACATGG + Intergenic
991919053 5:71636092-71636114 ATGAAGAATTTCTAAAGACATGG - Intronic
992355266 5:75975417-75975439 ATAAAATATGTCTATAGACATGG - Intergenic
993032082 5:82716185-82716207 AGAAAAAATGTCTAGAGACAGGG + Intergenic
993034852 5:82745501-82745523 ACCAAAACTGTCTCCAGACATGG + Intergenic
994109771 5:95988136-95988158 AGCAAAAATGTCTCCACACAAGG - Intergenic
994767724 5:103940458-103940480 TTGAAAAATGTATAAAGACAAGG - Intergenic
995066614 5:107869914-107869936 ATGATAAATGTTTACTGACATGG + Intronic
995097745 5:108259251-108259273 ATAAAAAATGTCTATCGATATGG + Intronic
995421019 5:111967006-111967028 AATAAAAATGTCTTTAGACATGG - Intronic
995453215 5:112325618-112325640 TTCAAAAATGTCTTAAGAAAAGG + Intronic
995512745 5:112924458-112924480 AGCAAAAATGTCTACCCTCACGG - Intergenic
996980474 5:129486546-129486568 ATCAAAACTGTCAACAAACTAGG + Intronic
997868247 5:137483755-137483777 ACCAAAAATGTCTCCAGACAGGG + Intronic
997926711 5:138036826-138036848 ACCAAAAATGTCTGCACACATGG - Intronic
998189054 5:140007043-140007065 AACAAAAATGTCTCTAAACATGG - Intronic
999600334 5:153255712-153255734 TTCAAAAATGCCTATAGCCAAGG - Intergenic
1000497238 5:162000013-162000035 ATCAAAATTGTCTCCAGAAGTGG + Intergenic
1000517299 5:162254192-162254214 ATCAGCAATGTCAAAAGACATGG - Intergenic
1001017975 5:168158654-168158676 ATCAAAAATGTCTCCAGACTGGG + Intronic
1002374871 5:178781445-178781467 AGCAAAAATGTTAACACACATGG - Intergenic
1002463582 5:179389608-179389630 GTCAAAAATGTCTCCAGACATGG - Intergenic
1003967420 6:11266278-11266300 ATCCAAAATGTCTCCAGATATGG - Intronic
1004608316 6:17214716-17214738 ATCAAAAATGTCTCCAGACATGG - Intergenic
1005187092 6:23174702-23174724 ATCAAAATTTTCTCCATACATGG + Intergenic
1005256292 6:24007002-24007024 AGCAAAAATGTCTCCAGACGTGG - Intergenic
1006705139 6:36013474-36013496 ATCAAAAATGTCTCCGGGCCAGG - Intronic
1006751203 6:36378794-36378816 ACTAAAAATGTCTCCAGACACGG + Intronic
1007688938 6:43685497-43685519 ACCAAAAATGTCTGCAGACATGG + Intronic
1008383948 6:50865829-50865851 ATCAATCATGCCTACAGATAAGG - Intergenic
1009037698 6:58137809-58137831 AACAAAAATGTCCCCAGATATGG + Intergenic
1009213487 6:60891436-60891458 AACAAAAATGTCCCCAGACATGG + Intergenic
1009438061 6:63640932-63640954 GCCAAAAATGTCTCTAGACATGG + Intronic
1009799135 6:68510876-68510898 TTAAAAAATGTCTACTGATAAGG - Intergenic
1011871669 6:91901984-91902006 TTCAAAAATCTCTAAAGATAGGG + Intergenic
1011957731 6:93044171-93044193 TTCAAACATGTTTACAGATAAGG + Intergenic
1011957840 6:93045359-93045381 TTCAAACATGTTTACAGATAAGG + Intergenic
1012358064 6:98340840-98340862 ACCAAAAATGTCTCCTGACATGG - Intergenic
1013750901 6:113404990-113405012 ACTAAAAGTGTCTCCAGACATGG + Intergenic
1014049572 6:116936303-116936325 ATCAAAATTTTCTACAGAAGAGG - Intergenic
1014990621 6:128070902-128070924 AGCAAAAATATCAACAGAAAAGG - Intronic
1015731042 6:136348581-136348603 GTCCAAAATGTGTACAGGCAGGG + Intronic
1016421364 6:143886818-143886840 ACCCAAAATGTCTACACACCTGG - Exonic
1016720448 6:147290051-147290073 TTTAAAAATGTATCCAGACATGG + Intronic
1016726031 6:147368444-147368466 TTTAAAAATCTCTACAAACAAGG + Intronic
1017064183 6:150513579-150513601 ATCAAAAGTATTTACATACATGG - Intergenic
1017556851 6:155581209-155581231 AACAAATATGTTTAAAGACATGG + Intergenic
1017869717 6:158476693-158476715 ACCAAACATGTCTATAGAAAAGG - Intronic
1019935113 7:4249680-4249702 AGCAAAGAGCTCTACAGACAAGG - Intronic
1019971371 7:4543580-4543602 AGTAAAACTGTCTAAAGACATGG + Intergenic
1020021514 7:4872232-4872254 ACCAAAGATGTCTGCAGACATGG - Intronic
1020120373 7:5499884-5499906 TTTAAAATTGTGTACAGACAAGG - Intronic
1020324633 7:6964887-6964909 ACCAAAATTGTCTCCAGACATGG - Intergenic
1021453077 7:20799348-20799370 ATCAAAAATTTATAAAGAGAAGG - Intergenic
1021523662 7:21562302-21562324 ATCATAAATGTCTCCAGACATGG + Intronic
1021793041 7:24225514-24225536 AACAAAAATATCTCCACACATGG + Intergenic
1021854176 7:24837497-24837519 TTCAAAAATGACTACAGGCAAGG - Intronic
1022282773 7:28927606-28927628 AACACAAATCTCTCCAGACAAGG - Intergenic
1022341920 7:29476708-29476730 ATAAAAAATGTCTCCAGACATGG - Intronic
1022382997 7:29878026-29878048 ATTATAAATGTCAACACACAAGG + Intronic
1022438400 7:30411877-30411899 ATCTAAAATGTCTCCTTACAGGG + Intronic
1022441133 7:30434360-30434382 ATCAAAAATGCCTCCGGACATGG - Intronic
1023119117 7:36891695-36891717 ATCAAAAATGTCTACATCATTGG - Intronic
1023583721 7:41707343-41707365 AACCAAAATGTCTTCAAACATGG - Intergenic
1024432849 7:49310336-49310358 ATGAACAATGTCTACAGAAAAGG - Intergenic
1024795386 7:53013290-53013312 AGCAAAAATGTCTCCACATAAGG + Intergenic
1026555359 7:71403953-71403975 ATCAAATTTGTCTACAGGCTGGG - Intronic
1026579216 7:71599983-71600005 AACCAAAATATCTTCAGACATGG + Intronic
1027809757 7:82880592-82880614 ACCAAAAATGTTTCTAGACATGG - Intronic
1028168181 7:87563610-87563632 ATCAAAACTCTCAACAAACAAGG + Intronic
1029119711 7:98259184-98259206 AAAAAAAATGTATAAAGACAAGG + Intronic
1029835049 7:103300581-103300603 GTCAAAACAGTCTACAAACATGG - Intronic
1029935967 7:104424578-104424600 ACCAAAAATGTCTCCAGACCTGG - Intronic
1030490025 7:110220699-110220721 ACCAAAAATATCTTCAGACATGG - Intergenic
1031289393 7:119913971-119913993 ATCTAAACTGTATAGAGACATGG - Intergenic
1031853727 7:126897460-126897482 GTGAAAAATGTGTAAAGACAGGG + Intronic
1032022695 7:128418539-128418561 ACCAAAAATGTCTTCAGACACGG - Intergenic
1032864345 7:135911036-135911058 AACAAAAATGCTTACAGAAAAGG + Intergenic
1034102068 7:148458533-148458555 ATCACAAATGACCACAAACATGG - Intergenic
1034199908 7:149277881-149277903 ATTAAACATGTATATAGACACGG + Intronic
1034935234 7:155194969-155194991 ATCCAAACTGTCCCCAGACATGG - Intergenic
1035691780 8:1563948-1563970 ATTTAAAAGGTCTTCAGACAGGG - Intronic
1035890836 8:3340993-3341015 ATCAAAAATGTCTGTAGAATTGG + Intronic
1036297703 8:7550072-7550094 ATCAAACATATCCAAAGACAAGG + Intergenic
1036299007 8:7557720-7557742 ATCAAACATATCCAAAGACAAGG + Intergenic
1036300312 8:7565370-7565392 ATCAAACATATCCAAAGACAAGG + Intergenic
1036324869 8:7770946-7770968 ATCAAACATATCCAAAGACAAGG - Intergenic
1036371433 8:8166054-8166076 ACCAAAATTGTCTCCAGACATGG + Intergenic
1036879470 8:12499590-12499612 ACCAAAATTGTCTCCAGACATGG - Intergenic
1037677214 8:21061527-21061549 CTCAAAAATATTTACAGGCATGG + Intergenic
1037766190 8:21773838-21773860 AACAAAGATGTCCCCAGACAGGG - Intronic
1037881560 8:22575785-22575807 ATCAAAACAGTCTGCAAACAAGG - Exonic
1038558214 8:28543725-28543747 AAAAAAAATGTATACAGTCATGG + Intronic
1039208583 8:35185176-35185198 AACTAAAATGTCTTCAGTCAAGG + Intergenic
1041030633 8:53732498-53732520 AACAGAAATAACTACAGACAGGG + Intronic
1041267990 8:56083614-56083636 ATAACAAATGTCTACAGAGGAGG + Intergenic
1041414118 8:57588549-57588571 AGGAAAAATGTTTACAGAAATGG + Intergenic
1042500680 8:69505244-69505266 ATCAAAAATGTTTACACCTATGG + Intronic
1042719163 8:71808240-71808262 GTCAAATGTGTCCACAGACACGG - Intergenic
1043346064 8:79299187-79299209 ATCATAAAAGTCTACAGTGATGG - Intergenic
1044194486 8:89358112-89358134 ATCAGAAATGTCTAAAGAAGAGG - Intergenic
1044530663 8:93303205-93303227 ACCAATAATGTCTACTGTCATGG + Intergenic
1045455648 8:102376324-102376346 ATCAGAAATCTCTAAATACAAGG + Intronic
1045690390 8:104754165-104754187 ACCAAAAATGTCTCCAGGCTGGG - Intronic
1046001261 8:108423352-108423374 AGCAAAAATTTGTAAAGACAGGG + Intronic
1046017586 8:108623798-108623820 ATCAAAAATGTCTCCAGACATGG - Intronic
1046581198 8:116094568-116094590 AACAAAGATGTCTAGTGACATGG + Intergenic
1046617051 8:116489258-116489280 ATCAAAAATGCCTCCAGACGTGG + Intergenic
1047045007 8:121042738-121042760 ATCATAAATGTCAACAAATATGG + Intergenic
1047063646 8:121255599-121255621 ATAAAAAATTTCCACAGACTTGG - Intergenic
1047108180 8:121758378-121758400 ATGCAAAATGGCTAAAGACAGGG - Intergenic
1047693751 8:127383120-127383142 CCCAAAAATGTCTCCAGACATGG + Intergenic
1049533087 8:143166151-143166173 ATCAAAGACGTCTGCAGAAATGG + Intergenic
1050026268 9:1337429-1337451 GCCAAAAATATCTCCAGACACGG - Intergenic
1050668613 9:7969882-7969904 ACCAAAAATGTCTCTGGACATGG - Intergenic
1050839233 9:10125891-10125913 ATGTAAAATGTCTAAAGATATGG + Intronic
1052155261 9:25179560-25179582 AACAAAAATGTCTACTAAAAAGG + Intergenic
1055459693 9:76507419-76507441 ATAAAAAATTTCTGCAGACAAGG - Intergenic
1055645140 9:78356102-78356124 ACCAAAAATGTCTCTAGACATGG - Intergenic
1055917658 9:81422646-81422668 ATGAAAAATTACTACATACAGGG + Intergenic
1056417018 9:86386593-86386615 ATCAAATATGTCTCCAGATCTGG + Intergenic
1057967389 9:99517519-99517541 ATCAAAAATGGTTACAGGCCGGG - Intergenic
1059078137 9:111217049-111217071 ATCAGAAACGTCTAAAGAAAAGG + Intergenic
1059604779 9:115822743-115822765 ATCAATAGTGTCTCCAGATAAGG - Intergenic
1059820267 9:117964934-117964956 AACAAATATGTGAACAGACAGGG - Intergenic
1060056281 9:120416448-120416470 CTTAAAAATTTGTACAGACAAGG + Intronic
1060062578 9:120474362-120474384 ACCAAAAATGTCTCCAGACATGG - Intronic
1060120433 9:120984143-120984165 AACCTAAATGTCTACAGAAAGGG - Intronic
1060820124 9:126656859-126656881 ATCAAAAATGTCTCCAGACATGG + Intronic
1061038495 9:128126550-128126572 ATCAAAAAAGTCTTAAAACACGG + Intronic
1061701333 9:132418218-132418240 ACCAAAAATGTCTCCAGACGTGG - Intronic
1061712000 9:132494369-132494391 ACCAAAAATATGTCCAGACATGG + Intronic
1185798899 X:2991692-2991714 AACAAAAATGTCTCCAGACATGG - Intergenic
1185822862 X:3221395-3221417 ATAAAAAATGTAGCCAGACATGG - Intergenic
1185846609 X:3443298-3443320 CTCCCAAATGTCCACAGACAGGG + Intergenic
1186157279 X:6738628-6738650 ACCCAAAATGTCTCCAGACATGG - Intergenic
1186157369 X:6739467-6739489 ACCAAAAATGTCCTCAGACATGG - Intergenic
1186239599 X:7552331-7552353 ACCAAGAATGTCTCCAGATATGG - Intergenic
1186515521 X:10163906-10163928 ACAAAAAATGTCTCTAGACATGG + Intronic
1186716192 X:12254492-12254514 ATCAAGAATCTCTAGAGACTAGG - Intronic
1187339979 X:18412323-18412345 ATCCAAAATGCCTCCAGACAAGG - Intergenic
1187408347 X:19024585-19024607 ACCAAAAATGTCTCCAGACATGG - Intronic
1187409563 X:19038427-19038449 AACAATAATGTGGACAGACAGGG - Intronic
1188215449 X:27471021-27471043 ACCAAAAATATCTTCAGTCAGGG + Intergenic
1188544500 X:31288942-31288964 AGCAAAAATGTTGACAGAGAGGG - Intronic
1189096939 X:38150433-38150455 ACCAAAAATATCTCCAGACATGG - Intronic
1189796222 X:44648216-44648238 AATAAAACTGTCTACAGAAAGGG - Intergenic
1193439841 X:81526271-81526293 ATTAAAAATTTCAACAGACTAGG - Intergenic
1194525706 X:94974894-94974916 ATCAAAAAAGCCTAGAAACATGG - Intergenic
1194613397 X:96071921-96071943 ATCAAAATTATCTCCAGAAAGGG - Intergenic
1195641653 X:107182319-107182341 ACCAAAAATGTCTCCAGATTTGG + Intronic
1195765972 X:108297511-108297533 ACCAAAAATGTTCCCAGACATGG + Intronic
1195999056 X:110761583-110761605 ACCAAAAATGTCTCCAGACATGG - Intronic
1196048451 X:111280552-111280574 ACCAAAGATTTCTACATACATGG + Intergenic
1197053595 X:122091281-122091303 CTCAAAGAGGTCTACAGAAAAGG - Intergenic
1198715112 X:139550201-139550223 ATCAACAATGGCTACAGAAAAGG - Intronic
1199162091 X:144624829-144624851 ATCAGAAATGTCTCCAGACAGGG - Intergenic
1200978272 Y:9236851-9236873 CTCAAAAATGTATACAGAAATGG + Intergenic
1201245150 Y:11996213-11996235 ACCAAAAATGTCTCTAGATATGG + Intergenic
1201550902 Y:15215423-15215445 ACCCAAAATGTCTCCAGACATGG - Intergenic
1201550991 Y:15216260-15216282 ATGAAAAATGTCCCCAGACATGG - Intergenic
1201754591 Y:17472415-17472437 AGAAGAAATGTCTACAGAAACGG - Intergenic
1201846961 Y:18433570-18433592 AGAAGAAATGTCTACAGAAACGG + Intergenic