ID: 960607253

View in Genome Browser
Species Human (GRCh38)
Location 3:119519411-119519433
Sequence GAAAAGGATGTTCATGCAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 672
Summary {0: 1, 1: 0, 2: 4, 3: 53, 4: 614}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960607249_960607253 14 Left 960607249 3:119519374-119519396 CCTGTAAAGATACAGATAGGCTG 0: 1
1: 0
2: 29
3: 198
4: 685
Right 960607253 3:119519411-119519433 GAAAAGGATGTTCATGCAAATGG 0: 1
1: 0
2: 4
3: 53
4: 614

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960607253 Original CRISPR GAAAAGGATGTTCATGCAAA TGG Intronic
900499286 1:2992501-2992523 GAACAGGCTGTTTATGGAAAAGG - Intergenic
900500890 1:3003969-3003991 GAAAAGGATCTGCTTGCAGATGG + Intergenic
902256447 1:15192121-15192143 GAAAATGCTGTTCATCAAAACGG - Intronic
903089607 1:20900129-20900151 GAAAAGGAAGACCATTCAAATGG + Intronic
903382832 1:22908841-22908863 GAAAAGGCACTTCATGCAGAGGG + Intronic
903616190 1:24659220-24659242 GAAAAGTCTGTTCATTGAAAAGG + Intronic
904861057 1:33537911-33537933 GAAAAGAATGTGCGTGAAAATGG - Intronic
904934218 1:34116297-34116319 AAAAAGATTTTTCATGCAAATGG + Intronic
905006271 1:34712663-34712685 GGAAAGGGTGTACCTGCAAAAGG - Intergenic
905423738 1:37866531-37866553 GAAACAGATCTTCCTGCAAAAGG + Exonic
905718978 1:40179475-40179497 GAAGTGGATGATCATGCAAAAGG - Intronic
906448298 1:45922378-45922400 GACCAGGCTGTTCATGCTAAGGG + Intronic
906563806 1:46781772-46781794 AAAAAGGCATTTCATGCAAATGG - Intronic
907364931 1:53950230-53950252 GAGAAGGATGTTCCAGCCAAAGG + Intronic
907787342 1:57625619-57625641 GAAAAAGGTGTCCAGGCAAAGGG + Intronic
908174903 1:61545830-61545852 AAAAAGGCATTTCATGCAAATGG - Intergenic
908483154 1:64564095-64564117 GAAAAGGCTCTGCATGCAAGTGG - Intronic
908859117 1:68463573-68463595 GGAAAGGAGGTCCAAGCAAAGGG - Intergenic
909188178 1:72516019-72516041 GAAATGGATTTTCATGAAACTGG + Intergenic
909411853 1:75363137-75363159 GAAAAAGATATCCATGCAAATGG - Intronic
909463509 1:75945933-75945955 GAAAAGATTTTCCATGCAAATGG + Intergenic
909673840 1:78216857-78216879 AAAAAGGCATTTCATGCAAATGG + Intergenic
909837027 1:80268692-80268714 GAAAAGAATATTCATGCAATAGG - Intergenic
909981185 1:82103398-82103420 GAAAAGGTATTTCATGCAAATGG - Intergenic
910077809 1:83300857-83300879 AAAAAGGCATTTCATGCAAATGG + Intergenic
910258504 1:85273911-85273933 TAAAAGGCTCTTCATGAAAATGG + Intronic
910323677 1:85978523-85978545 AAAAAGGTATTTCATGCAAATGG + Intronic
910738784 1:90492826-90492848 AAAAAGGCATTTCATGCAAATGG - Intergenic
910752291 1:90645450-90645472 GAAATAGATGATGATGCAAATGG + Intergenic
911080916 1:93929528-93929550 AAAAAGGCATTTCATGCAAATGG + Intergenic
911261041 1:95685753-95685775 TGAAAAGATGTTCTTGCAAATGG - Intergenic
911678706 1:100689881-100689903 AAAAAGGCATTTCATGCAAATGG - Intergenic
911948615 1:104142763-104142785 AAAGAGGCTGTTCATGTAAATGG - Intergenic
913100826 1:115563301-115563323 GAAAAAGATTTTCACACAAATGG + Intergenic
913151560 1:116048903-116048925 AAAAAGGCATTTCATGCAAATGG + Intronic
914346265 1:146801303-146801325 GAAAAAGGCTTTCATGCAAATGG + Intergenic
914927419 1:151900479-151900501 AAAAAGGCATTTCATGCAAATGG + Intronic
914968169 1:152279849-152279871 AAAAAGGCATTTCATGCAAATGG + Intergenic
916697541 1:167254532-167254554 GCATAAAATGTTCATGCAAAAGG + Intronic
917898267 1:179514902-179514924 GAAAAAGCATTTCATGCAAATGG - Intronic
917907791 1:179605212-179605234 GAAAAGGCATTTCATGCAAATGG - Intronic
918158558 1:181874579-181874601 AAAAAGGCATTTCATGCAAATGG + Intergenic
918750599 1:188264849-188264871 AAAAAGGCATTTCATGCAAATGG - Intergenic
918951617 1:191147131-191147153 GAAAAGTGTTTTTATGCAAAGGG - Intergenic
919115312 1:193274300-193274322 GAAAAGGCATTTCACGCAAATGG - Intergenic
919227770 1:194729873-194729895 GAATAGGATGGTCAAGCAAAGGG - Intergenic
919287317 1:195580418-195580440 GGAAAGGATCAACATGCAAAAGG + Intergenic
919598636 1:199595232-199595254 AAAAAGGTATTTCATGCAAATGG + Intergenic
920726765 1:208443568-208443590 AAAAAGGCATTTCATGCAAATGG - Intergenic
922591504 1:226780615-226780637 GAGAAGGATGTTGAGGCAAAAGG + Intergenic
922927161 1:229359252-229359274 AAAAAGGCATTTCATGCAAATGG - Intergenic
922995748 1:229958489-229958511 AAAAAGGCATTTCATGCAAATGG - Intergenic
923297519 1:232609393-232609415 GAGAAGTATGTTGATGGAAATGG - Intergenic
923648443 1:235847697-235847719 GAAAAGGCATTTCATGCAAATGG + Intronic
923874905 1:238036586-238036608 GAAAAGGCATTTCATGCAAGTGG + Intergenic
923996480 1:239500928-239500950 CAAAAGGCATTTCATGCAAATGG + Intronic
924321210 1:242852986-242853008 AAAAAGGCATTTCATGCAAATGG - Intergenic
924443612 1:244107416-244107438 TAAAAGGGTATTGATGCAAAGGG - Intergenic
1062761007 10:19091-19113 AAAAAGGCATTTCATGCAAATGG + Intergenic
1063170903 10:3509081-3509103 GAGAAGCATGTTAATGAAAACGG + Intergenic
1064535640 10:16354856-16354878 GTATACGATTTTCATGCAAAAGG - Intergenic
1065470752 10:26079336-26079358 AAAAAGGCATTTCATGCAAATGG - Intronic
1066037338 10:31506600-31506622 GAAAAAGATGTCCATGCAAATGG - Intronic
1066145330 10:32552237-32552259 AAAAAGGCATTTCATGCAAATGG - Intronic
1066747286 10:38613586-38613608 AAAAAGGCATTTCATGCAAATGG + Intergenic
1068480977 10:57587613-57587635 GAAAAGGCATTTCATGCAAATGG + Intergenic
1069063883 10:63922512-63922534 GACAGGGATGTTGATGCAATGGG + Intergenic
1069242503 10:66161019-66161041 GAAAAGGCATTTCATGCAAATGG - Intronic
1069325487 10:67227038-67227060 AAAAAGGTATTTCATGCAAATGG + Intronic
1070363447 10:75713000-75713022 GAAAATGATGTTTCTGGAAAGGG + Intronic
1070433857 10:76368939-76368961 AAAAAGGCATTTCATGCAAACGG - Intronic
1071484875 10:86092536-86092558 AAAAAGGCATTTCATGCAAATGG + Intronic
1071879646 10:89882474-89882496 GAAAAGATAGTCCATGCAAATGG - Intergenic
1072164057 10:92794945-92794967 AAAAAGGCATTTCATGCAAATGG + Intergenic
1072357674 10:94627618-94627640 GAAAAGGAAGTCCATTCAGATGG - Intergenic
1072815104 10:98499822-98499844 AAAAAGGCATTTCATGCAAATGG + Intronic
1073577416 10:104638500-104638522 GGCAAGGATTTTCAGGCAAAGGG + Intergenic
1073714017 10:106081284-106081306 AAAATGCATGTTCAAGCAAAAGG + Intergenic
1073839883 10:107486230-107486252 GAAAAGGATTTCCTTGCACATGG + Intergenic
1074087631 10:110220555-110220577 GAAAAGGGTGGTGATGCCAAGGG + Intronic
1074985619 10:118656890-118656912 AAAAAGGCAATTCATGCAAATGG - Intergenic
1075947005 10:126442207-126442229 AAAAAGGCATTTCATGCAAATGG + Intronic
1077681143 11:4241645-4241667 GAAAAGGAAGTTTATTTAAAAGG + Intergenic
1077684620 11:4279681-4279703 GAAAAGGAAGTTTATTTAAAAGG - Intergenic
1077685422 11:4287088-4287110 GAAAAGGAAGTTTATTTAAAAGG + Intergenic
1077689753 11:4330838-4330860 GAAAAGGAAGTTTATTTAAAAGG - Intergenic
1077690574 11:4338249-4338271 GAAAAGGAAGTTTATTTAAAAGG + Intergenic
1079207855 11:18432801-18432823 AAAAAGGCATTTCATGCAAATGG - Intronic
1079216240 11:18514715-18514737 GGAAAGCATGTTGATGCAAATGG - Exonic
1079273460 11:19011392-19011414 AAAAAGGCATTTCATGCAAATGG - Intergenic
1079585797 11:22125974-22125996 TAAAAGGTATTTCATGCAAATGG + Intergenic
1080203149 11:29697612-29697634 AAAAAGGTAGTCCATGCAAATGG - Intergenic
1080402499 11:31949173-31949195 AAAAAGGCATTTCATGCAAATGG + Intronic
1080672342 11:34392892-34392914 AAAAAGGCATTTCATGCAAATGG - Intergenic
1080926632 11:36764084-36764106 GAGAAGGATGTTTAAGGAAAAGG - Intergenic
1081111842 11:39145436-39145458 GAAAAGGTACTTGATGCAAATGG + Intergenic
1081645590 11:44788038-44788060 GAAAAGGTTGAGCATGGAAATGG + Intronic
1082140312 11:48601521-48601543 AAAAAGGCATTTCATGCAAATGG - Intergenic
1082689391 11:56281326-56281348 AAAAAGGATGTTCCAGCATAAGG + Intergenic
1082707863 11:56515166-56515188 TAAAAGGCTGTTCATGTAATAGG + Intergenic
1082917057 11:58448448-58448470 AAAAAGGCATTTCATGCAAATGG + Intergenic
1083064378 11:59909177-59909199 AAAAAGGCATTTCATGCAAATGG - Intergenic
1085748067 11:79131839-79131861 GAAAAGGCATTTCATACAAATGG + Intronic
1086262239 11:84953967-84953989 GAAAATGGTGTTCATGGAAGAGG - Intronic
1087090437 11:94265692-94265714 GAAAAGATATTTCATGCAAATGG + Intergenic
1087681438 11:101222637-101222659 GCAAAAGATATCCATGCAAATGG - Intergenic
1088137509 11:106576130-106576152 AAAAAGGCATTTCATGCAAATGG - Intergenic
1089107586 11:116025945-116025967 AAAAAGGCATTTCATGCAAACGG + Intergenic
1089826053 11:121278925-121278947 AAAAAGGCATTTCATGCAAATGG - Intergenic
1089827224 11:121289395-121289417 GAAGAGAATCTTCATGAAAAAGG - Intergenic
1089900293 11:121975594-121975616 AAAAAGGCATTTCATGCAAATGG + Intergenic
1089909759 11:122085463-122085485 GAAAAGAATGTTCAGACAATTGG + Intergenic
1089977874 11:122748070-122748092 CAAAAGGAGGATCCTGCAAAAGG + Intronic
1090292962 11:125562192-125562214 AAACAGGATGTTCAGGCATAAGG + Intergenic
1090559291 11:127913352-127913374 AAAAAGGCATTTCATGCAAATGG - Intergenic
1090648854 11:128789103-128789125 GAAATAGATGTTGAAGCAAAGGG + Intronic
1091105968 11:132920306-132920328 CAAAAGGAGACTCATGCAAATGG + Intronic
1091210270 11:133852290-133852312 AAAAAGGCATTTCATGCAAATGG - Intergenic
1093409015 12:18843077-18843099 AAAAAGGTATTTCATGCAAATGG - Intergenic
1093443882 12:19231459-19231481 GAAATGTATATTCATCCAAAAGG + Intronic
1093646833 12:21595616-21595638 AAAAAGGTATTTCATGCAAATGG + Intronic
1093720776 12:22439261-22439283 AAAAAGGCATTTCATGCAAATGG + Intergenic
1093890978 12:24520794-24520816 GAAAAGGAATTTCGTGCAAATGG + Intergenic
1094365399 12:29674613-29674635 GTAAAGGTTGTCCATGCACAAGG + Intronic
1094447160 12:30544340-30544362 AAAAAGGCATTTCATGCAAACGG - Intergenic
1094808746 12:34116810-34116832 AAAAAGGCATTTCATGCAAATGG + Intergenic
1095665374 12:44790816-44790838 AAAAAGGCATTTCATGCAAATGG + Intronic
1095732947 12:45524758-45524780 AAAAAGGCATTTCATGCAAATGG + Intergenic
1095788768 12:46141347-46141369 GAAAAGATAGTCCATGCAAATGG - Intergenic
1095893015 12:47252241-47252263 AAAAAGGCATTTCATGCAAATGG + Intergenic
1096348088 12:50868298-50868320 AAAAAGGCATTTCATGCAAATGG + Intronic
1096826975 12:54286943-54286965 CACAAGGACGTTCCTGCAAAAGG - Intronic
1097376982 12:58854044-58854066 GAAATTGATGTTGTTGCAAAGGG - Intergenic
1097471334 12:59996466-59996488 CAAAAGCATGCTCATGCCAAGGG - Intergenic
1097760799 12:63461654-63461676 AAAAAGGCATTTCATGCAAATGG + Intergenic
1098473819 12:70876187-70876209 GAAAAGGAAGTCAATGGAAAAGG + Intronic
1098617071 12:72539594-72539616 GAGACTGATGTGCATGCAAATGG + Intronic
1098982478 12:76972390-76972412 AAAAAGGCATTTCATGCAAATGG - Intergenic
1099279598 12:80627010-80627032 GAAAATGATGTTCATCCCAATGG + Intronic
1099519266 12:83640356-83640378 GGAAAGGTATTTCATGCAAATGG - Intergenic
1100087940 12:90934744-90934766 AAAAAGGCATTTCATGCAAATGG - Intronic
1100270028 12:93015916-93015938 GGTGAGGTTGTTCATGCAAAGGG + Intergenic
1100274175 12:93056461-93056483 GAAAAGGCTTTCCATGGAAAAGG - Intergenic
1100290797 12:93213086-93213108 AAAAAGGCATTTCATGCAAATGG - Intergenic
1100575390 12:95887275-95887297 GAAAATTATGTTCACACAAAAGG + Intronic
1101003543 12:100379826-100379848 GAAAAGGATATACAACCAAATGG + Intronic
1101145617 12:101838076-101838098 GAAAAGGTTATTTAGGCAAAGGG - Intergenic
1101298054 12:103446661-103446683 GAGAAAGATATCCATGCAAATGG + Intronic
1101303172 12:103502522-103502544 GGAAAGAGTGTTCCTGCAAAGGG - Intergenic
1101635068 12:106533617-106533639 GAAAAGTCATTTCATGCAAATGG - Intronic
1101905246 12:108819900-108819922 GAAAAAGATGCTTTTGCAAAAGG - Intronic
1102061370 12:109934423-109934445 AGAAAGGATTTCCATGCAAAAGG + Intronic
1102916523 12:116758163-116758185 AAAAAGGCATTTCATGCAAATGG - Intronic
1106743973 13:32679963-32679985 GAAAAGGATGCTAAAGAAAAAGG - Intronic
1106824590 13:33506516-33506538 GAAAATGGTGTTGATCCAAATGG + Intergenic
1106937955 13:34745406-34745428 AAAAAGGCATTTCATGCAAATGG - Intergenic
1107042518 13:35964592-35964614 AAAAAGTATGTTCTAGCAAATGG - Intronic
1107178351 13:37425985-37426007 GAAAAGATAGTCCATGCAAATGG + Intergenic
1107428880 13:40320775-40320797 GATAAAGATGTTCATGGAAGAGG + Intergenic
1107755782 13:43621082-43621104 AAAAAGGCATTTCATGCAAATGG - Intronic
1108825763 13:54410118-54410140 AAAAAGGCATTTCATGCAAATGG + Intergenic
1108886908 13:55197817-55197839 GAAAATGATTATCATGCAAATGG - Intergenic
1109150061 13:58835982-58836004 GAAAAGACTGTACATGCCAAAGG + Intergenic
1109508180 13:63334730-63334752 AAAAAGGCATTTCATGCAAATGG - Intergenic
1109613613 13:64799956-64799978 GAAAAGTAGGTTAATGCAAAGGG + Intergenic
1109782122 13:67125527-67125549 GAACATGGTGTACATGCAAAAGG + Intronic
1109862620 13:68220287-68220309 GAAAAGTAAGTTCCAGCAAATGG + Intergenic
1110627771 13:77670383-77670405 AAAAAGGCATTTCATGCAAATGG + Intergenic
1111089511 13:83424865-83424887 GAAAAGAAAATTCATACAAAAGG + Intergenic
1112597742 13:100824200-100824222 GGAAAGGGTCATCATGCAAAGGG + Intergenic
1112738330 13:102445653-102445675 AAAAAGGCATTTCATGCAAATGG + Intergenic
1112852113 13:103718759-103718781 GAAATGGAAGTTCTTGCATAGGG + Intergenic
1113208614 13:107947528-107947550 GAAAAGATTTTCCATGCAAATGG + Intergenic
1113269747 13:108660613-108660635 AAAAAGGCATTTCATGCAAATGG - Intronic
1113306744 13:109087682-109087704 GAGAAGGCTGTTCTTGAAAATGG - Intronic
1113738884 13:112697251-112697273 GACAAGGATGTTGATGGAGAGGG - Intronic
1114030597 14:18576194-18576216 AAAAAGGCATTTCATGCAAATGG - Intergenic
1114568900 14:23652122-23652144 GCAAAGGATGCTCATGGTAATGG + Intergenic
1114620148 14:24091081-24091103 GAAATAGATGTTCATTCTAAGGG + Intronic
1114687806 14:24551053-24551075 GAAAAAGATATTCATGCCAATGG - Intergenic
1115299465 14:31867466-31867488 AAAAAGGCATTTCATGCAAATGG + Intergenic
1115338367 14:32265358-32265380 AAAAATGTAGTTCATGCAAATGG + Intergenic
1115381437 14:32744685-32744707 GAATAGAAAGTTCATTCAAAGGG - Intronic
1115680517 14:35732552-35732574 AAAAAGGCATTTCATGCAAATGG + Intronic
1116088799 14:40277534-40277556 AAAAAGGCGTTTCATGCAAATGG - Intergenic
1116223584 14:42118753-42118775 AAAAAGGCATTTCATGCAAATGG - Intergenic
1116318897 14:43434300-43434322 GAAAAAGATATTCATCCATAAGG - Intergenic
1116732194 14:48637983-48638005 AAAAAGGCATTTCATGCAAATGG + Intergenic
1117226557 14:53666732-53666754 GAAAAGGAATTTCATGCAGAAGG - Intergenic
1117381712 14:55170970-55170992 TAAAAGGATGTACATACAAAGGG - Intronic
1117571598 14:57054443-57054465 GAAAGGGAATTTCAGGCAAAAGG + Intergenic
1117640033 14:57788073-57788095 AAAAAGGCTTTTCATGCAAATGG + Intronic
1118413985 14:65512951-65512973 GAAAAGGATGGTCTTGGAATGGG - Intronic
1120044140 14:79787926-79787948 TCAAAGGATGGACATGCAAAAGG - Intronic
1120545567 14:85807482-85807504 AAAAAGGTATTTCATGCAAATGG - Intergenic
1120642422 14:87031287-87031309 GAAAAGAATTTTCTTGCAGAAGG + Intergenic
1120806287 14:88754546-88754568 TTAAAGGATGTTCATACACATGG - Exonic
1121107342 14:91289657-91289679 GAAAATGAGATTCATGGAAATGG - Intronic
1122679802 14:103450499-103450521 GAAAACTATGTTAATGCAATAGG - Intronic
1122820089 14:104338495-104338517 GAAAAAGATCTTCAGGCAGAGGG - Intergenic
1122868120 14:104618957-104618979 GAGACGAATGTACATGCAAATGG - Intergenic
1123631614 15:22264623-22264645 GAAAAGCATGTTAAACCAAAAGG - Intergenic
1124557335 15:30738281-30738303 AAAAAGGCATTTCATGCAAATGG + Intronic
1124673928 15:31667466-31667488 AAAAAGGCATTTCATGCAAATGG - Intronic
1125269202 15:37919783-37919805 GAAAAAGCATTTCATGCAAATGG - Intergenic
1126461265 15:48917553-48917575 TAATAGAATATTCATGCAAAAGG - Intronic
1126488405 15:49208993-49209015 AAAAAGGCATTTCATGCAAATGG - Intronic
1126948258 15:53850027-53850049 TTAAAGGAAGTTCTTGCAAAAGG - Intergenic
1127036545 15:54924658-54924680 GAAAAAGAAATTCATGCAAATGG - Intergenic
1128238945 15:66086974-66086996 GAAAAGGCATTTCATGCAACTGG + Intronic
1129355982 15:74992141-74992163 GATAAGGATGTTCATATAAATGG - Intronic
1129928882 15:79391921-79391943 AAAAAGGCATTTCATGCAAATGG - Intronic
1130300156 15:82674445-82674467 GAGTAGGCTGTTCAGGCAAATGG - Intronic
1131296453 15:91153686-91153708 ACAAAGGATGTCCATCCAAATGG + Intronic
1133591861 16:7252678-7252700 AAAAAGGATGTAAATGAAAAAGG - Intronic
1134628106 16:15737323-15737345 GGAAACGAAGTTCATGCCAAGGG + Intronic
1135901843 16:26467064-26467086 AAAAAGGCATTTCATGCAAATGG + Intergenic
1136735776 16:32466057-32466079 AAAAAGGCATTTCATGCAAATGG - Intergenic
1138059585 16:53876086-53876108 GAATAGGTAGTTAATGCAAATGG + Intronic
1138535912 16:57660292-57660314 CCAAAGGAATTTCATGCAAATGG - Intronic
1138806632 16:60097741-60097763 AAAAAGGTTATTCATGCTAATGG - Intergenic
1138910171 16:61387170-61387192 GGAAAGATTGTGCATGCAAAGGG - Intergenic
1139987715 16:70913965-70913987 GAAAAAGGCTTTCATGCAAATGG - Intronic
1141326762 16:83067729-83067751 GAAAAGCATTTTAATGAAAAAGG + Intronic
1141783264 16:86179361-86179383 CAAAAAGATGTATATGCAAATGG + Intergenic
1141971383 16:87485806-87485828 GAAAAGCATGTTAATTCAAAAGG + Intronic
1203017299 16_KI270728v1_random:363517-363539 AAAAAGGCATTTCATGCAAATGG + Intergenic
1203035634 16_KI270728v1_random:636675-636697 AAAAAGGCATTTCATGCAAATGG + Intergenic
1142938181 17:3356349-3356371 GAAAAGGATGTTAATGAGCAAGG - Intergenic
1143748857 17:9013787-9013809 GAAAAGGATGTTGCTCCAGATGG - Intergenic
1143991026 17:10961740-10961762 AAAAAGGCATTTCATGCAAATGG + Intergenic
1144139464 17:12334712-12334734 AAAAAGGCATTTCATGCAAATGG - Intergenic
1145194392 17:20876528-20876550 GAAAAGGATGAAAAGGCAAAGGG - Intronic
1145297645 17:21604527-21604549 GAAAAGGATGAAAAGGCAAAGGG + Intergenic
1145352608 17:22098875-22098897 GAAAAGGATGAAAAGGCAAAGGG - Intergenic
1145813584 17:27780188-27780210 GAAAAGGCATGTCATGCAAAGGG + Intronic
1146566556 17:33918131-33918153 GAGAAGGATTTTCCTGGAAAAGG - Intronic
1146583601 17:34061676-34061698 AAAAAGGCATTTCATGCAAATGG + Intronic
1148165035 17:45477602-45477624 AAAAAGGCTGTTCCTGCTAAAGG + Intronic
1148408047 17:47437598-47437620 AAAAAGGCATTTCATGCAAATGG - Intronic
1148786972 17:50150321-50150343 CAAAAGTATGTTCCTGCAGATGG - Exonic
1149332484 17:55600143-55600165 GAAAAGGTATTCCATGCAAATGG - Intergenic
1149564499 17:57631358-57631380 GAGATGGATGTTCATAGAAAGGG - Intronic
1150113858 17:62527121-62527143 GAAAAGAATGTTCCTGGAAGAGG - Intronic
1150396265 17:64824327-64824349 AAAAAGGCTGTTCCTGCTAAAGG + Intergenic
1151303922 17:73250785-73250807 GACAAGACTGTTCCTGCAAAAGG - Intronic
1151720238 17:75851033-75851055 CAAATGGATGTTCTTGGAAAAGG - Intronic
1152953914 18:19445-19467 AAAAAGGCATTTCATGCAAATGG + Intergenic
1153587923 18:6642743-6642765 GAAAATGATGCTCATGCAATTGG + Intergenic
1155352802 18:24923571-24923593 GAGAAGTATGTTCAAGGAAAAGG - Intergenic
1155356420 18:24958064-24958086 GAAAAGGATGTACTTAGAAAAGG + Intergenic
1155555853 18:27018785-27018807 GAAAAGAATGTTCAGGCTGACGG + Intronic
1155621030 18:27780038-27780060 AAAATGGGTGTTCATGCTAAGGG - Intergenic
1155879947 18:31133181-31133203 GAAAAGTTTGTAAATGCAAATGG + Intronic
1155980904 18:32178330-32178352 TGTAAGGAAGTTCATGCAAAAGG - Intronic
1156011120 18:32499208-32499230 AAAAAGGCATTTCATGCAAATGG - Intergenic
1157351668 18:46893500-46893522 GCAAAGGATGTTAATGCAACTGG + Intronic
1157541050 18:48507290-48507312 AAAAAGGCATTTCATGCAAATGG + Intergenic
1158269560 18:55697963-55697985 GGCAAGGCTATTCATGCAAAGGG + Intergenic
1158337060 18:56423804-56423826 GAAAAGTATATGCATGGAAAAGG + Intergenic
1158468194 18:57710633-57710655 GAAAAGACAGTTCATACAAAGGG + Intronic
1158613760 18:58967456-58967478 GAAAGGTATGTCCAGGCAAAAGG - Intronic
1158830027 18:61266402-61266424 AAAAAGGCATTTCATGCAAATGG + Intergenic
1159400227 18:67922286-67922308 GAAATGGTTGTTTATGCCAATGG - Intergenic
1159623827 18:70669474-70669496 GATCAGGCTGTTCATGAAAAGGG - Intergenic
1160267416 18:77352085-77352107 AAAAAGGCATTTCATGCAAATGG - Intergenic
1162127710 19:8508235-8508257 GAACAGGATCTTCATCCAGAGGG + Intergenic
1163067561 19:14810209-14810231 GGGAAGGATGTTCATTCTAAGGG - Intronic
1164237882 19:23352759-23352781 AAAAAGGCATTTCATGCAAATGG + Intronic
1164299017 19:23942799-23942821 AAAAAGGCATTTCATGCAAATGG - Intronic
1164319932 19:24135273-24135295 AAAAAGGCGTTTCATGCAAATGG - Intergenic
1164549075 19:29193176-29193198 GTAAAGGCTGTTGATGCAGATGG - Intergenic
1165645863 19:37435657-37435679 GAAAAATATATTCATGCAAATGG + Intronic
1166604048 19:44124853-44124875 GAAAAGGCATTTTATGCAAATGG - Intronic
1167883725 19:52483503-52483525 CAATAGGATGTTCCTGCAGATGG - Intronic
1167887006 19:52508463-52508485 CAATAGGATGTTCCTGCAGATGG - Intronic
1167889986 19:52531572-52531594 CAATAGGATGTTCCTGCAGATGG - Intronic
1167914599 19:52730488-52730510 CAATAGGATGTTCCTGCAGATGG + Intronic
1167989778 19:53348545-53348567 CAATAGGATGTTCCTGCAGATGG - Intronic
1167993272 19:53378809-53378831 CAATAGGATGTTCCTGCAGATGG - Intronic
1168395879 19:56048060-56048082 AAAAAGGCATTTCATGCAAATGG - Intronic
1168458215 19:56531951-56531973 AAAAAGGCATTTCATGCAAATGG - Intergenic
925612737 2:5716208-5716230 GAAGAGGATTTTAATGCAAGAGG + Intergenic
925769007 2:7264452-7264474 GTAAAGGTTGTTTTTGCAAAGGG + Intergenic
926560382 2:14410327-14410349 GAAAAGGCAGTTCATGCAAATGG + Intergenic
928640686 2:33295709-33295731 TAAAAGTATGTTCTAGCAAAGGG + Intronic
928733911 2:34263305-34263327 AAAAAGGCGTTTCATGCAAATGG + Intergenic
929234327 2:39590456-39590478 CAAAGGGGTGTTCATCCAAAAGG - Intergenic
929722703 2:44387354-44387376 AAAAAGGCATTTCATGCAAATGG - Intronic
929813206 2:45209197-45209219 GAGAAGAATGTCTATGCAAAGGG - Intergenic
931524965 2:63143258-63143280 AAAAAGGCATTTCATGCAAATGG - Intronic
931548074 2:63410693-63410715 AAAAAGGCATTTCATGCAAATGG + Intronic
931654592 2:64499619-64499641 GAAAAGTAAGTGCATGCTAATGG - Intergenic
932954445 2:76335501-76335523 AAAAAGGCATTTCATGCAAATGG - Intergenic
933066470 2:77805037-77805059 GAAAAGGAAGTCCATTCAGATGG + Intergenic
933149705 2:78899525-78899547 GAAAAGAAAGTTCATGGAAAAGG + Intergenic
934310044 2:91854006-91854028 AAAAAGGCATTTCATGCAAATGG + Intergenic
936144632 2:109972035-109972057 GTAAAAGATGTTCATGAACACGG - Intergenic
936164652 2:110109353-110109375 AAAAAGGTACTTCATGCAAATGG + Intronic
936181316 2:110269998-110270020 GTAAAAGATGTTCATGAACACGG - Intergenic
936200055 2:110399434-110399456 GTAAAAGATGTTCATGAACACGG + Intergenic
936794730 2:116191316-116191338 GAAAAAGAATTTCATGCCAATGG - Intergenic
937019120 2:118634062-118634084 GAAAAGGATGATAAAGAAAAAGG - Intergenic
937175855 2:119933941-119933963 GAAATGGCTGTTTGTGCAAAAGG - Intronic
938037837 2:128051029-128051051 GAAAAGGCACTTCATGCAAATGG - Intergenic
938497613 2:131809573-131809595 AAAAAGGCATTTCATGCAAATGG + Intergenic
939117821 2:138080673-138080695 GAAAAGGCAGTTCGTACAAAAGG - Intergenic
939491679 2:142884311-142884333 GAAAACCATATTCATGGAAAAGG - Intronic
939587547 2:144023632-144023654 GAAAAGTAAGTTCATGAAAATGG + Intronic
940034503 2:149299885-149299907 AAAAGGGAATTTCATGCAAATGG - Intergenic
940157008 2:150667813-150667835 AAAAAGGCATTTCATGCAAACGG + Intergenic
940172164 2:150841190-150841212 AAAAAGGCATTTCATGCAAATGG - Intergenic
940335975 2:152527929-152527951 GATGAGGAAGTGCATGCAAAAGG + Intronic
940618482 2:156081951-156081973 AAAAAGGCATTTCATGCAAATGG - Intergenic
940881308 2:158949552-158949574 GAAAAGGCTGCTAATGTAAACGG + Intergenic
941060865 2:160845050-160845072 GAAAAGAGAATTCATGCAAATGG + Intergenic
941234049 2:162946876-162946898 GAAAAGGTATTCCATGCAAATGG + Intergenic
941627643 2:167846907-167846929 AAAAAGGCGTTTCATGCAAATGG + Intergenic
941631417 2:167889290-167889312 AAAAAGGCATTTCATGCAAATGG - Intergenic
941803338 2:169685882-169685904 GACAAGAATGTTAATGCAATGGG - Intronic
941823149 2:169862993-169863015 GAATGGGATGTTCTTGCCAAAGG + Intronic
942726284 2:179011273-179011295 AAAAAGGCATTTCATGCAAATGG + Intronic
942756691 2:179349565-179349587 GAAAAGGATATTTATGCATTTGG - Intergenic
943199204 2:184797467-184797489 AAAAAGGCATTTCATGCAAATGG - Intronic
943891090 2:193288380-193288402 AAAAAGACTCTTCATGCAAATGG - Intergenic
943933811 2:193888526-193888548 GAAAAAGACATTCATGCCAATGG + Intergenic
944108256 2:196102788-196102810 GGAAATTGTGTTCATGCAAAGGG - Intergenic
944735155 2:202556399-202556421 GAACAAGATGTTCTTGCACAGGG + Exonic
945405177 2:209438248-209438270 GATAAGGATGTGGATGTAAATGG + Intronic
945482342 2:210358672-210358694 AAAAAGGCATTTCATGCAAATGG - Intergenic
945772930 2:214067593-214067615 GAAAAGGATTTTTAGGCATATGG + Intronic
945825950 2:214719910-214719932 AAAAAGGCACTTCATGCAAATGG + Intergenic
945857530 2:215086387-215086409 GAGAAGCATTTCCATGCAAAGGG - Intronic
945861465 2:215127632-215127654 AAAAAGGCATTTCATGCAAATGG - Intronic
946036676 2:216748136-216748158 AAAAAGGCATTTCATGCAAATGG + Intergenic
947319254 2:228897964-228897986 GAAAAGGATGTTCCATCAAGAGG - Intronic
948529829 2:238597301-238597323 TGAAAGTATGTTCCTGCAAACGG - Intergenic
1169006233 20:2209443-2209465 GAATATGATGTTCTTGCCAATGG - Intergenic
1169401528 20:5284817-5284839 AAAAAGGCATTTCATGCAAACGG + Intergenic
1169904609 20:10589350-10589372 GAAAGGGCTTTTCATGCAACTGG + Intronic
1170720823 20:18877429-18877451 GAAAAGGCATTTCATGCAAATGG - Intergenic
1170851879 20:20012136-20012158 AAAAAGAATGTCCATGTAAATGG + Intergenic
1170862942 20:20126052-20126074 GAAAAGGCATTTCATGCAAATGG - Intronic
1171066758 20:22024809-22024831 AAAAAAGACATTCATGCAAATGG - Intergenic
1171562926 20:26144183-26144205 GAAAAGGATGCAAAGGCAAAGGG - Intergenic
1172326309 20:34038086-34038108 GGAAAGGAATTGCATGCAAAGGG + Intronic
1172635795 20:36408835-36408857 AAAAAGGACGTTAATGGAAATGG + Intronic
1174199592 20:48798068-48798090 CAAAAGTGAGTTCATGCAAAAGG - Intronic
1174787108 20:53443478-53443500 GAAAGAGATGTCCATGCAAAGGG + Intronic
1174949039 20:55023453-55023475 CAAATGGATATTCAGGCAAATGG - Intergenic
1174997882 20:55590925-55590947 GAATTGGATCTACATGCAAAGGG + Intergenic
1177006999 21:15685944-15685966 GAGAAGGAAGCTCCTGCAAATGG + Intergenic
1178059584 21:28836817-28836839 AAAAAGGCATTTCATGCAAATGG + Intergenic
1178623331 21:34195439-34195461 GAAAAGGATTTTCATGACAAAGG + Intergenic
1178801879 21:35803220-35803242 AAAAAGGCATTTCATGCAAATGG + Intronic
1180250894 21:46587309-46587331 GAAAAGACATTTCATGCAAATGG + Intergenic
1180454711 22:15503250-15503272 AAAAAGGCATTTCATGCAAATGG - Intergenic
1180536782 22:16399887-16399909 AAAAAGGCATTTCATGCAAATGG + Intergenic
1184402815 22:44283675-44283697 CAAATGTATGTGCATGCAAAAGG + Intronic
950603209 3:14054575-14054597 AAAAAGGCATTTCATGCAAACGG - Intronic
951572284 3:24077248-24077270 AAAAAGGCATTTCATGCAAATGG - Intergenic
951852111 3:27152814-27152836 AAAAAGGCATTTCATGCAAATGG + Intronic
952143631 3:30506957-30506979 GAAAAAAATGCTCATCCAAATGG + Intergenic
952402622 3:32976834-32976856 CAAAAGGATGATCAAGAAAATGG + Intergenic
952616966 3:35285317-35285339 GAAAAACATACTCATGCAAATGG + Intergenic
953224670 3:41007437-41007459 GAAAAGATGTTTCATGCAAATGG - Intergenic
953723692 3:45379383-45379405 GAAAAGGCATTTTATGCAAATGG - Intergenic
953866621 3:46588891-46588913 AAAAAGGCATTTCATGCAAATGG + Intronic
955461418 3:59187814-59187836 AAAAAGGCATTTCATGCAAATGG - Intergenic
955477340 3:59351629-59351651 GAAAAGGCATTTCATGCAAATGG - Intergenic
955582132 3:60435113-60435135 GAAAAGGCTGTGCATGCTAATGG - Intronic
956226187 3:66961834-66961856 GAAAAGGATTTTCACACAAGAGG - Intergenic
956950466 3:74275945-74275967 AAAAAGGCATTTCATGCAAATGG + Intronic
956995465 3:74822472-74822494 AAAAAGGCATTTCATGCAAATGG - Intergenic
957016194 3:75067636-75067658 AAAAAGGCATTTCATGCAAATGG - Intergenic
957331435 3:78769401-78769423 AAAAAGGCATTTCATGCAAATGG - Intronic
957998274 3:87718911-87718933 GAAAAATATATTCATGCAAGTGG + Intergenic
958262743 3:91402005-91402027 GAAAAGGCATTTCATGCAAATGG - Intergenic
958969727 3:100598824-100598846 GAAAGGGCATTTCATGCAAATGG - Intergenic
959280107 3:104326532-104326554 GAAAAGGCATTTCATGCAAATGG + Intergenic
959842256 3:110991117-110991139 GAAAAGAATGTTCCTGGCAAAGG + Intergenic
960499146 3:118414465-118414487 GAAAAGCGTATTCCTGCAAATGG + Intergenic
960607253 3:119519411-119519433 GAAAAGGATGTTCATGCAAATGG + Intronic
960880652 3:122341390-122341412 CAAAAGGAGATTCATTCAAATGG - Intronic
962065807 3:131979520-131979542 AAAAAGGCATTTCATGCAAATGG - Intronic
962365093 3:134773549-134773571 AAGAATGATGTTCATGGAAATGG - Intronic
963377047 3:144480711-144480733 TAAAATGATGACCATGCAAAAGG + Intergenic
964160843 3:153642927-153642949 AAAAAGGCATTTCATGCAAATGG + Intergenic
964491523 3:157241508-157241530 AAAAAAGATGCTCAGGCAAAGGG + Intergenic
964601044 3:158501689-158501711 GAAAAGGCATTTCATGCAAATGG - Intronic
964916142 3:161844571-161844593 GAAAAGGCATTTCATGCAAATGG - Intergenic
965052529 3:163669518-163669540 AAAAAGGCATTTCATGCAAAAGG - Intergenic
965357914 3:167699812-167699834 GAAAAGTATCTGCATGTAAATGG - Intronic
965468083 3:169057348-169057370 AAAATGGATGTCAATGCAAAAGG + Intergenic
966117486 3:176483337-176483359 AAAAAGGCATTTCATGCAAATGG - Intergenic
966206050 3:177407615-177407637 GAAAGGGATGCACATGAAAAAGG - Intergenic
966276551 3:178179334-178179356 GAAAAGTGTGTTAATGAAAATGG + Intergenic
966566965 3:181394120-181394142 GAAAAGATATTTCATGCAAATGG - Intergenic
966756491 3:183376275-183376297 GAAAAGGCTGCAAATGCAAAAGG + Intronic
966774298 3:183530557-183530579 AAAAAGAATGTTTAGGCAAAAGG + Intronic
967108944 3:186275730-186275752 GAAAAGGAAGAACATGCAAGAGG - Intronic
967257312 3:187607149-187607171 AAAAAGGCACTTCATGCAAATGG - Intergenic
967741379 3:193006576-193006598 AAAAAGGCATTTCATGCAAATGG - Intergenic
969947121 4:10795191-10795213 AAAAAGGCATTTCATGCAAATGG - Intergenic
970033901 4:11709894-11709916 GAGGAGGAAGTTCATTCAAATGG + Intergenic
970216424 4:13763585-13763607 GAGAAGGAAGTTCATGGAAAGGG - Intergenic
970217316 4:13773381-13773403 GAAAAGGCATTTCATGTAAATGG - Intergenic
970658427 4:18258367-18258389 AAAAAGGCATTTCATGCAAATGG - Intergenic
973179375 4:47249766-47249788 AAAAAGGCATTTCATGCAAATGG - Intronic
973302613 4:48604923-48604945 AAAAAGGATGATCAAACAAAGGG + Intronic
973616719 4:52686180-52686202 GACAAGGATGTTCCAACAAAAGG - Intergenic
973831308 4:54762657-54762679 AAAAAGGCATTTCATGCAAATGG - Intergenic
973832008 4:54771226-54771248 TAGAAGGATGTTCAGGCAGAAGG + Intergenic
974644224 4:64671713-64671735 GCCCAGGCTGTTCATGCAAAGGG + Intergenic
975517497 4:75262477-75262499 GAAAAGGCATTTCATACAAATGG + Intergenic
976252754 4:83069995-83070017 TAAAAGGATTTTCATTAAAATGG - Intronic
976327735 4:83792075-83792097 GAAAAGGATGGTGATACATAAGG + Intergenic
976856679 4:89612079-89612101 AAAAAGGTATTTCATGCAAATGG + Intergenic
976943291 4:90733206-90733228 TAAAATGATGTTTATCCAAAAGG - Intronic
976995139 4:91422277-91422299 GAAAGGGATGTAAAGGCAAAGGG - Intronic
977179879 4:93859965-93859987 GAAAAGATATTTCATGCAAATGG + Intergenic
977234596 4:94493258-94493280 GAAAATCATGTACATGAAAAGGG - Intronic
977560139 4:98524222-98524244 GAAAAGAAGTTTCTTGCAAAAGG - Intronic
977751331 4:100613411-100613433 GAAAAGATATTTCATGCAAATGG - Intronic
978232958 4:106423270-106423292 GAAAAACATTTTCATGGAAATGG - Intergenic
978726479 4:111975763-111975785 AAAAAGGCATTTCATGCAAATGG - Intergenic
978846450 4:113278571-113278593 GAAAAGGATTTACAGGCATAGGG + Intronic
978999233 4:115197575-115197597 AAAAAGGCATTTCATGCAAATGG - Intergenic
979381891 4:120016531-120016553 AAAAAGGCATTTCATGCAAATGG - Intergenic
979995608 4:127427120-127427142 GAAAAGGCATTTCATGCAAATGG + Intergenic
980153015 4:129071637-129071659 GAAAAATAATTTCATGCAAATGG - Intronic
980238053 4:130133841-130133863 GAAAAGACATTTCATGCAAATGG + Intergenic
980917727 4:139049879-139049901 GAAATGAATGTGCATGCATAAGG + Intronic
981285762 4:143017385-143017407 GAAAAGGTATTCCATGCAAATGG - Intergenic
981400788 4:144311817-144311839 AAAAAGGCATTTCATGCAAATGG - Intergenic
981626187 4:146758140-146758162 AAAAAGGCATTTCATGCAAATGG + Intronic
981755093 4:148134406-148134428 GAAAAGGAATTTCATACAAGTGG - Intronic
981825046 4:148930428-148930450 AAAAAGGCATTTCATGCAAATGG + Intergenic
982218573 4:153105255-153105277 AAAAAGGCATTTCATGCAAATGG - Intergenic
982679945 4:158417227-158417249 GAAAAGGCATTTCATGCAAATGG - Intronic
982696908 4:158612472-158612494 GAAAAGGTTTTTCATTGAAAAGG - Intronic
983175503 4:164583818-164583840 AAAAAGGCATTTCATGCAAATGG - Intergenic
984527353 4:180873604-180873626 AAAAAGGCATTTCATGCAAATGG - Intergenic
984721928 4:182980551-182980573 AAAAAGGCATTTCATGCAAATGG + Intergenic
985093107 4:186383738-186383760 GAAAAGGCATTTTATGCAAATGG + Intergenic
985329992 4:188821505-188821527 GAAAGGGATTTTCAGGCAGAGGG + Intergenic
986915922 5:12620881-12620903 GAAAACAAAGTTCATGCAAATGG - Intergenic
987240303 5:15990959-15990981 AAAAAGGTATTTCATGCAAATGG - Intergenic
987311281 5:16683536-16683558 GAAAATGATATTCCAGCAAAGGG - Intronic
987936184 5:24467773-24467795 GAAAAAGATAACCATGCAAATGG + Intergenic
988075289 5:26344621-26344643 GAAATACATGTTCATGTAAAAGG + Intergenic
988344807 5:30022969-30022991 AAAAAGGCATTTCATGCAAATGG + Intergenic
988882994 5:35524295-35524317 CAAAAGTATGTTCATGGTAATGG + Intergenic
988902435 5:35747486-35747508 AAAAAGGCATTTCATGCAAATGG + Intronic
989533606 5:42537996-42538018 AAAAAGGCATTTCATGCAAATGG - Intronic
989654747 5:43734343-43734365 GAGAAGGATATTCATGCAATAGG - Intergenic
990390946 5:55320165-55320187 GGAAAGGTTGTTCAAGCATATGG + Intronic
990775930 5:59306228-59306250 GAAAAGACTTTCCATGCAAATGG - Intronic
991269237 5:64759694-64759716 GCAAAGGATGTTCACAGAAACGG + Intronic
991660453 5:68945637-68945659 GAACAGAATATTCAGGCAAAAGG + Intergenic
993883685 5:93392926-93392948 GAAAAGGCATTTCATACAAATGG - Intergenic
993964946 5:94348618-94348640 AAAAAGGCATTTCATGCAAATGG + Intronic
993964981 5:94349096-94349118 AAAAAGGCATTTCATGCAAATGG + Intronic
995472800 5:112521460-112521482 AAAAAGGCATTTCATGCAAATGG - Intergenic
995818024 5:116193477-116193499 AAAAAGGCATTTCATGCAAATGG + Intronic
995955531 5:117771773-117771795 AAAAAGGCATTTCATGCAAATGG + Intergenic
996259544 5:121448805-121448827 GAAAAAGATATCCATGCCAAGGG + Intergenic
996288741 5:121827200-121827222 AAAAAGGCATTTCATGCAAATGG - Intergenic
996309526 5:122088797-122088819 GAAAAAGCAGTTCATGAAAAGGG - Intergenic
996361528 5:122653127-122653149 GAAAAGGAGGTGCAGGCAATGGG - Intergenic
996539520 5:124614770-124614792 GAAAATGATGTTCATTAAACTGG + Intergenic
996629291 5:125608045-125608067 GAAAAGAAGGTTGATGAAAAGGG - Intergenic
997159871 5:131596183-131596205 GAAAAAGACATCCATGCAAATGG + Intronic
997761131 5:136448385-136448407 AAAAAGGAATTTCATGCAAATGG + Intergenic
998276233 5:140756125-140756147 AAAAAGAATTTCCATGCAAATGG - Intergenic
998941082 5:147282593-147282615 GGAAAGGAATTTCATGCAAATGG + Intronic
999485935 5:151995992-151996014 GAAAAGATATTTCATGCAAATGG - Intergenic
999599838 5:153250629-153250651 GAAAAGGTATTCCATGCAAATGG - Intergenic
999846934 5:155492839-155492861 GAAAAGGAGCTTGATTCAAAAGG + Intergenic
999858913 5:155624248-155624270 GAAAAGGAAGCACCTGCAAAGGG + Intergenic
999936281 5:156489028-156489050 AAAAAGGGATTTCATGCAAATGG + Intronic
999961196 5:156757505-156757527 CAAAAGGAAGTTCATGCTCAAGG - Intronic
1000779951 5:165467482-165467504 AAAAAGGCATTTCATGCAAATGG + Intergenic
1001145249 5:169178117-169178139 GAAAAGGATGTTGATGATACTGG - Intronic
1002814069 6:661955-661977 AAAAAGGCATTTCATGCAAATGG + Intronic
1003451087 6:6232253-6232275 AAAAAGGTATTTCATGCAAATGG + Intronic
1003582220 6:7350060-7350082 AAAAAGGCATTTCATGCAAATGG + Intronic
1003711777 6:8600899-8600921 AAAAAGGCATTTCATGCAAATGG - Intergenic
1005194223 6:23264267-23264289 AAAAAGGATGTAGATTCAAAAGG + Intergenic
1005794320 6:29341757-29341779 GAATAGGATGATCATGAGAATGG + Intergenic
1009181292 6:60519993-60520015 AAAAAGGCATTTCATGCAAATGG + Intergenic
1009453377 6:63827075-63827097 AAAAAGGCATTTCATGCAAATGG + Intronic
1010008803 6:71027025-71027047 AAAAAGGCATTTCATGCAAATGG - Intergenic
1010076161 6:71801508-71801530 GAAAAGGAATTTCATGCAAATGG - Intergenic
1010164894 6:72904193-72904215 AAAAAGGCATTTCATGCAAATGG - Intronic
1010637550 6:78280207-78280229 GAAAAGGTATTCCATGCAAATGG - Intergenic
1011132928 6:84070902-84070924 AAAAAGGCATTTCATGCAAATGG - Intronic
1011183764 6:84651477-84651499 GAGAAAGAAGTTCATGAAAATGG - Intergenic
1011327354 6:86163766-86163788 GGAAAGGCATTTCATGCAAATGG + Intergenic
1011710246 6:90045736-90045758 TAAAAGGATGGTGATGCAAGAGG + Intronic
1011863408 6:91789290-91789312 GAAGAGTATGTTCTTGCATAAGG - Intergenic
1012394230 6:98777535-98777557 GAAAAGGATGTATGTGGAAAAGG - Intergenic
1012684792 6:102232529-102232551 AAAAAGGCATTTCATGCAAATGG - Intergenic
1012738027 6:102975639-102975661 AAAAAGGCATTTCATGCAAATGG + Intergenic
1013455331 6:110324642-110324664 GAAAAGGCTGTTCTTTCAGAAGG - Intronic
1013903680 6:115188615-115188637 GAAAAGGAAGTCTAGGCAAAAGG + Intergenic
1013940857 6:115660095-115660117 AAAAAGGCATTTCATGCAAATGG - Intergenic
1014531184 6:122561753-122561775 AAAAAGGCATTTCATGCAAATGG - Intronic
1014593734 6:123306391-123306413 GATAAGGATGTTGATCAAAAGGG + Intronic
1014664343 6:124218491-124218513 GAAATGAATGTTCATGAAATAGG - Intronic
1014982026 6:127956039-127956061 GAAAAAGATGTTCTTGCAGCTGG + Intergenic
1015455971 6:133426753-133426775 GACAAGGGTATTCAGGCAAAAGG - Intronic
1015565785 6:134569223-134569245 AAAAAGGCATTTCATGCAAATGG + Intergenic
1015886005 6:137919415-137919437 AAAAATGATCTTCCTGCAAAGGG - Intergenic
1016080381 6:139847984-139848006 GAAAAGGATTTTCATTCAAAGGG + Intergenic
1016314108 6:142767893-142767915 GAAAAGGATATTGATGGAACTGG + Intronic
1017535105 6:155339160-155339182 AAAAAGGCATTTCATGCAAATGG - Intergenic
1017730022 6:157306973-157306995 GAAAATGATGTTCTCTCAAATGG - Intronic
1017828282 6:158100004-158100026 GAAAAGGAAGTTTCTGCAACCGG - Intergenic
1018009604 6:159657595-159657617 AAAAAGGCATTTCATGCAAATGG + Intergenic
1018256692 6:161927217-161927239 TAAAAGCATGTACATGCAAGTGG - Intronic
1018331537 6:162733010-162733032 GAGAAGGGTGTTCGAGCAAAGGG - Intronic
1019108178 6:169686564-169686586 GAAAAATATATTCATGCAAATGG + Intronic
1020860993 7:13491405-13491427 AAAAAGGCATTTCATGCAAATGG + Intergenic
1020918838 7:14234975-14234997 CAAAAGAATTTTTATGCAAAAGG - Intronic
1021123978 7:16828976-16828998 GAAAAAGATATCTATGCAAATGG + Intronic
1021204491 7:17763700-17763722 AAAAAGGCATTTCATGCAAATGG + Intergenic
1021473892 7:21038533-21038555 AAAAAGGCATTTCATGCAAATGG - Intergenic
1021481054 7:21117519-21117541 GAAAAGGCATTTCACGCAAATGG - Intergenic
1022701474 7:32763805-32763827 GAAAAGGATGTAAAAGCCAAGGG - Intergenic
1022717192 7:32909322-32909344 GAAAAGGATGGTGGTGCACATGG + Intergenic
1022936968 7:35187566-35187588 GAAAAGGATGTAAAAGCCAAGGG - Intergenic
1023701471 7:42895407-42895429 GGAAAGGCATTTCATGCAAATGG + Intergenic
1023748762 7:43349695-43349717 AAAAAGGCATTTCATGCAAATGG - Intronic
1024545708 7:50515727-50515749 AAAAAGGCATTTCATGCAAATGG + Intronic
1024669090 7:51575636-51575658 AAAAAGGCATTTCATGCAAATGG - Intergenic
1024779617 7:52832537-52832559 GAAAATGTTGTTCCTGCCAAAGG - Intergenic
1024824013 7:53367752-53367774 GAAAAGAAGGTTCTTCCAAATGG + Intergenic
1024876024 7:54024688-54024710 GAAAAGGTACTCCATGCAAATGG - Intergenic
1024917018 7:54513385-54513407 AAAAAGGCATTTCATGCAAATGG - Intergenic
1025274871 7:57571246-57571268 GAAAAGGATGAAAAGGCAAAGGG + Intergenic
1027295580 7:76766055-76766077 AAAAAGGCATTTCATGCAAATGG + Intergenic
1027699424 7:81451226-81451248 AAAAAGGCATTTCATGCAAATGG + Intergenic
1027830627 7:83172670-83172692 GAAAAGGAGGTTCATGTGAGGGG - Intergenic
1028182814 7:87746652-87746674 AAAAAGGCATTTCATGCAAATGG - Intronic
1028306072 7:89266586-89266608 GAGAAGGCTATTCATGCAAGAGG - Intronic
1028818499 7:95177680-95177702 AAAAAGGCATTTCATGCAAATGG + Intronic
1029833206 7:103281673-103281695 GAAAAGGATGTAAAAGCCAAGGG - Intergenic
1030263820 7:107595086-107595108 GAAAAGAGTGTTCTGGCAAAAGG - Intronic
1030294265 7:107905355-107905377 GTAAAGGTTGTTCATGTCAATGG + Exonic
1030390247 7:108919178-108919200 GAAAAGGCATTTCATGCATATGG - Intergenic
1031203349 7:118720561-118720583 GAGAAGGATATTCATGAACATGG + Intergenic
1031380294 7:121077284-121077306 GAGAAGGAAGTTAATGAAAATGG + Intronic
1031879425 7:127179155-127179177 AAAAAGGCATTTCATGCAAATGG + Intronic
1032043563 7:128582879-128582901 GAAAAGAATGTTCCTGGAAGAGG - Intergenic
1033259825 7:139833290-139833312 AAAAAGGCATTTCATGCAAATGG + Intronic
1035073821 7:156164154-156164176 ATAAAGGAAGTTAATGCAAATGG + Intergenic
1036005283 8:4655192-4655214 GGAAACGAAGTTCATGAAAAAGG - Intronic
1036087648 8:5630744-5630766 TAAAAGTATGTTGATACAAACGG - Intergenic
1036827553 8:11989708-11989730 GAAAAGGTATTCCATGCAAATGG + Intergenic
1037311215 8:17558737-17558759 GTAAAGGATGTTTCTGGAAAAGG + Intronic
1037433476 8:18838985-18839007 GAAAAGGCTTATCATACAAATGG + Intronic
1037445830 8:18964967-18964989 GAATAAGTTGGTCATGCAAATGG - Intronic
1037697844 8:21242824-21242846 TAAAAGGTGTTTCATGCAAATGG - Intergenic
1037713403 8:21374688-21374710 AAAAAGGCATTTCATGCAAATGG - Intergenic
1038366958 8:26946274-26946296 AAAAAGGCATTTCATGCAAATGG - Intergenic
1038772189 8:30493319-30493341 GAAAAAGACATTGATGCAAAGGG + Intronic
1039084066 8:33762101-33762123 GGAAAGGATGTGAAGGCAAAAGG + Intergenic
1039123787 8:34177506-34177528 AAAAAGGCATTTCATGCAAATGG + Intergenic
1039211158 8:35216001-35216023 AAAAAGATAGTTCATGCAAATGG - Intergenic
1039242163 8:35568821-35568843 GAGAATGAAATTCATGCAAATGG + Intronic
1039304366 8:36245374-36245396 GAAAATGATATACATGCAAACGG + Intergenic
1039612230 8:38929063-38929085 GAAAAGAATGTGCCTGCAGAGGG - Intronic
1039641680 8:39229500-39229522 AAAAAGGCATTTCATGCAAATGG + Intronic
1040402787 8:47069346-47069368 AAAAAGGATGTTCCAGCATAAGG + Intergenic
1040635469 8:49268616-49268638 AAAAAGGCATTTCATGCAAATGG - Intergenic
1040799184 8:51322306-51322328 GAAAAGGCATTTCAGGCAAATGG + Intronic
1040820345 8:51548980-51549002 GAAAAGGGATTTCATGCAAATGG + Intronic
1041877775 8:62710559-62710581 AAAAAGGCATTTCATGCAAATGG - Intronic
1042088805 8:65135760-65135782 AAAAAGGCATTTCATGCAAATGG + Intergenic
1042338604 8:67655431-67655453 GAAAAGGATTTTGATGGAAAGGG + Intronic
1042823593 8:72957835-72957857 GAATAGGACATTCAAGCAAACGG + Intergenic
1043098958 8:76015396-76015418 GAAAACCGTGGTCATGCAAATGG + Intergenic
1043231046 8:77801050-77801072 AAAAAGTATGTTCAGGCAGAAGG - Intergenic
1043270903 8:78331581-78331603 AAAAAGGCATTTCATGCAAATGG + Intergenic
1043389121 8:79774472-79774494 GAAAAGGAAGCCTATGCAAAAGG + Intergenic
1043708567 8:83383372-83383394 GAAAAGATATTTCATGCAAATGG + Intergenic
1043988039 8:86717020-86717042 GAAAAAGATATTCCAGCAAATGG + Intronic
1045180999 8:99782577-99782599 GAAAAAGATGTCCAAGCAGAGGG + Intronic
1045417777 8:101984117-101984139 GAACAGGATGTTTATAAAAATGG + Intronic
1045738904 8:105330702-105330724 GAAAAGATGGTTCAGGCAAATGG + Intronic
1046692325 8:117299573-117299595 GAAAAGCATGTGTGTGCAAAGGG - Intergenic
1049295776 8:141836210-141836232 AAAAAGGCATTTCATGCAAATGG - Intergenic
1051362890 9:16296743-16296765 AAAAAGGCATTTCATGCAAATGG + Intergenic
1052131085 9:24847302-24847324 GAAATACATGTTCATGCAACAGG + Intergenic
1052158187 9:25221475-25221497 GAAAAGCATTTTTATGCTAATGG - Intergenic
1052247167 9:26349603-26349625 AAAAAGGCATTTCATGCAAATGG + Intergenic
1053753346 9:41278132-41278154 AAAAAGGCATTTCATGCAAATGG - Intergenic
1053884457 9:42632553-42632575 AAAAAGGCATTTCATGCAAATGG + Intergenic
1053888211 9:42661689-42661711 AAAAAGGCATTTCATGCAAATGG - Intergenic
1054223480 9:62439998-62440020 AAAAAGGCATTTCATGCAAATGG + Intergenic
1054227230 9:62469139-62469161 AAAAAGGCATTTCATGCAAATGG - Intergenic
1054258873 9:62842498-62842520 GAAAAGGCATTTCATGCAAATGG - Intergenic
1055163455 9:73160748-73160770 GAAAAAAATCTTCATGCAAGAGG - Intronic
1055169785 9:73242169-73242191 GAAAAGGAAGTTCAGCCGAACGG - Intergenic
1055346792 9:75348183-75348205 AAAAAGGGATTTCATGCAAATGG - Intergenic
1055731375 9:79282290-79282312 GAAAAAGATTTACATGCAAGTGG + Intergenic
1055816394 9:80212295-80212317 GAAAAAGTTATCCATGCAAATGG + Intergenic
1056188298 9:84159275-84159297 GCAAAGGATGTTGATTCCAAAGG + Intergenic
1056242203 9:84659048-84659070 GTAAAGGAGATTCCTGCAAATGG + Intergenic
1056698839 9:88885239-88885261 AAAAAGGCATTTCATGCAAATGG - Intergenic
1057584574 9:96317696-96317718 AAAAAGTATGTTGATGCAACAGG + Intergenic
1058410663 9:104727179-104727201 AAAAAGGCATTTCATGCAAATGG + Intergenic
1058540498 9:106007471-106007493 AAAAAGATAGTTCATGCAAATGG - Intergenic
1058622997 9:106903762-106903784 AAAAAGGCATTTCATGCAAATGG - Intronic
1060045764 9:120338774-120338796 GAAGACAATGTGCATGCAAAGGG - Intergenic
1060332429 9:122685626-122685648 GAAAAGATAGTTCATGCAATTGG + Intergenic
1060369230 9:123053890-123053912 CAAAAGGATGTGTATTCAAAGGG + Intronic
1061476426 9:130870288-130870310 GAGAGGTATGTACATGCAAAAGG - Intronic
1186309875 X:8306250-8306272 GAAAAGCCTTTTCCTGCAAATGG - Intergenic
1187053467 X:15717309-15717331 TAAAAGCATTTTCTTGCAAAGGG + Intronic
1187681585 X:21772427-21772449 AAAAAGGCATTTCATGCAAATGG + Intergenic
1187748580 X:22435420-22435442 AAAAAGGGATTTCATGCAAATGG + Intergenic
1187792293 X:22964180-22964202 GAAAAGGACGTTCATTTAAATGG + Intergenic
1188252233 X:27911188-27911210 AAAAAGCATTTTCATGAAAATGG + Intergenic
1188607269 X:32046772-32046794 GAAAAGGTTGTTCTTCCACAGGG - Intronic
1188633795 X:32402473-32402495 GAACAGGATGTGAATGAAAATGG - Intronic
1188713873 X:33436567-33436589 GAAAAGATATTTCATGCAAATGG + Intergenic
1189138084 X:38570871-38570893 GAAAAGGATGTAGAGGAAAAAGG + Intronic
1189218372 X:39346912-39346934 AAAAAGGGATTTCATGCAAATGG + Intergenic
1189754842 X:44260522-44260544 GGAAAGGATGTTTATGTACAAGG - Intronic
1189931916 X:46021390-46021412 GAAAAGGCATTTCATGCCAATGG + Intergenic
1190064604 X:47231336-47231358 GAAAAGGAGGGCCTTGCAAAGGG + Intergenic
1190449140 X:50560026-50560048 AAAAAGGTATTTCATGCAAATGG + Intergenic
1190690058 X:52906630-52906652 GAAAAGGCTGCTCATGCCTATGG - Intronic
1190695925 X:52949162-52949184 GAAAAGGCTGCTCATGCCTATGG + Intronic
1190895274 X:54612261-54612283 GAAAAGGCATTTCATGCAAATGG - Intergenic
1190955729 X:55191308-55191330 GAAAAGGTACTCCATGCAAATGG - Intronic
1191151619 X:57225977-57225999 AAAAAGGCATTTCATGCAAATGG - Intergenic
1191954361 X:66627432-66627454 AAAAAGGCATTTCATGCAAATGG + Intronic
1192820429 X:74638955-74638977 AAAAAGGCATTTCATGCAAATGG + Intergenic
1192994932 X:76503589-76503611 AAAAAGGCATTTCATGCAAATGG - Intergenic
1193077216 X:77366848-77366870 GAAAAGCCATTTCATGCAAATGG + Intergenic
1193253200 X:79317625-79317647 AAAAAGGCATTTCATGCAAATGG - Intergenic
1193590155 X:83379568-83379590 AAAAAGGCATTTCATGCAAATGG - Intergenic
1194466338 X:94238551-94238573 AAAAAGGTATTTCATGCAAATGG + Intergenic
1194767799 X:97862750-97862772 GATAAGGATGTTAAAGTAAAAGG - Intergenic
1194770629 X:97900441-97900463 GAAAAGGTAGTTCATTCATATGG + Intergenic
1194926718 X:99834684-99834706 GAAAAGGCATTTCAGGCAAATGG - Intergenic
1195019309 X:100810850-100810872 AAAAAGGCATTTCATGCAAATGG - Intergenic
1196163915 X:112516874-112516896 GAAAAGATAGTTCATGCAACTGG + Intergenic
1196171095 X:112589368-112589390 AAAAAGGCATTTCATGCAAATGG + Intergenic
1196219096 X:113090217-113090239 AAAAAGGCATTTCATGCAAATGG + Intergenic
1196465040 X:115962930-115962952 AAAAAGGCATTTCATGCAAATGG + Intergenic
1196675552 X:118417027-118417049 TAAAAGGCGTTTCATGCAAATGG - Intronic
1196737718 X:118994338-118994360 AAAAAGGCGTTTCATGCAAATGG + Intronic
1197030393 X:121806482-121806504 GAAAAGGTATTCCATGCAAATGG - Intergenic
1197132650 X:123022293-123022315 AAAAAGGCATTTCATGCAAATGG + Intergenic
1197519116 X:127475026-127475048 AAAAAGGCATTTCATGCAAACGG + Intergenic
1197589103 X:128386096-128386118 AAAAAGGCATTTCATGCAAATGG + Intergenic
1197664411 X:129208546-129208568 GAAAAGACATTTCATGCAAATGG - Intergenic
1198184468 X:134239931-134239953 GAAAAGGAAGTTCCTGAGAAAGG - Intronic
1199154237 X:144527289-144527311 GAAAAGATATTTCATGCAAATGG + Intergenic
1199233587 X:145467117-145467139 GAAAAGGTTTCCCATGCAAAGGG - Intergenic
1199521303 X:148739470-148739492 AAAAAGGCATTTCATGCAAATGG - Intronic
1199558903 X:149141457-149141479 GAAAAACATGATCATGCTAAGGG - Intergenic
1199668750 X:150123112-150123134 AAAAAGGCACTTCATGCAAATGG + Intergenic
1199821545 X:151454080-151454102 AAAAAGGCATTTCATGCAAATGG + Intergenic
1199926526 X:152472174-152472196 AAAAAGGCATTTCATGCAAATGG + Intergenic
1200415038 Y:2900803-2900825 AAAAAGTAATTTCATGCAAATGG + Intronic
1201307820 Y:12565894-12565916 AAAAAGGAATTTCATGCAAATGG - Intergenic
1201672189 Y:16536222-16536244 GAAAAGTATGTACTTGCATAGGG - Intergenic