ID: 960607482

View in Genome Browser
Species Human (GRCh38)
Location 3:119522048-119522070
Sequence CTTTGGATAAATACCTAGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 782
Summary {0: 1, 1: 2, 2: 40, 3: 203, 4: 536}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960607482 Original CRISPR CTTTGGATAAATACCTAGTA GGG (reversed) Intronic
906572168 1:46852118-46852140 CTTTGGGTATATACCCAGTAAGG - Intergenic
907260879 1:53217701-53217723 CTTTAAATAAATACCAAATAAGG + Intronic
907607937 1:55838225-55838247 CTTTGGATATATACCAAGTCAGG + Intergenic
908337182 1:63138592-63138614 TCTTGGGTAAATACCTAGAAGGG - Intergenic
908610677 1:65856680-65856702 CTTTGGGTATATACTCAGTAAGG + Intronic
908734252 1:67259271-67259293 CCTTGGATAAATACCTAGGTAGG + Exonic
909245986 1:73285057-73285079 CTCTGGGTATATACCCAGTAAGG - Intergenic
909247661 1:73308717-73308739 ATCTGGGTAAATACCTAGGAGGG - Intergenic
909304638 1:74057913-74057935 CTTTTGATAAATGTCTAGTCAGG - Intronic
909791992 1:79691742-79691764 CTTTGGAAAAATATCTATTTAGG + Intergenic
909987129 1:82174724-82174746 CTTTGGATACATATCAAGTAGGG - Intergenic
909989609 1:82207102-82207124 GCTTTGATAAATACCTAGGAGGG - Intergenic
910406486 1:86896581-86896603 CTTTGAAAAAATACCTATTAAGG + Intronic
910496761 1:87838315-87838337 CTTTGGGTATATACCCAGTAAGG - Intergenic
910600693 1:89029019-89029041 CTTTAGGTATATACCCAGTAAGG + Intergenic
910751031 1:90631101-90631123 CTTTGGAGAAATATCTATTGAGG - Intergenic
910811941 1:91247084-91247106 CTTTGGGTATATACCTAGTAAGG + Intergenic
910816227 1:91293690-91293712 CTTTGGGTATATACCTAGTAAGG - Intronic
910941139 1:92535399-92535421 CTTTGGGTATATACCCAGTAAGG - Intronic
911034914 1:93532098-93532120 CTGTTGATAAACAACTAGTATGG + Intronic
911136124 1:94442966-94442988 CTTTGGATGTATACCCAATAGGG + Intronic
911234959 1:95402729-95402751 CTTTGTATTAATTCCTAGAAGGG + Intergenic
911313785 1:96330637-96330659 CTTTGAGTAAATATCTAATATGG + Intergenic
911338761 1:96612230-96612252 CTTTGGGTATATACCCAGTAAGG + Intergenic
911373262 1:97019881-97019903 CTTTTGATAAATATCTATTGGGG - Intergenic
911724808 1:101232202-101232224 CTTTGGGTATATACCCAGTAAGG - Intergenic
912034228 1:105291151-105291173 CTTTGGATATATACCCAGTAAGG + Intergenic
912190725 1:107337101-107337123 TTTTGGATATATACCCAGAATGG - Intronic
912275484 1:108253873-108253895 CTTTGGAGAAATATCTATTCAGG + Intergenic
912292740 1:108440475-108440497 CTTTGGAGAAATATCTATTCAGG - Intronic
912743736 1:112226916-112226938 CTTTGGGTATATACCCAGTATGG - Intergenic
912832154 1:112962715-112962737 CTTTTGAGAAATGCCTATTAAGG + Intergenic
913373405 1:118125873-118125895 CTTTGGATAAATACCTAATAGGG + Intronic
914383391 1:147141715-147141737 CTTTGGAGAAATATCTATTCAGG + Intergenic
915200907 1:154227858-154227880 CTTTGGATAGATACTTTGTTTGG + Intronic
915843298 1:159235235-159235257 CTTTGGGTATATACCCCGTAAGG + Intergenic
916635748 1:166666810-166666832 CTTTGGGTATATACCCAGTAAGG - Intergenic
916748238 1:167700933-167700955 CTTTGGTTGAAAAGCTAGTAGGG + Intronic
916857869 1:168769891-168769913 CTTTGGGTATATACTCAGTAAGG - Intergenic
917065969 1:171093687-171093709 CTTTGGATAGATATCTACTAGGG + Intronic
917323648 1:173810001-173810023 CTTTGGGTATATACCCAGTAAGG - Intronic
917399769 1:174634524-174634546 ATTTGGGTATATACCCAGTAAGG - Intronic
918832044 1:189411135-189411157 CTTTGGGTATATACCCAGTAAGG + Intergenic
918851122 1:189692347-189692369 CTTTGGATAAATTTCTAGCCTGG + Intergenic
919288145 1:195592441-195592463 CTTTGAATAAATACCAGGTGTGG - Intergenic
919290287 1:195621602-195621624 CTTTAGGTATATACCCAGTAAGG + Intergenic
919320881 1:196036363-196036385 CTTTGAATAAATATACAGTAGGG + Intergenic
919435603 1:197555845-197555867 CTTTGGCTATATACCCAATATGG - Intronic
919561826 1:199130361-199130383 CTCTGGATAAATAGTTAATATGG - Intergenic
920642874 1:207770902-207770924 CTTTGGGTATATACCCAGTAAGG + Intronic
921775437 1:219094146-219094168 CTTTGGATAAATATTCAGAAGGG - Intergenic
922084085 1:222328888-222328910 CTTTGGAGAAATACCTATTCAGG + Intergenic
922131220 1:222780946-222780968 CTTTGGAAAAATGCCTATTTAGG + Intergenic
922713688 1:227853548-227853570 CCTTGGATAAATGCCTTGTATGG - Intergenic
923066449 1:230521686-230521708 CTTTGGCTATATACCCAGTATGG + Intergenic
923262261 1:232278697-232278719 CTTTGGGTAAAAACTAAGTAGGG + Intergenic
923424199 1:233852706-233852728 CTTTGGGTAAATATCAAGGAGGG - Intergenic
924575216 1:245274729-245274751 CTTTGGGTATATACCCAGTAAGG + Intronic
924575229 1:245274824-245274846 CTTTGGGTATATACCCAGTAAGG + Intronic
1062869361 10:886438-886460 CTTTGGATAAATACTCAGAAAGG - Intronic
1063086683 10:2824917-2824939 CTTTAAATACATAGCTAGTATGG - Intergenic
1063250995 10:4274688-4274710 CTTTGGGTATATACCCAGTAAGG - Intergenic
1064962081 10:20976410-20976432 TTTTGGGTATGTACCTAGTATGG - Intronic
1064975083 10:21105686-21105708 CTTTGGGTATATACCCAATAAGG + Intronic
1065083390 10:22149458-22149480 CTTTGGAAAAATATCTATTCAGG + Intergenic
1065561263 10:26966123-26966145 CTTTGGATATATACCCAGAAAGG - Intergenic
1066346269 10:34589974-34589996 CTTTGTATAAATACCAAAAATGG - Intronic
1066784656 10:38990093-38990115 CCTTGGGTATATACCCAGTAAGG + Intergenic
1068050296 10:51941951-51941973 CTTTGGGTATATACCCAGTAAGG + Intronic
1068127734 10:52862259-52862281 CTTTGGGTATATACCCCGTAAGG + Intergenic
1068412494 10:56675203-56675225 CTTTGAGTATATACCCAGTATGG + Intergenic
1069335851 10:67349193-67349215 TTTTGGATAAATACCCAGAGTGG - Intronic
1071105892 10:82094482-82094504 CTTTGGGTAGATACCCAGCAGGG - Intronic
1071238935 10:83682228-83682250 CCTTGGATATATGCCTAGAAGGG + Intergenic
1071306834 10:84306908-84306930 CTTCAGATAAATACCCAGAAGGG + Intergenic
1072177718 10:92945170-92945192 CTTTTGATAAATATCTATTCAGG + Intronic
1072384661 10:94912289-94912311 CTTTGGCTATATACCCAGTAAGG - Intergenic
1073821828 10:107273040-107273062 CTTTGGATATATACTCAGTAGGG + Intergenic
1074057104 10:109932585-109932607 TCTTGGATAAATACCTAGGATGG + Intergenic
1075814101 10:125251195-125251217 CTTTGGGTATCTACCCAGTAAGG + Intergenic
1076069663 10:127477572-127477594 CTTTCGGTATATACCCAGTAGGG + Intergenic
1077449939 11:2634679-2634701 CTTTGGGTATATACCCAGTAAGG + Intronic
1077817792 11:5704132-5704154 CTTTGGGTATATACCCAGCAGGG - Intronic
1077903060 11:6505593-6505615 CTTTGTTGAAATGCCTAGTATGG + Intronic
1078389593 11:10925442-10925464 CTTGGGATAAATGCCGAGCATGG + Intergenic
1078825695 11:14928187-14928209 TTTTGGATATATACTCAGTAAGG + Intronic
1079357442 11:19741854-19741876 CTTTGGGTATATACCCAGAAGGG + Intronic
1079665688 11:23102735-23102757 CTTTGGGCATATACCCAGTATGG - Intergenic
1079766692 11:24402782-24402804 CTTTGGGTGGATACCTAGTAGGG + Intergenic
1079943324 11:26709979-26710001 CTTAGGAGAAATACCTAATGTGG - Intronic
1080985696 11:37461596-37461618 CTTTGGGTATATACCCTGTATGG + Intergenic
1082023747 11:47556117-47556139 CTTAGGATAAATTCCTAGAAAGG - Intronic
1082151084 11:48739512-48739534 CTTTGGGTATATACCCAGTACGG - Intergenic
1082793226 11:57361789-57361811 CTTTGGGTATATACCCAGTAAGG + Intronic
1082926795 11:58556891-58556913 CTTTGGAAAAATATCTATTCAGG - Intronic
1083018421 11:59480884-59480906 CTTTGGATAAATAACTGATGTGG - Intergenic
1083530237 11:63414487-63414509 CTTTGGAGAAATATCTATTCAGG - Intergenic
1084505585 11:69564869-69564891 CTTAGGATAAATTCCTAGAGGGG - Intergenic
1086382389 11:86269998-86270020 CTCTGGGTAAATGCCTAGGAGGG + Intronic
1086513093 11:87581827-87581849 CTTTGGATATGTACTGAGTAGGG + Intergenic
1086875021 11:92085363-92085385 CTTTGGTTATATGCCTAGGAGGG + Intergenic
1087085705 11:94216438-94216460 CTTTGAGTATATACCCAGTATGG + Intergenic
1087201964 11:95354668-95354690 CTTTGGATAAATAACAAGTATGG + Intergenic
1087387144 11:97486033-97486055 CTTTTGGTATATACCCAGTATGG - Intergenic
1087694855 11:101364978-101365000 CTTTGGGTATATGCCCAGTAAGG + Intergenic
1088004154 11:104920693-104920715 CTTTGGGTATACACCTGGTAAGG + Intergenic
1088403850 11:109450251-109450273 CTTTGGGTACATACCCAGTAAGG - Intergenic
1088541133 11:110915022-110915044 CTTTGGAAATATACCCAGTTGGG - Intergenic
1088703379 11:112435144-112435166 CTTTGGGTATATACCCAGCAGGG - Intergenic
1088804737 11:113341828-113341850 CTGTGGAAAAACACCTAGAATGG - Exonic
1089039199 11:115430071-115430093 CTTTGGAAAAATAACTTGTAAGG + Intronic
1089663019 11:119998030-119998052 CTTTGGGTAAACACTTAGTATGG - Intergenic
1092303383 12:7274261-7274283 CTCTGGGTAGATACCCAGTAGGG + Intergenic
1092329377 12:7568617-7568639 CTTTGGAGAAATATCTGGTCAGG - Intergenic
1092639410 12:10487298-10487320 CTTTGGGTATATACCCAGTAAGG - Intergenic
1093052910 12:14523795-14523817 CTTTGGATAAATACCCAGCAAGG - Intronic
1093064071 12:14638357-14638379 CTTTGGATAAATACTCAGCAGGG - Intronic
1093157429 12:15703911-15703933 CTTTGGATAATTACGGAGTTTGG - Intronic
1093398169 12:18708811-18708833 CTTTGGAGAAATGCCTATTCAGG + Intronic
1093604083 12:21068536-21068558 CTCTGGCTATATACCTAGTATGG + Intronic
1093606664 12:21098668-21098690 CTTTGGATAAATTCCCAGTAGGG + Intronic
1093859746 12:24149656-24149678 TTTTGAGTAAATACCTAGAATGG - Intergenic
1094690704 12:32765599-32765621 CTTTGGGTAGATACTCAGTAAGG + Intergenic
1094742108 12:33301715-33301737 CTTTGGGTATATACCCAGTAGGG + Intergenic
1095258986 12:40076653-40076675 CTTTGGGTATATACCCAGTAAGG + Intronic
1096028724 12:48391861-48391883 CTTTGGGTATATACTCAGTAAGG + Intergenic
1097312439 12:58134997-58135019 CTTTGGAGAAATTCCAAGTATGG - Intergenic
1097567695 12:61291843-61291865 CTTTGGAGTAATAGCTAGTCTGG - Intergenic
1097634706 12:62108486-62108508 CTTTGGGTACATACCCAGTAAGG + Intronic
1098096195 12:66958809-66958831 CTTAGGATAAATTGCTAGAATGG + Intergenic
1098795494 12:74883063-74883085 CTTTGGATAAATGTCTATTCAGG - Intergenic
1098912823 12:76227237-76227259 CTTTGGAGAAATCCCTATTCAGG + Intergenic
1098945173 12:76581576-76581598 TTTTGGACAAAGACCTAGAAGGG - Intergenic
1099126776 12:78769533-78769555 CTTTGGATAAATACCCATATGGG - Intergenic
1099234902 12:80072255-80072277 ATTAGGAGAAATACCTAATATGG - Intergenic
1099398125 12:82167444-82167466 CTTTGAATATATACCCAGTAAGG - Intergenic
1099500944 12:83413769-83413791 CTGTGGGTATATACCTAGTAAGG + Intergenic
1099506442 12:83482218-83482240 CTTTGGGTATATACCCAGAAAGG + Intergenic
1099784578 12:87244630-87244652 CTTTGAATAGATACCTAACATGG + Intergenic
1099892769 12:88610048-88610070 CTTTGGGTATATATCCAGTATGG - Intergenic
1099937963 12:89150701-89150723 CTTTGGGTAGATATCCAGTAGGG - Intergenic
1100173213 12:92000962-92000984 CTTTGGATAATTGCCCAGTAGGG - Intronic
1101459293 12:104873528-104873550 CTTTGGATACATACCCAAAAGGG + Intronic
1101649496 12:106662064-106662086 CTTTGGGTAAATACCAAGAAGGG + Intronic
1104543747 12:129692479-129692501 CTTTGGGTATATACCCAGAATGG - Intronic
1104564335 12:129866760-129866782 CTTTGGATATATACCCAGAGTGG - Intronic
1106362139 13:29040462-29040484 CTCTGGGTAGATACCCAGTAGGG + Intronic
1106433157 13:29701514-29701536 CTTTGGGTAGATACCCAGTAGGG - Intergenic
1106755427 13:32818374-32818396 CTTTGGAAAAATATCTACTCAGG - Intergenic
1106905229 13:34400838-34400860 CTTTGGATACATGCCCAGTAGGG - Intergenic
1107632146 13:42353276-42353298 CTTTGGAAATATACCCAGAAAGG + Intergenic
1107663938 13:42669686-42669708 CTTTGGAAAAATATCAAGGAAGG - Intergenic
1107836919 13:44419454-44419476 CTTTGCAAGAATACCTGGTAAGG + Intergenic
1108812887 13:54251000-54251022 CTTTCAATAAATACTGAGTATGG - Intergenic
1109361988 13:61305106-61305128 CTTTGGGTATATACCCAGAAAGG - Intergenic
1109580106 13:64319324-64319346 CTTCAGATATATACCCAGTATGG + Intergenic
1109584477 13:64380630-64380652 CTTTGGATAAATACTCAGTAAGG + Intergenic
1109703849 13:66062736-66062758 CTTTGGAAAAATTCCTATTCAGG - Intergenic
1109897043 13:68706407-68706429 CTTTGGATATATACCCAGTAAGG + Intergenic
1110512549 13:76368248-76368270 CTTTGGATAAATATCTATTCAGG - Intergenic
1111027843 13:82555744-82555766 CTTTTGAGAAATACCTATTCAGG - Intergenic
1111032366 13:82620006-82620028 TTCTGGATAGATACCCAGTAGGG - Intergenic
1111327682 13:86720731-86720753 CTTTGGGTATATACACAGTAAGG - Intergenic
1111348951 13:87000521-87000543 CTTTTCATAGATACCCAGTAGGG - Intergenic
1111660008 13:91197870-91197892 CTTTGTAGAAATATCTAGTCAGG - Intergenic
1111776709 13:92672523-92672545 CTTTGAGTATATACCCAGTATGG - Intronic
1111922799 13:94430301-94430323 CTTTGGGTAGATGCCGAGTAGGG - Intergenic
1112147225 13:96713307-96713329 CTTTGCATAAATACATATTGAGG + Intronic
1112217758 13:97451933-97451955 CTTTGGAGAAATACCCATTCAGG + Intronic
1112713557 13:102158161-102158183 CTTTGGGTATATACCCAGTAAGG - Intronic
1112794555 13:103041951-103041973 CCTTGGGTAAATACCTAGGAGGG + Intergenic
1114544200 14:23486583-23486605 CTTTTGATAAATTCCTGGTTTGG + Intronic
1115110374 14:29814008-29814030 CTTTGGGTAATTACATACTAAGG + Intronic
1115343344 14:32316100-32316122 CTTTTGAGAAATACCTATTCAGG + Intergenic
1115669108 14:35588744-35588766 CTCTGGATATATACCCAGTAGGG - Intronic
1115724982 14:36203936-36203958 TTTTGGATAAATACCCAGAATGG - Intergenic
1115891542 14:38035296-38035318 CTTTGAATAAAAATCTAGAAAGG - Intronic
1116265261 14:42680271-42680293 ATTTGGATATATATCAAGTAAGG - Intergenic
1116281211 14:42910467-42910489 CTTTAGGTATATACCCAGTAAGG + Intergenic
1117030392 14:51663254-51663276 CTTTGGGTATATACCCAGTAGGG - Intronic
1117607622 14:57446318-57446340 ATTTGGGTAAATACCAAGGAAGG + Intergenic
1117898335 14:60509724-60509746 CTGTGGACAAGTACCGAGTAAGG + Exonic
1118044793 14:61956097-61956119 CTTTGGAGAAATGCCTATTTAGG + Intergenic
1118814962 14:69304969-69304991 TTTTGGATAAATACCCAGAGTGG + Intronic
1118961006 14:70532863-70532885 TTTTGGATAAATGCCTATTCAGG - Intronic
1119077391 14:71655470-71655492 CTTTGAGTAGATACCCAGTAGGG + Intronic
1119178837 14:72590276-72590298 TCTTGGTTAAATACCTAGGATGG - Intergenic
1119692449 14:76686676-76686698 CCTTGAATAAATATCTAGGAGGG + Intergenic
1119782759 14:77288724-77288746 GTTTGGATAAATAAATGGTACGG - Intronic
1120318637 14:82930457-82930479 CTTTGGGTATATACTCAGTACGG - Intergenic
1120742420 14:88122705-88122727 CTTTGGGTATATACCTAGTAAGG + Intergenic
1122406321 14:101503251-101503273 CTTTGGATCAGCACTTAGTAGGG - Intergenic
1122847621 14:104509337-104509359 CTTTGGATAAATAGCTAGGAGGG - Intronic
1123228705 15:17079186-17079208 CTTTGGGTATATACCCAGTAAGG - Intergenic
1123508190 15:20967220-20967242 CTTTGGATATATGCCCAGAAGGG + Intergenic
1123565410 15:21540967-21540989 CTTTGGATATATGCCCAGAAGGG + Intergenic
1123601675 15:21978257-21978279 CTTTGGATATATGCCCAGAAGGG + Intergenic
1123957466 15:25352903-25352925 CTTAAGATACATACCAAGTAGGG + Intronic
1124066647 15:26350515-26350537 CTTTGGGTAGATACCCAGTAGGG - Intergenic
1124117681 15:26862577-26862599 CTTTAGATAGATACACAGTATGG - Intronic
1124452771 15:29811549-29811571 ATTTGGATGTCTACCTAGTATGG - Intronic
1124682436 15:31746175-31746197 TCTTGCATAAATACCTAGTGGGG - Intronic
1124717370 15:32077297-32077319 CTTTGGGTAAATACCAAAGAGGG + Intronic
1124724068 15:32139363-32139385 CTTTGGATAAATACAAGGGAAGG + Intronic
1125155980 15:36586245-36586267 CTTTTAATAAATACCTTGTGGGG + Intronic
1125456485 15:39865190-39865212 CTTTGGGTAGATACCTAGTAGGG - Intronic
1125807590 15:42507277-42507299 ATGTAGATAAATACTTAGTAGGG + Intronic
1126051624 15:44691255-44691277 CATTGGACAATTACCTATTATGG - Intronic
1126233890 15:46359387-46359409 CTTTGGATATATACCCTATAAGG - Intergenic
1126965957 15:54054125-54054147 CTTTGGGCATATACCTAGCAGGG + Intronic
1127090824 15:55465246-55465268 CTCTAGATAGATACCCAGTAGGG - Intronic
1127369391 15:58323261-58323283 TTTTGGATATATACCCAGTAAGG + Intronic
1127754613 15:62079282-62079304 CTATGGATTAATACATATTAGGG + Intergenic
1128032487 15:64493482-64493504 CTTTGGGTAAATACAGGGTATGG + Intronic
1128172742 15:65527309-65527331 CTTGGAATAAATACCTATGAAGG - Intergenic
1128408067 15:67364057-67364079 CTTTGGGTATATACCCAATAAGG + Intronic
1128926914 15:71664994-71665016 CTTTGGGTATATACCCAGTAAGG + Intronic
1130363918 15:83215673-83215695 CTTTGGGTATATACCCAGTAAGG + Intergenic
1132358578 15:101192735-101192757 CTTTGGATAAATGTTTATTAAGG - Intronic
1202973782 15_KI270727v1_random:268057-268079 CTTTGGATATATGCCCAGAAGGG + Intergenic
1134753404 16:16645161-16645183 TTTTGGATATATACCCAGCATGG + Intergenic
1134769262 16:16792107-16792129 CTTTGGGTATATACCCAGTAGGG - Intergenic
1134992654 16:18713920-18713942 TTTTGGATATATACCCAGCATGG - Intergenic
1137082431 16:36077432-36077454 CTTTGGGTATATACCCAGTAAGG - Intergenic
1137421442 16:48338197-48338219 CATTTAATAAATACCTATTAAGG + Intronic
1138471003 16:57236360-57236382 TTTTGGATATATATCTACTATGG - Intronic
1138721159 16:59082025-59082047 CTTTGGGTATATACCCAGGAAGG - Intergenic
1138725231 16:59130079-59130101 CTTTGGATATAAACCCAGTAGGG + Intergenic
1138922198 16:61544982-61545004 CTTTGGAGAAATATCTATTCAGG + Intergenic
1139724484 16:68886185-68886207 CTTTGGAGAAATGTCTATTAAGG + Intronic
1140248115 16:73269657-73269679 TTTTGGGTAGATACCTAGGAGGG + Intergenic
1141037086 16:80636694-80636716 CTTTGGGTATATACCCAGGATGG - Intronic
1142725162 17:1808128-1808150 CTTAGGATAAATTCCTAGAAGGG - Intronic
1142931339 17:3286415-3286437 CTTTGGGTATATACTCAGTAAGG + Intergenic
1143815807 17:9513662-9513684 CTTTGGATAAGTGCCCAGTAGGG - Intronic
1144009381 17:11131835-11131857 TTTTGGATATATATCTAGTAGGG + Intergenic
1144231334 17:13207234-13207256 CTTTGGGTATACACCCAGTAAGG + Intergenic
1144612083 17:16729091-16729113 CTTTGGGTAGATGCCCAGTAGGG + Intronic
1144900651 17:18586291-18586313 CTTTGGGTAGATACCCAGTAGGG - Intergenic
1145131800 17:20359448-20359470 CTTTGGGTAGATACCCAGTAGGG + Intergenic
1146089254 17:29859793-29859815 CTTTGGGTATATATCCAGTAAGG + Intronic
1146423724 17:32715303-32715325 CTTTGGGTATATACCCAGTAAGG - Intronic
1146583860 17:34065020-34065042 CTCTGGATAGATACCCAGTAGGG - Intronic
1148663111 17:49352623-49352645 TTGTGGGTAAATACCTAGGAGGG - Intronic
1149090693 17:52774648-52774670 CTTTGGGTATATACCTAGTAAGG + Intergenic
1149170219 17:53800869-53800891 CTGTGTATAAATCCCTATTAAGG + Intergenic
1149371201 17:55994842-55994864 CTTTGTATAAATACTTGTTAAGG + Intergenic
1149719969 17:58833730-58833752 TTTTGGGTATATACCCAGTATGG + Intronic
1149884065 17:60323135-60323157 CTTTGGATATATACCTTGCATGG - Intronic
1150537765 17:66061418-66061440 CTTCAGATATATATCTAGTAGGG - Intronic
1151098135 17:71522773-71522795 TTTTGGATATATACCCAGAATGG - Intergenic
1153054219 18:929598-929620 CTTTTGATAAATAGTTATTAAGG - Intergenic
1153122930 18:1752857-1752879 CTTTGGATAAATGTCTAATCAGG - Intergenic
1153585896 18:6619911-6619933 CTTTGGATAAATACCCAAGCAGG - Intergenic
1154053532 18:10987880-10987902 CTTTGGAGAAATATCTATTCAGG - Intronic
1154396148 18:13991221-13991243 ATTTGGATAAATACCCAGTATGG - Intergenic
1155335485 18:24760381-24760403 CTTTGGTTACATACCCAGTAAGG - Intergenic
1155417097 18:25610775-25610797 CTTTGGAGAAATATCTATTCAGG - Intergenic
1155417907 18:25620762-25620784 CTTTGGAGAAATATCTATTGAGG + Intergenic
1155526826 18:26724682-26724704 TTTTGGATAAATACCTGAAAGGG + Intergenic
1155553225 18:26989562-26989584 CTTGGGAAAAATGCCTAGGAAGG - Intronic
1155684842 18:28536026-28536048 TTTTGGGTATATACCTAGAAAGG - Intergenic
1156007625 18:32462415-32462437 CTTTTGAGAAATGCCTATTAAGG + Intronic
1156934415 18:42685832-42685854 CTTTAGGTATATACCCAGTAGGG - Intergenic
1157018578 18:43750433-43750455 CTTTGGGTATATACCCAGTAAGG + Intergenic
1157473268 18:48006033-48006055 ATTTGGATATATACCCAGTAAGG + Intergenic
1157879866 18:51311198-51311220 TTTTGGGCATATACCTAGTAGGG - Intergenic
1158151097 18:54371491-54371513 TTTTGGATATATACCTAAGAGGG + Intronic
1158793969 18:60818763-60818785 CTTTGGGTATATACCCAGTAAGG + Intergenic
1159192499 18:65065181-65065203 TTTTTGATAAATACCCAGAAGGG + Intergenic
1159385663 18:67722362-67722384 CTTTTGAGAAATATCTAGTTAGG + Intergenic
1159613360 18:70550801-70550823 CTTTGGGTATATACCCACTAGGG - Intergenic
1159613489 18:70552308-70552330 CTTTGGGTAGATACTCAGTAAGG - Intergenic
1160199617 18:76785713-76785735 CTTTCAGTAAATACCTAGGAGGG - Intergenic
1160252471 18:77215188-77215210 CGCCGGATAAATACCAAGTATGG - Intergenic
1161606503 19:5217990-5218012 CTTGGGATATATCCCTAGCAAGG - Intronic
1163521132 19:17792767-17792789 CTTTGGGTAGATACCTACAAGGG + Intergenic
1164331629 19:24264273-24264295 CTTTGGGTATATATCCAGTAAGG + Intergenic
1167400605 19:49265844-49265866 CTTTGGAGAAATATCTACTCAGG - Intergenic
1167848208 19:52181900-52181922 CTTTGGATATATACCATGAAGGG + Intergenic
1168012853 19:53547533-53547555 CTTTGGATATATACCCAGAGTGG + Intronic
1168547605 19:57266550-57266572 CTTGGGATAAAAACCAAATATGG + Intergenic
1168628703 19:57939696-57939718 CTTTGGATAAATTCCCAGTAGGG - Intergenic
925037392 2:700035-700057 CTTTGGGTATATACTCAGTAAGG + Intergenic
925044011 2:757299-757321 CTTTGGACAAATACCCAGAGTGG - Intergenic
925354208 2:3226140-3226162 CTTTGGATATATACCCAGAATGG + Intronic
925376912 2:3392822-3392844 CTTTGGATACATACCCAGAATGG - Intronic
925720778 2:6824547-6824569 CTTTGGGTATATACCCAGTAAGG - Intergenic
925848563 2:8056923-8056945 CTTTGGAGAAATATCTATTCAGG + Intergenic
926074188 2:9927370-9927392 CTTTGGGTATATACTCAGTAAGG + Intronic
927034598 2:19161096-19161118 CTTTGGAAAAATGCCTATTCTGG + Intergenic
927795294 2:26042799-26042821 CTTTGGAGAAATACCTACAGAGG - Intronic
928008727 2:27587064-27587086 CTTTTGATAAATATCTAAGATGG + Intronic
928346919 2:30507810-30507832 CTTTGGGTATATATCCAGTAAGG + Intronic
928567133 2:32564467-32564489 CTTTGGTAATATACCTAGGATGG + Intronic
929446635 2:42007130-42007152 TTTTGGATGAATTCCTAGGATGG - Intergenic
929643026 2:43600658-43600680 CTCTGGGTAGATACCCAGTAGGG - Intergenic
930239185 2:48918260-48918282 CTTTGGGTATATACCCAGTATGG + Intergenic
930931605 2:56890622-56890644 CTTTGGAGAAATATCTATTTAGG + Intergenic
931307092 2:61040227-61040249 CTTTGGATATATACCCAGTAAGG - Intronic
931420880 2:62126271-62126293 CTTTGGGTATATACCCAGTAAGG + Intronic
932636454 2:73393083-73393105 CTTTGGAGAAATATCTATTCAGG + Intronic
932946787 2:76243246-76243268 CTTTGGATAAATACTCAGTATGG + Intergenic
933001919 2:76936079-76936101 CTTTGGGTATATACCCAGTATGG - Intronic
933270906 2:80231853-80231875 CTCTGGAAAAAAAACTAGTAAGG - Intronic
934530213 2:95081368-95081390 TCTTGGATACATACCTAGGAAGG + Intergenic
934651595 2:96094678-96094700 CTTTGGAGAAATGCCTATTCAGG - Intergenic
935027046 2:99286755-99286777 TTTTGGATGAATACCCAGAAAGG - Intronic
935439853 2:103079937-103079959 CTTTGGGTAAATTCCCAGTAGGG - Intergenic
936000904 2:108829329-108829351 CTTTGGAGAAATAGCTATTTAGG - Intronic
936085479 2:109465311-109465333 ATTCGGATAAATACCAAGAAAGG + Intronic
936255861 2:110910456-110910478 CTTAGAATAAATACCTAGAGAGG + Intronic
936528137 2:113256142-113256164 CTTTGTTGAAATACCTAGGAAGG - Intronic
936717869 2:115210518-115210540 CTTTGGGTGTATACCTAGTAAGG + Intronic
936897838 2:117447889-117447911 CTATGGATGTATACCCAGTAAGG - Intergenic
937424040 2:121782615-121782637 CTCTGGGTAGATACCTAGTAGGG + Intergenic
937878455 2:126846172-126846194 CTTTTGATAAATGTCTATTATGG - Intergenic
938484025 2:131685118-131685140 CTTTGGAAAAATATCTAATCCGG + Intergenic
938816747 2:134912445-134912467 TTTTGGGTATATACCTAGCAGGG + Intergenic
939370766 2:141297206-141297228 CTTTGGGTATATACCTAGTAAGG + Intronic
939837351 2:147147163-147147185 CTTTGGGTATATACCCAGTAAGG + Intergenic
939975645 2:148714412-148714434 CTTTGGGTATATACCAAGTAAGG + Intronic
940163883 2:150746309-150746331 CTTTGGGTAAATATCAAGAAGGG - Intergenic
940444090 2:153755548-153755570 CTTTTGAAAAATACCTATTCAGG + Intergenic
940451092 2:153838061-153838083 CTTTGGATAAATCTCTATTCAGG + Intergenic
940452364 2:153855429-153855451 CTTTGGAGAAATGCCTAGCCAGG - Intergenic
940631245 2:156242270-156242292 CTTTTGAGAAATACCTATTCTGG + Intergenic
940644690 2:156378444-156378466 TTTTGGATATATACACAGTAAGG + Intergenic
940669170 2:156646563-156646585 CTTTGGGTAAATATCCAGTATGG - Intergenic
940868536 2:158840263-158840285 ATTAGGATAAATACCTAATATGG - Intronic
941207979 2:162598468-162598490 CTTTTCTTAAATACCTAGAAGGG - Intronic
941239923 2:163024654-163024676 CTTTGGGTATATACCCAGAATGG - Intergenic
941388615 2:164883725-164883747 CTTTGGGTAAATATATACTAAGG + Intergenic
941390019 2:164900599-164900621 CTTTGGAGAAATATCTGCTAAGG + Intronic
942186676 2:173430866-173430888 CTTAGGATAAATTCTTAGAATGG + Intergenic
942400505 2:175596923-175596945 TTTTGGATATGTACCCAGTAAGG + Intergenic
942529886 2:176898258-176898280 CTTTGGGTAGAAACCCAGTAGGG + Intergenic
943138261 2:183943557-183943579 TTTTGAATAAATACCCAGTAGGG - Intergenic
943292021 2:186085585-186085607 CTATGCATAAATCTCTAGTAAGG + Intergenic
943322595 2:186464104-186464126 CTTTGGGTAGATACCCAATAGGG - Intergenic
943498973 2:188662432-188662454 ATTTGGATATATACTTAGGAGGG + Intergenic
943506447 2:188765978-188766000 ATTTGGAAAACTACCCAGTAGGG + Intronic
943592786 2:189819381-189819403 CTTTGGGTAGATACCCAGTAGGG + Intronic
944315930 2:198285815-198285837 CTTTGTTCAAATAACTAGTATGG - Intronic
944590387 2:201211719-201211741 CTTTGTTTATATACTTAGTATGG + Intronic
944727154 2:202483155-202483177 ATTTGGAAAAATACCTATTCAGG + Intronic
945018730 2:205549279-205549301 CTTTGGGTAAATACTAAGGAAGG - Intronic
945227304 2:207545064-207545086 CTTTGGGTATATATCCAGTAAGG + Intronic
945347375 2:208733836-208733858 CTTTGGCTATATACCCATTAAGG + Intronic
945410455 2:209500345-209500367 GTTTGGAAAAATACCTAGCCTGG - Intronic
946152214 2:217784119-217784141 CTTTGGGTATAATCCTAGTAAGG - Intergenic
946552446 2:220817466-220817488 CCTTGGGTATATACCTAGAAGGG + Intergenic
946662077 2:222012174-222012196 CTTTGGATATATATCAAGAAGGG + Intergenic
947376368 2:229500522-229500544 CTTTGGATATATATCCAGTAGGG - Intronic
947957788 2:234209100-234209122 CTTTGGGTATATACCCAATAAGG + Intergenic
948493328 2:238328086-238328108 TTTTGGATAAATACCCAGAAGGG + Intronic
1169304634 20:4477928-4477950 CTTTGGAGAAATAGCTATTCAGG - Intergenic
1169610157 20:7370237-7370259 CTTTGGGTTTATACCCAGTAAGG - Intergenic
1169902049 20:10562913-10562935 TTTTGTTAAAATACCTAGTAGGG + Intronic
1170093551 20:12619703-12619725 CTTTGGGTAAATACCCATTAAGG - Intergenic
1170112379 20:12819676-12819698 CTTTGGAGAAATATCTATTTAGG - Intergenic
1170112404 20:12819967-12819989 CTTTGGATGTATAACTAGAAGGG - Intergenic
1170224801 20:13980626-13980648 CTTTGGATATATACCTAGAGGGG - Intronic
1171999480 20:31761755-31761777 TTTTGGATATATACCCAGTAGGG + Intronic
1173025960 20:39307626-39307648 CTTGGTATAAATACCAAATAGGG + Intergenic
1173707969 20:45127022-45127044 TTTTGGATAAATACCCAGAAGGG + Intergenic
1174653133 20:52146220-52146242 CTTTGGGTATATACCCAGCATGG - Intronic
1174986839 20:55463765-55463787 ACTTTGATAAATACCTAGGATGG + Intergenic
1175519758 20:59592998-59593020 CTTTGTGTAAATACCAAGGAAGG + Intronic
1176318974 21:5288692-5288714 CTTTGGGCATATACCCAGTAAGG + Intergenic
1176476957 21:7228201-7228223 CTTTGGGCATATACCCAGTAAGG + Intergenic
1176727576 21:10453151-10453173 CTTTGGATACAAAGATAGTATGG + Intergenic
1176889543 21:14298008-14298030 CTTTGGATAAATGACTATTCAGG - Intergenic
1176900196 21:14431974-14431996 CTTTGGAGAAATGCCTATTGGGG - Intergenic
1177348401 21:19901776-19901798 CTTTGGGTATATACCCAGTAAGG + Intergenic
1177669262 21:24204953-24204975 CTTTGTATAAATATCTATTCTGG + Intergenic
1177711512 21:24781655-24781677 CTTTGGAAAAATATTTAGTGTGG + Intergenic
1178563909 21:33665322-33665344 CTTTGGAAAAATGCCTACTCAGG - Intronic
1178642655 21:34357948-34357970 CTCTAGGTAAATACCTAGAAGGG + Intergenic
1178749595 21:35288022-35288044 ATTTGGAGAAATGCCTATTAAGG + Intronic
1178761725 21:35409491-35409513 CTCTGGGTATATACCCAGTATGG + Intronic
1178812834 21:35899136-35899158 CTTTGGGTATATACCCAGTGAGG - Intronic
1178974202 21:37208001-37208023 CTTCTGAAAAATACCTAGAATGG - Intergenic
1179326943 21:40356130-40356152 CTTTGGATATATACCCAGAGTGG + Intronic
1179581160 21:42344882-42344904 CTTTGGATAGATACTCAGTGGGG - Intergenic
1180191133 21:46163130-46163152 CTTTGGAGAAATATCTATTCAGG + Intronic
1180286818 22:10753880-10753902 CTTTGGATACAAAGATAGTATGG - Intergenic
1180714314 22:17861103-17861125 CTTTCCATAAATGCCTAGAAGGG + Intronic
1180845229 22:18977406-18977428 TCTTGGGTAAATACCTAGGAGGG - Intergenic
1182187505 22:28421955-28421977 GTTATGATAAATACCTAGTCAGG + Intronic
949151478 3:773058-773080 CTTTGGGTATATACCCAGTAAGG + Intergenic
949196403 3:1314420-1314442 CTTTAGTTAAAAACTTAGTATGG + Intronic
949401729 3:3671833-3671855 CTTTGGGTATATACCCAGTAAGG + Intergenic
950476152 3:13216128-13216150 CTTTGGATAGATTCCTAGAATGG - Intergenic
950848473 3:16038397-16038419 CTTTGGGTATATACTCAGTAAGG + Intergenic
951030183 3:17872843-17872865 CTTTGGGTAGATGCCCAGTAGGG + Intronic
951282296 3:20766829-20766851 CATTGGATAAATACTCAGTGGGG + Intergenic
951515554 3:23555219-23555241 CTTTGGATAAATGTCTATTCAGG - Intronic
951796438 3:26543967-26543989 CTTTGGAAAAATATCTATTCTGG + Intergenic
952006339 3:28846510-28846532 CTTGGGATAAATACCTCTGAGGG - Intergenic
952083322 3:29787323-29787345 CTCTGGGTAAATATGTAGTAGGG - Intronic
952127970 3:30324383-30324405 CTTTGGCTAAATCTCTAGTTTGG - Intergenic
952726270 3:36589051-36589073 TTTTGGGTATATACCTAGCAGGG - Intergenic
952810074 3:37394217-37394239 CTTTGGGTATATACCCAATAAGG + Intronic
952886418 3:38014818-38014840 CTTTGGAGAAATATCTATTCAGG - Intronic
953156428 3:40378968-40378990 CTTTGGAGAAATACCTACTCAGG - Intergenic
953753335 3:45626231-45626253 ATTTGGGTAAATACCAAGGACGG - Intronic
954099626 3:48359313-48359335 CTTTGGAAAAATATCTATTCAGG - Intergenic
954487231 3:50863961-50863983 CTTTGGATATGTACCAAGCAGGG + Intronic
954949272 3:54455094-54455116 CTTTGGATATATACCCAGTAGGG + Intronic
956357767 3:68412876-68412898 CTTTGGGTATATACCCAGTAAGG + Intronic
956713976 3:72062220-72062242 CTTTGGATAGATCCCTGGAAAGG + Intergenic
957111702 3:75969312-75969334 CTTTGGGTATATACCCAGCAGGG + Intronic
957530203 3:81431169-81431191 CTTTGGGTATATACCCAGTAAGG - Intergenic
957570443 3:81940974-81940996 CTTTGGAAAAATATCTATTGAGG + Intergenic
957571881 3:81957318-81957340 CTTTGAGTATATACCTGGTAAGG + Intergenic
957693651 3:83604023-83604045 CTTTGGATATATACACAGAAGGG + Intergenic
957894420 3:86403002-86403024 CTTTGGCTAAAAAACTAATATGG + Intergenic
957931568 3:86885132-86885154 CTCTGGGTAGATACCCAGTAGGG + Intergenic
957993801 3:87662127-87662149 CTTTGGAAAAATATCTATTTAGG - Intergenic
958423547 3:93955217-93955239 CTTTGGGTATATACCCAGTAAGG - Intronic
958593049 3:96184652-96184674 TTTTGGATAAATACCCAGAATGG - Intergenic
958964573 3:100544838-100544860 TCTTGGGTAAATACCTAGTGAGG + Intronic
958985283 3:100773586-100773608 CTTTGGACAAATACCTAGGAAGG - Intronic
959369828 3:105509510-105509532 CTTTGGAAAAATGCCTATTCAGG + Intronic
959494363 3:107032188-107032210 CTTTGGGTATATACCCAGTAAGG - Intergenic
959738540 3:109689226-109689248 TTTTGGATATATACCGAGGATGG + Intergenic
959866124 3:111272395-111272417 CTTTGGATAGATACTTTATAGGG - Intronic
960017054 3:112903079-112903101 CTTTGAGTATATACCCAGTAAGG + Intergenic
960251760 3:115463421-115463443 CTTTGGGTATATACCCAGTAAGG - Intergenic
960492107 3:118329851-118329873 CTTTGGATATATACCCAGAATGG - Intergenic
960607482 3:119522048-119522070 CTTTGGATAAATACCTAGTAGGG - Intronic
960634554 3:119770080-119770102 CATTCAATAAATACCTACTAAGG - Intergenic
960772273 3:121207974-121207996 CTTTGGGTATATACCCAGTAAGG - Intronic
961187083 3:124924969-124924991 CTTTGGTTAAATACCAAGGAGGG - Intronic
961189375 3:124945156-124945178 CTTGGGATAAATTCCTAGAATGG - Intronic
962553567 3:136523068-136523090 CTTTGGATAGATACCCAGTAAGG + Intronic
962815744 3:138996705-138996727 TGTTGGGTAAATACCTAGTCAGG + Intergenic
962911052 3:139850035-139850057 CTTTGGATATATACCCAGTAAGG + Intergenic
963695269 3:148559416-148559438 CTTTGGGTATATACCCAGTAAGG + Intergenic
963717358 3:148819146-148819168 CTTTGGGTATATCCCCAGTAAGG + Intronic
964397492 3:156260675-156260697 CTTTGGATAATTTCCTGGTTTGG + Intronic
964689946 3:159438990-159439012 CTTTGGATATATACCCAGTAAGG + Intronic
965016325 3:163162119-163162141 ATTTTGATAAATACTTTGTAAGG + Intergenic
965241639 3:166207821-166207843 CTTTGGATATATACCCAGTTAGG + Intergenic
965383323 3:168016533-168016555 CTTTGGGTATATACCCAGTAAGG - Intronic
965477642 3:169177107-169177129 CTTTGGGTATATACCCAGTAAGG - Intronic
965526432 3:169724187-169724209 CTTTGGAAAAATACCAAGAAGGG - Intergenic
965714998 3:171593672-171593694 CTTTGGATATATACCCAGAGTGG + Intergenic
965891153 3:173515005-173515027 TTTTGGATAAATACCCAGAATGG + Intronic
966010356 3:175067730-175067752 TTTTGGATATATACCTAGTAGGG - Intronic
966339710 3:178912160-178912182 CTTTGGGTATATACCTAGTAAGG - Intergenic
966486166 3:180472943-180472965 CTTTGGATATATAACCAGTGTGG - Intergenic
966654998 3:182346257-182346279 CTTTGGGTATATACCCAGTATGG - Intergenic
969385397 4:6842959-6842981 ATTTGGATACATTCCTAGAAGGG + Intronic
969883803 4:10197486-10197508 CTTTGGGTATATACCCAGTTAGG + Intergenic
969958786 4:10921280-10921302 CTTTGGAGAAATATCTATTCAGG - Intergenic
970011305 4:11462498-11462520 TTTTGGGTATATACCTAGCATGG - Intergenic
970144315 4:13018304-13018326 CTTTGGAAAAATATCTATTCAGG - Intergenic
971656420 4:29351871-29351893 CTTTGGGTATATAGCCAGTAGGG + Intergenic
972222381 4:36970573-36970595 TTTTGGATATATACCCAGGATGG - Intergenic
973922264 4:55700002-55700024 CTTTGGGTATATACCCAGTAAGG - Intergenic
974458152 4:62155173-62155195 CTCTGGGTAGATACCCAGTAGGG - Intergenic
974498393 4:62663890-62663912 CTTTGGAAAAATATCTATTCAGG + Intergenic
974622580 4:64379903-64379925 CATTGGATAAATACCCAGGGTGG + Intronic
974658261 4:64853169-64853191 ATTTGGAGAAATACCTAATGTGG + Intergenic
974861598 4:67528820-67528842 TTTTGGGTATATACCTAGGAGGG + Intronic
974881485 4:67763490-67763512 CTTTGGAAAAATATCTATTTAGG + Intergenic
975163357 4:71148891-71148913 CTCTGCATATATACCTAGTAAGG + Intergenic
975525089 4:75340268-75340290 CTTTAGATAAATACAAAGTATGG - Intergenic
975833383 4:78394013-78394035 CTTTGGAGAAATACCTATTTAGG + Intronic
975896618 4:79100163-79100185 CTTTGGATACATACCCAACATGG + Intergenic
975994593 4:80299754-80299776 TGTTGGATATATCCCTAGTAGGG + Intronic
976105240 4:81610244-81610266 CTTTGGATATAGACTCAGTAAGG - Intronic
976328907 4:83805164-83805186 CTGTGGATATATACCCAGAATGG - Intergenic
976345806 4:83998867-83998889 ATTTGGATAAATATCTACAATGG - Intergenic
976572482 4:86629002-86629024 CTTTGGGTATATACCCAGTCAGG + Intronic
976680894 4:87754595-87754617 CTTTGGGTATATACCCAGTATGG + Intergenic
977036125 4:91955826-91955848 CTTTGGGTATATGCTTAGTAAGG - Intergenic
977063589 4:92286490-92286512 CTTTGGATATATACCCAGTAGGG + Intergenic
977547416 4:98400204-98400226 CTTTTGATAAATACCCAGTAAGG - Intronic
977777663 4:100940128-100940150 CTCTGGATAGATACCTAGTGTGG - Intergenic
978052305 4:104216667-104216689 CTTTGGGTATATTCCCAGTATGG - Intergenic
978252107 4:106643582-106643604 CTTTGGATAAATACCCAGTATGG + Intergenic
978584984 4:110267713-110267735 CTTTGGGTAAATATCAAGGAGGG - Intergenic
979346483 4:119593214-119593236 TTTTGGGTAAATACATAGGAGGG - Intronic
979916217 4:126437382-126437404 CTTTGGAGAAATATCTATTCAGG + Intergenic
980166137 4:129230261-129230283 CTTTTGAGAAATATCTATTAAGG - Intergenic
980514388 4:133835367-133835389 CTTTTGAGAAATACCTACTACGG + Intergenic
980514526 4:133837675-133837697 CTTTGGGTATATACCCAGAAGGG + Intergenic
981397069 4:144264200-144264222 CTTTGGATATATAACCAGCAGGG - Intergenic
981738517 4:147978174-147978196 TTTTGGATATATACCCAGTAAGG + Intronic
981838968 4:149089093-149089115 CTTTGGGTATATACCCAGTAAGG + Intergenic
981884524 4:149657803-149657825 CTTTTGAGAAATGCCTATTAAGG + Intergenic
982397881 4:154932010-154932032 CTTTTGAGAAATACCTATTCAGG + Intergenic
982507186 4:156234115-156234137 CTTTGGGTATATACCCAGTAAGG - Intergenic
982985030 4:162196315-162196337 CTTTTGGTATATACTTAGTATGG - Intergenic
984010185 4:174361275-174361297 TTTTGGATATATATCCAGTAAGG - Intergenic
984293169 4:177821098-177821120 CTTTGGATTAATACATAGTTTGG + Intronic
984481354 4:180306985-180307007 CTTTGGGTATATACTCAGTATGG + Intergenic
984592054 4:181627836-181627858 CTTTGGGTATATGCCCAGTAAGG + Intergenic
984625615 4:182004574-182004596 CTTTGGGTATATACCCAGTAAGG + Intergenic
985091744 4:186370197-186370219 CTTTGGGTATATACCCAGTAAGG - Intergenic
985109287 4:186532721-186532743 CTTTGGGTATATACCCAGTAAGG + Intronic
985436263 4:189932066-189932088 CTTTGAATATACACCCAGTAGGG - Intergenic
985793132 5:1942529-1942551 TTTTGGATATATACCCAGGAGGG + Intergenic
985853617 5:2407786-2407808 CTTTGGAGAAATATCTATTCAGG - Intergenic
986359045 5:6957758-6957780 CTTTGGGTATATACCCAGTAAGG - Intergenic
986373535 5:7106369-7106391 CTTTGAGTATATACCCAGTAAGG + Intergenic
986507526 5:8468060-8468082 CTTTGGAGAAATGCCTAGCAGGG - Intergenic
987092978 5:14523788-14523810 CTTTGGGTAAATACTAAGGAGGG - Intronic
987199515 5:15561563-15561585 CTTTGGATATATACCCAGCAGGG + Intronic
987520775 5:18980546-18980568 CTTTGGATATATAGCCAGAATGG + Intergenic
987565325 5:19576728-19576750 CTTTGGCTATATACCCAGTCAGG - Intronic
987669313 5:20986678-20986700 CTTTGGGTATATACCCAGTAAGG + Intergenic
988316648 5:29639667-29639689 CTTTGGATGTATACCCTGTAGGG - Intergenic
988324416 5:29743425-29743447 CTTTGGGTATATGCCCAGTATGG - Intergenic
988394887 5:30684163-30684185 CTTTGGATATATATCTAGAAAGG - Intergenic
988412871 5:30909721-30909743 CTTTGGGTATATACCCAGTAAGG - Intergenic
988637372 5:32999595-32999617 CTCTGGGTAGATACCTAGCAGGG + Intergenic
988875466 5:35440799-35440821 AGTTGGATAAATACCTAAGAAGG - Intergenic
989006463 5:36819032-36819054 CTTTGGCTAAATAGCTACTTTGG - Intergenic
989392628 5:40917627-40917649 CTTTGGCTATATACCCTGTAGGG + Intronic
989607575 5:43259254-43259276 CTTTGGGGAGATACCCAGTAGGG + Intronic
990480916 5:56209800-56209822 CTTTGGACACATTCCTAGAAAGG + Intronic
990638615 5:57757576-57757598 CCTTGGGTAAATACCTAGAAGGG - Intergenic
990770001 5:59232660-59232682 CTTTAGATAAACACCCAGTAGGG - Intronic
990859871 5:60314986-60315008 CTTTGGGTATATACCCAGTAAGG + Intronic
991172220 5:63641739-63641761 CTTTGGGTAGATACCCAGTAGGG + Intergenic
991239359 5:64439867-64439889 CTTTGGATATATTCCCAGAAAGG - Intergenic
991484987 5:67125752-67125774 CTTTGAGTATATACCCAGTAAGG + Intronic
991681049 5:69139815-69139837 TTTTGGGTATATACCTAGCAGGG + Intergenic
992177014 5:74159263-74159285 CTTTGGAGAAATACCTATTCAGG - Intergenic
992183361 5:74220085-74220107 CTTTTGGTATATACCCAGTATGG - Intergenic
992782029 5:80136788-80136810 CTTTTGAGAAATACCTATTCAGG - Intronic
993065444 5:83092156-83092178 CTTTTGACAAATACCTATTCAGG + Intronic
993212658 5:84974259-84974281 CTTTGGCTAGATACCCAGGAGGG + Intergenic
994360919 5:98847360-98847382 GTTTGGGTAAATACCAAGGAGGG - Intergenic
994466258 5:100136528-100136550 TTTTGGATAAATACCTACTAGGG + Intergenic
994777708 5:104055868-104055890 CTCTGGGTCAATACCTAGTAGGG + Intergenic
994884709 5:105545232-105545254 CTTTGGAAAAATGCCTATTTAGG + Intergenic
995415360 5:111905218-111905240 ATTTGGGTAAGTACCTAGGAGGG + Intronic
995535667 5:113133626-113133648 TTTTGGATATATACCCAGTAAGG + Intronic
995974944 5:118023070-118023092 CTTTGGGTATATACCCAGAAGGG - Intergenic
996005364 5:118414599-118414621 CTTTGGATATATACCCTGCAAGG - Intergenic
996429378 5:123355285-123355307 CTTTGGGTATATACCCAGTAAGG + Intronic
996928596 5:128858958-128858980 ATTTGGGTATATACCCAGTATGG + Intronic
997140675 5:131376991-131377013 CTTTGGGTATATACTCAGTAAGG + Intronic
997186540 5:131887340-131887362 CTTTGGGTATATACCCAGTAAGG + Intronic
997333602 5:133086527-133086549 TTTTGGCTATATACCTAGAATGG + Intronic
997887601 5:137644520-137644542 CTTTGGATGCATACCCAGTATGG + Intronic
998180870 5:139940092-139940114 TCTTGGATGAATACCTAGCATGG - Intronic
998361734 5:141594216-141594238 CTTTGGATAAATAAATACCAAGG - Intronic
998843178 5:146277981-146278003 CTTTAGGTAAATTCCTAGGAAGG + Intronic
999346292 5:150822770-150822792 CTTTGGGTATATACCCAATAAGG - Intergenic
999549351 5:152668502-152668524 CTTTGGATATATACCTAAAGTGG - Intergenic
1000215154 5:159148112-159148134 CTTTGGATATATACCCAGATAGG - Intergenic
1000394240 5:160756374-160756396 TCTTGGATAAATACTTAGGAGGG + Intronic
1000741732 5:164976781-164976803 TTTTGAATGTATACCTAGTAAGG + Intergenic
1001922960 5:175615148-175615170 TTTTGAATAAATACCCAGAAGGG - Intergenic
1002149454 5:177215487-177215509 TTTTGGATAAATACCTAGAATGG + Intronic
1002583122 5:180222571-180222593 CTTTGTTGAAATACCTAGTGTGG + Intergenic
1002681142 5:180965881-180965903 CTTTTGATATTTACCCAGTAGGG - Intergenic
1003621657 6:7706064-7706086 CTGAGGAAAAATACCCAGTACGG - Intergenic
1004095979 6:12554824-12554846 CTTTGGGTATATACCCAGTAAGG - Intergenic
1004875684 6:19950924-19950946 CCTTAGATAAATATCTATTAAGG + Intergenic
1006216444 6:32447624-32447646 CTTTGGATAAATACATAGAAGGG + Intergenic
1006694034 6:35915485-35915507 CTTAGGATAAATACTTCGAATGG - Intronic
1006916661 6:37599041-37599063 CTTTGGGTATATACCTAGTAAGG + Intergenic
1008150392 6:47943389-47943411 CATTAGATGAATACCTACTAGGG + Intronic
1008239503 6:49091882-49091904 CATTGGATAAACTCCCAGTAGGG + Intergenic
1008342524 6:50384838-50384860 CTTTGAATTAATACTTAGTGGGG - Intergenic
1008463609 6:51805020-51805042 CTTTGGATATATACCCAGTAAGG - Intronic
1008757282 6:54811222-54811244 TTTTTGATAAATAGCTAGAATGG + Intergenic
1009313053 6:62181386-62181408 CTTTGGAGAAATGCCTATTCAGG - Intronic
1010079369 6:71841107-71841129 ATCTGGATAAATACCAAGCAAGG + Intergenic
1010974484 6:82297027-82297049 CTATGAATAAATACCTAGATTGG + Intergenic
1011229654 6:85146102-85146124 CTTTGGATATATACCCAGTATGG + Intergenic
1011414479 6:87103096-87103118 TCTTGGATAATTACCTAGGAGGG - Intergenic
1011571461 6:88741087-88741109 CTTTAGATATATACCCAGTAAGG - Intronic
1011987063 6:93460598-93460620 TTTTGGATAAATACTAAGGATGG + Intergenic
1011994266 6:93565600-93565622 CTTGGGGTATATACCCAGTATGG + Intergenic
1012688835 6:102288126-102288148 CTTTTGATAAATACCCAGTAGGG - Intergenic
1013045794 6:106483816-106483838 CTTTTGAGAAATGCCTATTAAGG + Intergenic
1013279014 6:108617128-108617150 CTTTGGGTATATGCCTAGGAGGG + Intronic
1014348689 6:120310583-120310605 CTTTAGATAGATACCCAGTAGGG + Intergenic
1014355393 6:120402547-120402569 TTTTGGATATATACCCAGCAGGG + Intergenic
1014375579 6:120668324-120668346 CTTTTGAGAAATATCTAGTCAGG + Intergenic
1014423456 6:121272750-121272772 CTTTGGGTATATACCCAGTAAGG - Intronic
1014511781 6:122331434-122331456 CTTTGGGTATATACCCAGTATGG - Intergenic
1014636312 6:123851195-123851217 CTTTGGATATATACTCAGTAGGG + Intronic
1014844611 6:126259626-126259648 CTTTGGGTATATTCTTAGTAAGG + Intergenic
1015281473 6:131439446-131439468 CTTTGGATATACACCCAGTAAGG - Intergenic
1015354898 6:132266220-132266242 CTTTGGATAAATGTCTATTCAGG + Intergenic
1015676174 6:135752164-135752186 CTTTGGAGAAATGTCTAGTCAGG - Intergenic
1015824409 6:137296398-137296420 ATTTGAATAATTACCTAATACGG - Intergenic
1016458185 6:144253815-144253837 TCTTGGATAGATACCTAGTGTGG + Intergenic
1016477135 6:144440034-144440056 TTTTGTATTAATTCCTAGTATGG + Intronic
1016577506 6:145585881-145585903 AATTGGATAAATACGTAGAAGGG - Intronic
1016726859 6:147381224-147381246 CTTTGGATAAATATCTATTGAGG - Intronic
1017167510 6:151423786-151423808 CTTAGGATAAACTCCTAGAAAGG - Intronic
1018271976 6:162089528-162089550 TTTTGGATATATACCTAGAAGGG - Intronic
1019972778 7:4554955-4554977 CTTTGGGTATATACTTAGTAAGG + Intergenic
1020188292 7:5975083-5975105 TCTTGGATAAAGACCTAATAGGG - Intronic
1020294625 7:6749685-6749707 TCTTGGATAAAGACCTAATAGGG + Intergenic
1020489602 7:8763930-8763952 TTTTGGGTAAATACCTAAGAAGG + Intergenic
1020588391 7:10102820-10102842 CTTTGGAGAAATGCCTATTCAGG - Intergenic
1020917878 7:14219584-14219606 CTTTGGATAAATGTCTATTAAGG + Intronic
1021057839 7:16072656-16072678 CTTTGGATATATACCCAGAGTGG - Intergenic
1021351288 7:19596980-19597002 CTTTGTATATATACCCAGTAAGG + Intergenic
1021367412 7:19796906-19796928 CTTTGGATAAATATACAGTATGG + Intergenic
1021535548 7:21700600-21700622 CTTTGGGTATATACCTAGAAAGG - Intronic
1022635971 7:32135464-32135486 CTTTGGAAAAATGCCTATTCAGG - Intronic
1023236438 7:38095166-38095188 CTTTGGGTATATACCCAGAAAGG - Intergenic
1023285103 7:38610957-38610979 TTTTGGATAAATACCCAGAGTGG - Intronic
1023473313 7:40549143-40549165 CTTTGGTTAAATTCTTAGTGAGG + Intronic
1023543694 7:41294469-41294491 CTTTGGATAAATGCTTAAAAAGG + Intergenic
1024171592 7:46793234-46793256 CTTTGGATATATACCCAGAAGGG + Intergenic
1024742337 7:52367919-52367941 CTTTGGGTGTATACCCAGTAAGG + Intergenic
1024949951 7:54850197-54850219 CTTTGGGTATATACCCAGTATGG + Intergenic
1025624695 7:63210089-63210111 ATTAGGAGAAATACCTAATATGG + Intergenic
1025865938 7:65380699-65380721 CTTTGGGTATATACCTAATTAGG + Intronic
1026133528 7:67639941-67639963 CTTTGAATATATACCTGGTAAGG + Intergenic
1026542557 7:71293204-71293226 CTTTGGATATATATCTAAAATGG + Intronic
1026974951 7:74491828-74491850 CTTTGGGTATATACCCAGTAAGG + Intronic
1027349485 7:77296098-77296120 CTCTGGATAAATTTCCAGTAGGG + Intronic
1028045496 7:86112434-86112456 CTTTGGATATATAACCAGTAGGG + Intergenic
1028064800 7:86370111-86370133 CTTTGGATAAATATTCAGTAGGG + Intergenic
1028208654 7:88046066-88046088 CTTTGGATGCATACCCAGAAGGG + Intronic
1028348275 7:89811220-89811242 CTCTGGGTAGATACCCAGTAGGG - Intergenic
1028969572 7:96842726-96842748 CTTTGGATATATACCCAGTAAGG + Intergenic
1029831620 7:103266288-103266310 CTGTGGCTAAATGCCTAGTGTGG - Intergenic
1030195042 7:106845000-106845022 CTTGGAATATATATCTAGTAGGG - Intergenic
1030471648 7:109971358-109971380 CTTTGAATATATACCTAATATGG - Intergenic
1030487306 7:110185862-110185884 CTTTGGATAAATGTCTATTCAGG - Intergenic
1030522457 7:110615076-110615098 CTTTGGATATAAACCTAGTAGGG + Intergenic
1030726284 7:112929280-112929302 CTTTGGAAAAATATCTATTCAGG - Intronic
1030726312 7:112929571-112929593 CTTTGGATAAATACCCATAGTGG - Intronic
1030735272 7:113040913-113040935 CTTAGGATAAATTCCTAGGGGGG - Intergenic
1031175695 7:118346275-118346297 CTTTGGATAGATAGATAGTCTGG + Intergenic
1031203045 7:118715966-118715988 CATTGAATATATACCTAGAATGG + Intergenic
1031826018 7:126566669-126566691 TTTTGGATAAATACTCAGAAGGG - Intronic
1032296913 7:130647496-130647518 CCTTGAGTAAATACCTAGAAGGG + Intronic
1033626641 7:143116933-143116955 CTTTGGGTATATACCCAGTAAGG - Intergenic
1033772842 7:144572756-144572778 TTTGGGATATATACCTAGGAAGG - Intronic
1033785260 7:144722375-144722397 ATTTGGATAAATACCTTCTTGGG - Intronic
1034486398 7:151366823-151366845 CTTTGAATATATACCAAGAACGG + Intronic
1034585077 7:152083625-152083647 CTTTGGAAAAAGAACTAGTGGGG - Intronic
1034602521 7:152274842-152274864 CTTTGGATACAAAGATAGTATGG - Intronic
1035151952 7:156881965-156881987 CTTAGGATAAATACTCAGAAGGG - Intronic
1037159084 8:15745309-15745331 CTTTGGGTGTATACCCAGTAAGG + Intronic
1037257765 8:16974351-16974373 CTTTGGGTATATACCCAGTATGG + Intergenic
1039173603 8:34778926-34778948 CTTTGGATATATACCCAGTATGG - Intergenic
1039400387 8:37264093-37264115 TTTTGGATAAATACCCAGTAGGG - Intergenic
1039807990 8:41018798-41018820 CTTTGGGTATATACCCAGTGAGG + Intergenic
1039809528 8:41033989-41034011 CTTTGGGTATATACCCAGTGAGG - Intergenic
1040357059 8:46628877-46628899 CTTTGGGTATATACCCAATAAGG - Intergenic
1040809842 8:51439881-51439903 CTCTGGGTAAATATCCAGTAGGG - Intronic
1041272791 8:56125276-56125298 CTTTGGATAAATAGCGAGTGTGG + Intergenic
1041504053 8:58574485-58574507 CTTTGCCCAAATACCTAGAAGGG + Intronic
1041817496 8:61991600-61991622 ATTAGGAGAAATACCTAATATGG - Intergenic
1041900126 8:62973171-62973193 CTTTGGGTATACACCCAGTAGGG + Intronic
1042000466 8:64118025-64118047 CTTTAGATGAATACCCAGTAGGG - Intergenic
1042451536 8:68953036-68953058 TCTTGGGTAAATACCTAGGAGGG - Intergenic
1042861439 8:73317952-73317974 TTTTGCATGAATACCTAATATGG - Intronic
1042876291 8:73443224-73443246 CTTTGGATAAATATGTGGAAAGG + Intronic
1043252003 8:78086712-78086734 CTTTGGGTAGATACCCAGTAGGG + Intergenic
1043629793 8:82315521-82315543 TTTTGGGTATATACCCAGTAAGG + Intergenic
1043751354 8:83939823-83939845 CTTTGGAAAAATATCTATTTAGG + Intergenic
1043788414 8:84431890-84431912 CTTTGGTTATATACCCAGTGGGG + Intronic
1043840764 8:85101054-85101076 CTATAGATAATTACCCAGTAGGG + Intergenic
1044221732 8:89677754-89677776 CTTTGGGTGTATACCCAGTAAGG - Intergenic
1044384623 8:91572895-91572917 CTTTGGGTATACACCTAGTAAGG - Intergenic
1044440230 8:92215409-92215431 CTTTGGGTATATCCCCAGTAAGG + Intergenic
1044685143 8:94819537-94819559 TCTTGGATACATACCTAGAAGGG + Intronic
1046151066 8:110226760-110226782 CTTTGGATATATACCTAGAAAGG + Intergenic
1046188116 8:110749417-110749439 CTTTGGACATATACCCAGAAGGG - Intergenic
1046266796 8:111841051-111841073 ATTTGAATATATACCCAGTAGGG - Intergenic
1047383733 8:124388905-124388927 CTTTGGGTAGATACCCAGTAGGG + Intergenic
1048055340 8:130857461-130857483 TTTTCGATAAATACGTTGTAAGG - Intronic
1048299126 8:133238764-133238786 CTTTGGATTAATACCGAGTTAGG + Exonic
1048435878 8:134417064-134417086 CTTTGGGTATATACCCAGTATGG - Intergenic
1048891129 8:138948323-138948345 CTTTTGAGAAATGCCTATTAAGG - Intergenic
1048912050 8:139144740-139144762 CCTTGGAAAAATACCTATTCAGG + Intergenic
1049077823 8:140414010-140414032 CTTTGGGTATATACCCAGTAAGG + Intronic
1050198958 9:3120978-3121000 ATTAGGAGAAATACCTAGTGTGG - Intergenic
1050347558 9:4707361-4707383 CTTTGGCTAAGTACCCATTAAGG + Exonic
1050350584 9:4738014-4738036 CTTCAAATAAATTCCTAGTATGG - Intronic
1050368509 9:4896578-4896600 CTTTGGGTATATACCCAGTAAGG + Intergenic
1050761642 9:9079498-9079520 CTTTGGATAGATTCTCAGTAGGG + Intronic
1050795141 9:9529766-9529788 CATTGGGTAAATACCTAGAGAGG - Intronic
1050931675 9:11336383-11336405 GTTTTGATAGATACCTTGTAAGG + Intergenic
1051567653 9:18518649-18518671 CTTTGGTTAGATACCCAGTGTGG + Intronic
1052293224 9:26867947-26867969 CTTTGGAGAAAGAACAAGTATGG + Intronic
1052694901 9:31865241-31865263 CTTTGGGTATATACCCAGTATGG + Intergenic
1052696308 9:31883661-31883683 CTTTGGGTATATATCCAGTATGG + Intergenic
1053485074 9:38446597-38446619 CTTTGGATAAATACCCATACTGG + Intergenic
1053593787 9:39539100-39539122 TTTTGAATAAATACCAAGTGTGG + Intergenic
1053625446 9:39866303-39866325 CTTTGGATATATACCTAGATGGG + Intergenic
1053851576 9:42294152-42294174 TTTTGAATAAATACCAAGTGTGG + Intergenic
1053879416 9:42576920-42576942 CTTTGGATATATACCCAGATGGG - Intergenic
1053893242 9:42717439-42717461 CTTTGGATATATACCTAGATGGG + Intergenic
1054218442 9:62384398-62384420 CTTTGGATATATACCTAGATGGG - Intergenic
1054232274 9:62524777-62524799 CTTTGGATATATACCCAGATGGG + Intergenic
1054572462 9:66825852-66825874 TTTTGAATAAATACCAAGTGTGG - Intergenic
1054782121 9:69174789-69174811 CTTTGCATCAATACCGAGTGTGG - Intronic
1055283627 9:74703785-74703807 CTCTGGGTAGATACCTAATAGGG + Intergenic
1055903009 9:81262703-81262725 CTTTGGCTATATACCCAGTATGG - Intergenic
1056485750 9:87055712-87055734 CTTTGGAAAAATACCCATTCAGG + Intergenic
1057238672 9:93389200-93389222 CTTAGGATAAATACCCAGAAAGG + Intergenic
1057320029 9:94004187-94004209 CTCTGTTTAAATACCTAGTGTGG + Intergenic
1057749124 9:97776861-97776883 CTTAGGAAAAATACCTATTCAGG - Intergenic
1058270370 9:102965698-102965720 CTTTGAAGAAATGCCTATTAAGG + Intergenic
1058307955 9:103466252-103466274 CTCTGGGTAGATACCCAGTAGGG + Intergenic
1058554475 9:106152316-106152338 CTTTGGGTATATGCCTAGGAAGG - Intergenic
1059236724 9:112766954-112766976 ATATGGATATATACCTAGAAGGG + Intronic
1060425600 9:123502481-123502503 CTTTGGAGAAATATCGAGTCAGG + Intronic
1062522703 9:136964955-136964977 TTTTGGGTAAATACCCAGGAAGG - Intergenic
1062701753 9:137909704-137909726 TTTTGGATATATAGCTAGAAGGG + Intronic
1203412390 Un_KI270579v1:30882-30904 CTTTGGGCATATACCCAGTAAGG + Intergenic
1185686393 X:1932358-1932380 CTTTGGATAAATTCCCAGCAGGG + Intergenic
1185753471 X:2633090-2633112 TTTTGGGTAAATACCCAGGAGGG + Intergenic
1186135018 X:6510400-6510422 CTTTGGGTATATACCCAGCAAGG - Intergenic
1186851673 X:13586102-13586124 CTTTGGATAAATGTCTATTCAGG - Intronic
1186920901 X:14279122-14279144 CTTTGGATGAATACCCAATAGGG - Intergenic
1187983618 X:24786454-24786476 CTTTGGAAAAATATCTATTCAGG + Intronic
1188194921 X:27221813-27221835 CTTTGAGTATATACCCAGTAAGG + Intergenic
1188435733 X:30156182-30156204 CTTTGGGTATGTACCTAGAATGG + Intergenic
1188810335 X:34646596-34646618 CTTTGAATAAAAACCTAATTAGG + Intronic
1188863275 X:35284429-35284451 CTTTGGATATATGCCCAGGAAGG - Intergenic
1189022540 X:37356223-37356245 CTTTGGAGAAATACAAAGCAGGG + Intronic
1189660781 X:43295987-43296009 CTTTGGGTATATACCCAGAATGG - Intergenic
1190080457 X:47353144-47353166 CTTTGGTTATGTATCTAGTAGGG + Intergenic
1190505602 X:51123049-51123071 CTTTGGATATATATCCAGAAGGG + Intergenic
1190587352 X:51959865-51959887 CTTTGGGTATATACCCAGTAAGG + Intergenic
1190591609 X:52008238-52008260 CTTTGGGTATATACCCAGTAAGG + Intergenic
1190942910 X:55060421-55060443 CTTTGGAAAAATATCTATTCAGG + Intergenic
1191058425 X:56268304-56268326 CTTTGGATATATACCCAGAAGGG + Intronic
1191072254 X:56412856-56412878 CTTTGGGTATATATCCAGTAAGG + Intergenic
1191205780 X:57832917-57832939 CTTTGGGTATATACCCAGTAAGG - Intergenic
1191597469 X:62961260-62961282 CTTTGAGTATATACCCAGTAAGG + Intergenic
1191789469 X:64953809-64953831 CTTTGGGTATATACCCAGTAAGG - Intronic
1191970290 X:66806684-66806706 TTTTGGATAAATACCAGGAAGGG + Intergenic
1192015903 X:67330599-67330621 CTTTGGGTACATACCCAGTAGGG - Intergenic
1192023381 X:67421494-67421516 CTTAGGAGAAATACCTAATGTGG - Intergenic
1192075266 X:67988648-67988670 CTTTGGATAGATATCCAGTGGGG - Intergenic
1192987339 X:76414453-76414475 CTGTGGGTAGATACCTAGTAGGG - Intergenic
1193589506 X:83370560-83370582 CTTTGGAGAAATATATAGTCTGG + Intergenic
1194096450 X:89645425-89645447 TTTTGGATATATACCCAGTAAGG - Intergenic
1194264146 X:91734532-91734554 CTCTGGGTAGATACCCAGTAGGG + Intergenic
1194565206 X:95478374-95478396 CTTTGGAGAAATATCTATTCAGG - Intergenic
1194588795 X:95771217-95771239 CTTTGGATATATACCCAGTAAGG - Intergenic
1194990062 X:100537626-100537648 CTTTGGGTATATACCCAGTAAGG + Intergenic
1195223680 X:102770437-102770459 CTTTGGATATATACTCAGAAGGG + Intergenic
1195501530 X:105606542-105606564 CTTTGGATATATATCCTGTAGGG - Intronic
1195691700 X:107631545-107631567 CTTAGAATAAATCCCTAGGAAGG + Intronic
1196088426 X:111711688-111711710 CTTTTGAGAAATACCTGGAACGG + Exonic
1196531370 X:116790838-116790860 CTTTGGGTATATACCCAGTAAGG - Intergenic
1196550128 X:117014779-117014801 TTTTGGGTACATACTTAGTAGGG - Intergenic
1197102944 X:122678148-122678170 CTCTGGGTAGATACCTGGTAGGG - Intergenic
1197274285 X:124460219-124460241 CTTTGAGTATATACCCAGTAAGG - Intronic
1197615831 X:128690554-128690576 CTTTGGGTATATACCCAATAAGG + Intergenic
1197863817 X:130997392-130997414 CTGTGGATAAAACCCTATTATGG + Intergenic
1197958153 X:131975165-131975187 CTCTGGGTAGATACCCAGTATGG + Intergenic
1197989478 X:132302240-132302262 CTTTGGATAAATGTCTATTCAGG + Intergenic
1198011190 X:132556393-132556415 CTTTTGATAAATGCCTACTCAGG + Intergenic
1198148814 X:133887470-133887492 CTTTGGAGAAATATCTATTCAGG + Intronic
1198585100 X:138111672-138111694 CTTTGTATAAATACTCAGTAGGG - Intergenic
1198672683 X:139098362-139098384 CCTTGGGTATATACCCAGTAGGG - Intronic
1198955069 X:142120389-142120411 CTTTGGAGAAATACCTGTTCAGG + Intergenic
1199308954 X:146300114-146300136 CTTTGGATAAAGACCAAGCCTGG - Intergenic
1199363375 X:146947882-146947904 CTTTGGTTAAATACGTAGGATGG + Intergenic
1199490477 X:148393438-148393460 CTTTGGATAGGTACCTAGTAGGG - Intergenic
1199588841 X:149446638-149446660 CTGTGGCTATATACCCAGTAAGG + Intergenic
1200449462 Y:3306807-3306829 TTTTGGATATATACCCAGTAAGG - Intergenic
1200717258 Y:6562251-6562273 CTTTGGGTAGATACCCAGTAGGG - Intergenic
1201192257 Y:11454978-11455000 TTTTGGATATATATCCAGTAAGG + Intergenic
1201244439 Y:11989113-11989135 CTTTGGGTATATACCCAGTAAGG + Intergenic
1201364643 Y:13190172-13190194 CTTTTGGTATATACCCAGTAAGG + Intergenic
1201476287 Y:14385437-14385459 ATTTGGTTAAATACATAGAATGG - Intergenic
1201535356 Y:15041947-15041969 CTTGGGGTATATACCCAGTAAGG + Intergenic
1201535925 Y:15048209-15048231 CTTTGGCTATATACCCAGTAAGG + Intergenic