ID: 960608949

View in Genome Browser
Species Human (GRCh38)
Location 3:119537186-119537208
Sequence GAGACACATGAAGCTGTGGT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 378
Summary {0: 1, 1: 0, 2: 0, 3: 32, 4: 345}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960608946_960608949 19 Left 960608946 3:119537144-119537166 CCAGTTGAAGGTCTGATTCACTC 0: 1
1: 0
2: 0
3: 7
4: 87
Right 960608949 3:119537186-119537208 GAGACACATGAAGCTGTGGTTGG 0: 1
1: 0
2: 0
3: 32
4: 345

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960608949 Original CRISPR GAGACACATGAAGCTGTGGT TGG Exonic
900701065 1:4048935-4048957 GAGAGACAGGAAGGTGTGGTGGG - Intergenic
900863863 1:5253343-5253365 GAGATACAGGAATCTGAGGTCGG - Intergenic
901379652 1:8864410-8864432 GCGACTCAGGAAGCTGAGGTGGG - Intronic
901401149 1:9015833-9015855 GCCACTCAGGAAGCTGTGGTGGG - Intronic
901840126 1:11949114-11949136 GGGGCACATGAATCTGTGGCTGG - Intronic
902535640 1:17118127-17118149 GAGACACATGATGGGTTGGTGGG + Intronic
902822379 1:18951190-18951212 GAGAGGCATGGAGCTATGGTGGG + Intronic
903564923 1:24258036-24258058 GGGACAGATGCAGGTGTGGTAGG + Intergenic
904177423 1:28640445-28640467 GAGGCACATGTAACTGGGGTTGG + Intronic
906267273 1:44442252-44442274 GCTACTCATGAAGCTGAGGTGGG - Intronic
907071768 1:51541997-51542019 GATACACAAGAGGCTGAGGTGGG - Intergenic
907356119 1:53875401-53875423 GATACTCATGAAGATGAGGTGGG + Intronic
907402730 1:54234474-54234496 GCTACTCAGGAAGCTGTGGTGGG + Intronic
908598883 1:65718174-65718196 GAGCCACTTGGAGCTGTGGGTGG + Intergenic
909045888 1:70709263-70709285 GAAACTCATGAAGCTGTGAAAGG + Intergenic
910560328 1:88582781-88582803 GAGTCACCTGGAGCTGGGGTGGG - Intergenic
911536531 1:99106560-99106582 GAGCCACCTGAAGCTGGGGGTGG - Intergenic
912625793 1:111204032-111204054 GGGACACAGGAAGCCGTTGTGGG - Intronic
914004488 1:143720663-143720685 GAGGCATATGGAGCTGTGGCAGG - Intergenic
914517442 1:148385982-148386004 GAGGCGTATGGAGCTGTGGTGGG - Intergenic
914738535 1:150442539-150442561 GAGAGACTTGAAGGTGTGGAGGG + Intronic
916898633 1:169195321-169195343 GCGACTCAGGAAGCTGAGGTGGG - Intronic
918449782 1:184647191-184647213 GACACGCATGAAGCTGAGGTGGG + Intergenic
919523818 1:198622351-198622373 AAAAGACATGAAGCTGTAGTAGG - Intergenic
919837703 1:201587097-201587119 GCTACACAGGAAGCTGAGGTGGG + Intergenic
920527176 1:206675637-206675659 GATACACAAGAAACTGGGGTGGG + Intronic
920745032 1:208617916-208617938 GAGCCACATAAAGCTGGGGGTGG - Intergenic
921381484 1:214529203-214529225 GATACACAGGAAGCTGAGGTGGG + Intronic
921816351 1:219568493-219568515 AAGGCACATGAACCTGCGGTAGG - Intergenic
923238528 1:232058382-232058404 GACAAACAAGAAGCTGTGTTGGG + Intergenic
924619674 1:245649706-245649728 GAGACAAATGAAGAGGTAGTGGG - Intronic
1063299723 10:4840637-4840659 CAGCCACATGAAGCTGCTGTGGG + Intronic
1063877765 10:10497817-10497839 GTGAGACAGGAAGCTGTGGGAGG + Intergenic
1067329816 10:45304407-45304429 AAATCACATGAAGCTGTGGATGG - Exonic
1067909714 10:50333573-50333595 GAGATACCTGAGGCTGTGATGGG - Intronic
1068217391 10:53999971-53999993 GAGCCACCTGGAGCTGGGGTTGG - Intronic
1068471220 10:57466360-57466382 GATACCCAGGAAGCTGGGGTGGG - Intergenic
1068933660 10:62616163-62616185 GAGAATCATGAAGCTGAGGTGGG + Intronic
1070217199 10:74397647-74397669 GGGACTCAGGAAGCTGAGGTGGG - Intronic
1070597831 10:77845055-77845077 GTGAGACAGGAAGCTGTGGAGGG + Intronic
1071503205 10:86217953-86217975 GAGACAAATGCAGGTGGGGTAGG - Intronic
1072869019 10:99096914-99096936 GAGACAAATGCAGCATTGGTGGG + Intronic
1072965451 10:99968574-99968596 GCTACTCATGAAGCTGAGGTGGG + Intronic
1075084914 10:119408226-119408248 GCTACACAGGAAGCTGAGGTGGG + Intronic
1077023533 11:430140-430162 GGGACACATGAGGATGTCGTGGG + Exonic
1077094566 11:793829-793851 GAGACAGATGGAGCTGCAGTGGG - Intronic
1077178699 11:1202851-1202873 GGGCCACCTGAAGCTGTGGGAGG - Intergenic
1079401380 11:20108989-20109011 GAGACACAAGATGCTATCGTAGG + Intronic
1079860381 11:25662820-25662842 GTTACACAGGAGGCTGTGGTAGG - Intergenic
1084121953 11:67074653-67074675 GCCAGAAATGAAGCTGTGGTGGG + Intergenic
1084304575 11:68273142-68273164 GAGACACAGAAAGCTGAGATTGG + Intergenic
1084871671 11:72102848-72102870 AAGACACAGGAAGCTGGGGAAGG + Intronic
1085621374 11:78040385-78040407 GAGACACAGGAAGAAGTGGAGGG - Intronic
1086594539 11:88555119-88555141 GAGAAACTTGAAGCTGAGGGAGG - Intronic
1087201443 11:95347884-95347906 GAGACACCTAAAGCTGGGGGTGG - Intergenic
1088591693 11:111408906-111408928 GAGACACAAGGTGCTGTGGGAGG + Intronic
1091492403 12:944399-944421 GCTACTCAGGAAGCTGTGGTGGG + Intronic
1092180150 12:6441350-6441372 GAGACACTGGGAGCTGTGCTGGG + Intergenic
1092959779 12:13585229-13585251 CAGAGTCATGAAGCTGGGGTGGG + Intronic
1093025976 12:14245816-14245838 GATACACAGGAGGCTGAGGTGGG + Intergenic
1094671668 12:32576373-32576395 GAGACACAAGAAGCAGAGGCAGG - Exonic
1095273651 12:40253495-40253517 GATACTCAGGAAGCTGAGGTGGG - Intronic
1096301282 12:50430250-50430272 GCTACTCAAGAAGCTGTGGTGGG + Intronic
1096682698 12:53267486-53267508 GAGACAGCTGAATCTGTGTTTGG + Intergenic
1096748828 12:53745935-53745957 GAGAGGCAAGAAGCAGTGGTGGG + Intergenic
1098530703 12:71538402-71538424 GCTACACATGAGGCTGAGGTGGG + Intronic
1099882349 12:88481302-88481324 GAGCCACCTGGAGCTGTGGGTGG - Intergenic
1100240054 12:92702079-92702101 GCTACACAGGAAGCTGAGGTAGG + Intergenic
1100540564 12:95553320-95553342 GTTACACAGGAAGCTGAGGTGGG - Intergenic
1103383244 12:120511537-120511559 GAGACTCAGGAGGCTGAGGTGGG + Intronic
1104508730 12:129356751-129356773 GCTACTCATGAAGCTGAGGTGGG + Intronic
1106963953 13:35037709-35037731 GAGACACCTAAAGCTGGGGCTGG + Intronic
1108025472 13:46172550-46172572 CACACACAGGAAGCTGTGGCAGG + Intronic
1108328172 13:49355943-49355965 CTAACACCTGAAGCTGTGGTGGG + Intronic
1109590454 13:64473855-64473877 GAGACAAATTATGCTGGGGTTGG + Intergenic
1109711181 13:66162695-66162717 GCTACTCAGGAAGCTGTGGTGGG - Intergenic
1113745386 13:112741206-112741228 GAGGGACATGGAGCTGTAGTCGG + Intronic
1114089709 14:19273608-19273630 GAGACACCTAAAGCTGGGGCTGG - Intergenic
1114453298 14:22840076-22840098 GCTACTCAGGAAGCTGTGGTAGG - Intronic
1116079507 14:40155013-40155035 GAGCCACATGTAGCTGGGGCTGG - Intergenic
1116492841 14:45526677-45526699 GACAGAGATGAAGCTGTAGTAGG + Intergenic
1116861485 14:49999240-49999262 GGGACAGATGAAGCTGCAGTGGG - Intronic
1119139676 14:72255036-72255058 GAGACACAGCAGGCTGTGCTGGG + Intronic
1120091719 14:80340141-80340163 GAGAAACATGCAGCACTGGTAGG + Intronic
1121259257 14:92554082-92554104 GAAAGCCATGAAGCTGTGGATGG - Intronic
1121738171 14:96233365-96233387 GAGAATCATGGGGCTGTGGTGGG + Intronic
1122015363 14:98790488-98790510 GAGACACAAGAAGATGTCATTGG - Intergenic
1122770837 14:104096975-104096997 TAGACACAGGCAGCTGTGGGAGG + Intronic
1123698216 15:22894965-22894987 GATACTCATGAGGCTGAGGTGGG - Intronic
1123970377 15:25502891-25502913 GAAACACATGAAGCTGAACTAGG + Intergenic
1125422612 15:39519675-39519697 GAGACTGATAAAGCTGTGTTGGG - Intergenic
1125688336 15:41577201-41577223 GCTACTCAGGAAGCTGTGGTGGG + Intronic
1126597801 15:50399188-50399210 GATACTCAGGAGGCTGTGGTGGG + Intergenic
1127435173 15:58950246-58950268 GCGACACAGGAAGCTGAGGCAGG + Intronic
1128201003 15:65807938-65807960 GCTACACAGGAAGCTGAGGTGGG - Intronic
1128736334 15:70055988-70056010 GAGTCACCTGGAGCTGTGGTGGG - Intronic
1129179896 15:73867464-73867486 GAGACAGACGAAGCTGGGGCTGG - Intergenic
1129786831 15:78315278-78315300 GAGACACAGAAGGCTGTGGATGG - Intergenic
1130112373 15:80976440-80976462 AAGACTCATGCAGCTGGGGTTGG + Exonic
1132597875 16:761508-761530 GGGTCACATGGAGCTGGGGTGGG + Intronic
1132713237 16:1278451-1278473 GAGGCACATGTAGTTGGGGTGGG + Intergenic
1132923519 16:2413955-2413977 GCTACACAGGAAGCTGAGGTGGG - Intergenic
1133247615 16:4459666-4459688 GCTACTCAGGAAGCTGTGGTAGG - Intergenic
1134097328 16:11427055-11427077 AACACACATGAAGCAGTGCTTGG + Intronic
1134999801 16:18767248-18767270 GCTACACAAGAAGCTGAGGTGGG + Intergenic
1135843555 16:25897672-25897694 GAGAGAGAGGAAGCTGTGGGTGG - Intronic
1136356014 16:29745218-29745240 GCTACACAGGAAGCTGAGGTGGG + Intronic
1136588914 16:31205341-31205363 GCTACACAGGAAGCTGAGGTGGG - Intergenic
1137662096 16:50216764-50216786 GATACACATAAGGCTGAGGTGGG - Intronic
1139310911 16:66027286-66027308 GAGCCACATGTGGCTGTGGCTGG - Intergenic
1143990180 17:10952504-10952526 AAAACACATGATCCTGTGGTGGG + Intergenic
1144171114 17:12660900-12660922 GCTACACAGGAAGCTGAGGTGGG - Intergenic
1144342481 17:14321378-14321400 GAGATACATGAAGCTGCGCCAGG - Intronic
1144673172 17:17144313-17144335 GTTACACATCAATCTGTGGTTGG - Intronic
1147399083 17:40168384-40168406 GATACAGATGAGGCGGTGGTGGG - Exonic
1147627922 17:41911702-41911724 GATACTCAGGAAGCTGAGGTGGG + Intronic
1147676862 17:42212907-42212929 GATACACAAGAAACTGTGTTAGG - Intronic
1148906751 17:50917251-50917273 GGGGCACAGGAAGCTGTGGCGGG - Intergenic
1148953602 17:51335630-51335652 GGGACAGATGAAGATGTGGCGGG + Intergenic
1149745094 17:59089140-59089162 GCTACCCATGAAGCTGAGGTAGG + Intronic
1150485521 17:65540725-65540747 GAGAAACAGCAAGCTGAGGTTGG - Intronic
1150647968 17:66991713-66991735 GAGAATCATGAACATGTGGTTGG - Intronic
1150684267 17:67307825-67307847 GCTACACAAGAAGCTGAGGTGGG + Intergenic
1150828975 17:68501565-68501587 GCTACACAGGAAGCTGAGGTGGG - Intergenic
1152503950 17:80734647-80734669 GAAACACCTGCAGATGTGGTGGG - Intronic
1152855273 17:82662122-82662144 GTGTCACATGCACCTGTGGTCGG + Intronic
1154133576 18:11757319-11757341 CAGACACACGAAGCTTTGGAGGG + Intronic
1155686845 18:28563979-28564001 GAGATACAAGAAGTTGTAGTTGG + Intergenic
1156162979 18:34382674-34382696 GAGGGACATGAAGCTGAGGCAGG - Intergenic
1159019102 18:63128290-63128312 GAGCCACACGAAGCGGTGCTTGG + Exonic
1159086095 18:63793614-63793636 GCGACTCAGGAAGCTGAGGTGGG - Intronic
1159648500 18:70949045-70949067 GAGACTCATAAAGCTGTGTTAGG + Intergenic
1161099859 19:2416247-2416269 GAGACTCATAAAGCTGTAGGGGG + Intronic
1161225827 19:3145279-3145301 GCTACTCATGAAGCTGAGGTAGG - Intronic
1161805180 19:6439275-6439297 GATACTCAGGAGGCTGTGGTGGG + Intronic
1161903662 19:7138616-7138638 GTGACTCAGGAAGCTGAGGTGGG - Intronic
1162899995 19:13789330-13789352 GCTACTCAGGAAGCTGTGGTGGG - Intergenic
1162902525 19:13803691-13803713 GCTACACAGGAAGCTGAGGTAGG + Intronic
1165059562 19:33198488-33198510 CAGAGTCATGGAGCTGTGGTGGG - Intronic
1165177871 19:33943277-33943299 GAGGCACTGGGAGCTGTGGTGGG - Intergenic
1165807909 19:38592986-38593008 GATACTCAGGAAGCTGAGGTGGG + Intronic
1166081594 19:40446992-40447014 GATACTCAGGAAGCTGAGGTGGG - Intergenic
1166089344 19:40498003-40498025 GAGACACTTGAAGATGGGGTTGG - Intronic
1166961487 19:46498831-46498853 GATACTCAGGAAGCTGAGGTAGG + Intronic
1167908390 19:52681171-52681193 GCTACACAGGAAGCTGAGGTAGG + Intronic
1168004832 19:53478279-53478301 GCTACACAGGAAGCTGAGGTAGG - Intronic
1168462921 19:56575717-56575739 GCTACTCAAGAAGCTGTGGTGGG - Intronic
925189450 2:1871069-1871091 GAGACAGAAGAAGCTGAGGAGGG + Intronic
925305942 2:2848583-2848605 GAGACACATGGACTTGTGCTGGG - Intergenic
925770877 2:7282132-7282154 GAGACCCATGTTGCTGTGGCTGG + Intergenic
926229933 2:10994662-10994684 GAGAAATATGAAGCTGGGGAGGG - Intergenic
926288326 2:11508353-11508375 GGGACACATGAGGCTGGCGTTGG + Intergenic
926758150 2:16252403-16252425 GAGCCACAGGGTGCTGTGGTTGG + Intergenic
927777259 2:25911888-25911910 GACACTCAGGAGGCTGTGGTGGG - Intergenic
927825487 2:26306702-26306724 GATACTCAGGAAGCTGAGGTGGG - Intergenic
928775909 2:34763255-34763277 AAGACACCTGAAGCAGTGATGGG - Intergenic
929510181 2:42560351-42560373 AAAACAAATCAAGCTGTGGTTGG + Intronic
929987379 2:46748295-46748317 GCGACTCATGAGGCTGAGGTGGG - Intronic
930970298 2:57386591-57386613 GAGCCACCTGGAGCTGTGGGTGG - Intergenic
931200480 2:60092799-60092821 GAGAGAAATGATGCTGTGGGAGG - Intergenic
931343708 2:61426830-61426852 GAGCCACCTAAAGCTGGGGTTGG - Intronic
931367229 2:61629425-61629447 GATACTCATGAAGCTGGGGTGGG - Intergenic
932393541 2:71420172-71420194 GCTACACAGGAAGCTGAGGTGGG - Intronic
932544494 2:72693636-72693658 GAGATACATCAAGGTTTGGTCGG + Intronic
933785038 2:85832266-85832288 GCTACACAGGAGGCTGTGGTGGG + Intergenic
935411670 2:102770950-102770972 GAGGCACATCAACCTGTTGTAGG + Intronic
935576418 2:104716301-104716323 GAGTCACCTGAAGCTGCGGGTGG - Intergenic
935576467 2:104716799-104716821 GAGCCACCTGAAGCTGGGGGTGG + Intergenic
936246853 2:110836101-110836123 GAGACCCAGTGAGCTGTGGTGGG + Intronic
937411872 2:121683628-121683650 GCTACTCATGAAGCTGAGGTGGG - Intergenic
937872223 2:126794016-126794038 GAGCATCATGAAGCTGTGGCAGG + Intergenic
937920477 2:127125347-127125369 GATACTCAGGAAGCTGAGGTTGG + Intergenic
939044370 2:137232617-137232639 GAGATACATGCTGCAGTGGTGGG + Intronic
940302712 2:152192453-152192475 GACACACAGGAAGCTGAGGTGGG - Intergenic
942015017 2:171804794-171804816 GCTACTCATGAAGCTGAGGTGGG + Intronic
942767416 2:179473110-179473132 GAGACACATTAACCAGTGGAAGG + Intronic
943547684 2:189301073-189301095 GCTACTCAGGAAGCTGTGGTGGG + Intergenic
945053553 2:205848614-205848636 GAAAAAGATGATGCTGTGGTTGG + Intergenic
945294546 2:208157748-208157770 GCTACACAGGAGGCTGTGGTGGG - Intergenic
945607702 2:211956943-211956965 TAGACACAGGAATCTGAGGTGGG - Intronic
946895195 2:224317351-224317373 GCTACTCATGAAGCTGAGGTGGG + Intergenic
947028670 2:225768143-225768165 GTGGCACATGACCCTGTGGTAGG - Intergenic
947763326 2:232619782-232619804 GAGACTCAGGAGGCTGAGGTGGG + Intronic
948410603 2:237756938-237756960 GTGACACAGGAAGCTGAGGTTGG + Intronic
948504232 2:238417348-238417370 GAGACTCAAGAGGCTGAGGTGGG - Intergenic
948511069 2:238465707-238465729 GAGACACAGCTGGCTGTGGTGGG + Intergenic
1170863986 20:20137129-20137151 GAGCCACCTGAAGCTGGGGGAGG + Intronic
1171029423 20:21663924-21663946 GAGACAGATGCAGCTGGGCTGGG + Intergenic
1171777831 20:29387378-29387400 GAGACATATGGAGCTGGGGTTGG + Intergenic
1171819593 20:29822690-29822712 GAGACATGTGAAGCTGGGGTTGG + Intergenic
1171898230 20:30830492-30830514 GAGACATGTGAAGCTGGGGTTGG - Intergenic
1172523999 20:35586611-35586633 GAGACTCAGGAGGCTGAGGTGGG - Intergenic
1172790172 20:37498522-37498544 GAGATACATAAAACTGTGGAGGG + Intronic
1172953691 20:38739794-38739816 GCTACACAGGAAGCTGGGGTGGG - Intergenic
1173224663 20:41155244-41155266 AACACACATGAATCTGAGGTTGG + Intronic
1174328678 20:49800181-49800203 CAAACACATGAAGATGAGGTTGG + Intergenic
1175363201 20:58431348-58431370 CAGAACCATGAAGCTCTGGTTGG + Intronic
1175646177 20:60673793-60673815 GAGAGCCATCAAGCTGTGGGAGG - Intergenic
1175790601 20:61737876-61737898 CAGAGACAGGAGGCTGTGGTTGG + Intronic
1176133917 20:63511086-63511108 GCTACTCAGGAAGCTGTGGTGGG - Intergenic
1176159496 20:63641209-63641231 GAGAAGCATGAAGCTGGGGGCGG + Exonic
1177798628 21:25805771-25805793 GTGACACAGGAGGCTGAGGTGGG - Intergenic
1179232181 21:39514471-39514493 GCGACTCAAGAAGCTGAGGTGGG - Intronic
1179826749 21:43970384-43970406 GTGAAACATGAAGGTGTGTTGGG - Intronic
1180323589 22:11347381-11347403 GAGACATGTGAAGCTGGGGTTGG + Intergenic
1180490995 22:15848739-15848761 GAGACACCTAAAGCTGGGGCTGG + Intergenic
1181539363 22:23565309-23565331 GAGATGCATGAGGCTGTGGCTGG + Intergenic
1181779004 22:25179180-25179202 GAGAAGCATGAAGCTGGGGGCGG + Intronic
1185013234 22:48328110-48328132 GAGAGACAGGAGGCTGTGCTGGG - Intergenic
949945639 3:9187642-9187664 AACACAGATGAAGCTGTGGCAGG - Intronic
951623440 3:24632884-24632906 GCTACTCATGAAGCTGAGGTGGG - Intergenic
952365618 3:32672447-32672469 GCTACACAGGAAGCTGAGGTGGG - Intergenic
953742312 3:45548195-45548217 GAGGCACATCCAGCTGGGGTTGG - Exonic
953877966 3:46677056-46677078 GAGAGAGATGGAGCTGAGGTAGG + Intronic
953997514 3:47531556-47531578 GAGACTCAGGAGGCTGAGGTGGG - Intergenic
954052520 3:47992537-47992559 GCTACACAGGAAGCTGAGGTAGG - Intronic
954184480 3:48906265-48906287 GATACTCATGAGGCTGAGGTGGG + Intergenic
954727111 3:52621932-52621954 GCTACACATGAGGCTGAGGTGGG + Intronic
954822551 3:53343356-53343378 GAGACGCAAGAAACTGTGTTTGG - Intronic
957087356 3:75693267-75693289 GAGACATACGGAGCTGGGGTCGG - Intergenic
957133926 3:76260199-76260221 GAGCCACATGAACTTGTGGATGG + Intronic
958713653 3:97750746-97750768 GAGAAGGATTAAGCTGTGGTAGG - Intronic
958840088 3:99192522-99192544 GAGCCACCTGGAGCTGGGGTTGG - Intergenic
960079797 3:113529352-113529374 GAGGCACAAGAAGCCTTGGTGGG + Intergenic
960140507 3:114147729-114147751 GATACTCAGGAAGCTGAGGTAGG - Intronic
960397057 3:117150852-117150874 AATACACAGGAAGCTGTGGCAGG - Intergenic
960608949 3:119537186-119537208 GAGACACATGAAGCTGTGGTTGG + Exonic
960709527 3:120513460-120513482 GATACTCAGGAAGCTGAGGTGGG + Intergenic
963196161 3:142532728-142532750 AATACACCTGAAGTTGTGGTAGG - Intronic
964271505 3:154961289-154961311 GACACACATGATGCTCTGGAAGG + Intergenic
964610233 3:158605939-158605961 GAGACAGATGAAGCTGTTTGTGG - Exonic
964698208 3:159533958-159533980 TCTTCACATGAAGCTGTGGTTGG - Intronic
965576963 3:170227309-170227331 CAGGCACATGATGCTGTCGTAGG + Intronic
966819260 3:183912039-183912061 GAGACTCAGGAGGCTGTGGCAGG - Intergenic
967868018 3:194206168-194206190 AAGAGACATGAAAATGTGGTGGG - Intergenic
968995497 4:3942674-3942696 GTGACCCGGGAAGCTGTGGTTGG + Intergenic
969105244 4:4802623-4802645 GAGACACAGGAGGATCTGGTGGG - Intergenic
970931433 4:21516865-21516887 TAGAAACATGAAGCTGTGTCTGG + Intronic
971075659 4:23145917-23145939 GAGACAGATGAAAATGTGGGAGG + Intergenic
972468658 4:39383465-39383487 GAGACACGTGGAGCTGGGGGTGG + Intergenic
972617493 4:40714110-40714132 GGGACACATCAAACTGTGGCAGG + Intergenic
972885050 4:43475730-43475752 GAGCCACATAAAGCTGGGGGTGG + Intergenic
972912089 4:43829978-43830000 GCTACACAGGAAGCTGTGGCAGG + Intergenic
977165685 4:93694008-93694030 GAGACACATGAAGCACTGGAAGG + Intronic
977762627 4:100758298-100758320 GAGAAAGATGCAGCTGTAGTTGG + Intronic
979111874 4:116768745-116768767 GAGACACAGGAAAATGAGGTAGG - Intergenic
980624560 4:135357586-135357608 GAGACACATTTTTCTGTGGTAGG - Intergenic
981329316 4:143489311-143489333 GAGCCACATGAAGCTGGGGGTGG - Intergenic
981739410 4:147986273-147986295 GAGACACATGAAGCTCATGGAGG + Intronic
982185327 4:152790842-152790864 GTGACTCAGGAAGCTGAGGTAGG - Intronic
983017600 4:162633242-162633264 GATACACAGGAGGCTGAGGTAGG + Intergenic
984957945 4:185064531-185064553 GCTACTCAGGAAGCTGTGGTAGG - Intergenic
985546309 5:510924-510946 GAGACACAGGAAGACCTGGTGGG - Intronic
986012542 5:3729100-3729122 GAGTAACATGAAGCTGTCATAGG + Intergenic
989616092 5:43338177-43338199 GAGACAGATGAAATTCTGGTTGG - Intergenic
990388508 5:55293041-55293063 GAGACACAAGAAGCTGTTACTGG - Intronic
990556296 5:56939835-56939857 GATGCACATACAGCTGTGGTAGG + Intronic
992402409 5:76423747-76423769 AAGGCACATGAAGCCATGGTGGG + Intronic
992693564 5:79261919-79261941 AAGAAACATGAAGCAGAGGTTGG - Intronic
996087321 5:119318398-119318420 GCGACACAGGAAGCTGACGTGGG - Intronic
996371869 5:122761995-122762017 GATACTCAGGAAGCTGAGGTGGG - Intergenic
997197353 5:131988910-131988932 GAGACACATGAGGCGGGGGTGGG + Intronic
998683101 5:144492828-144492850 GCTACACATGAGGCTGAGGTGGG + Intergenic
998685661 5:144521457-144521479 GAGACATATGAAGATGTAGAAGG - Intergenic
998843838 5:146284893-146284915 GAGATATAAGAAGCTGTGTTAGG + Intronic
999406478 5:151311721-151311743 GAGCCACATGAAGCTGGGGGTGG + Intergenic
1000292261 5:159881487-159881509 GACAGACATGAAGCTGTGAGGGG - Intergenic
1002879719 6:1240180-1240202 GAGATACAAGAAGCTGTGTGGGG + Intergenic
1004349315 6:14877334-14877356 GAGACACATCAAGCTTTTGTAGG - Intergenic
1004401926 6:15296770-15296792 CAGACACATTAAGGTGTTGTAGG + Intronic
1004540052 6:16541283-16541305 GTGAGACTTGAAGGTGTGGTTGG - Intronic
1005354050 6:24965247-24965269 GCTACTCATGAAGCTGTGGTGGG - Intronic
1005375006 6:25173065-25173087 GAGACACAGGAAGCTCAGTTGGG - Intergenic
1007252940 6:40508702-40508724 AAGACACATAAAGCTGTGCTTGG + Intronic
1008880878 6:56378850-56378872 GAGCCACCTGAAGCTGGGGGTGG - Intronic
1009353047 6:62706942-62706964 GAGACACCCAAAGCTGGGGTTGG + Intergenic
1009771130 6:68144467-68144489 GAGCCACCTGAAGCTGGGGGCGG + Intergenic
1010561230 6:77353254-77353276 GAGCCACCTAAAGCTGGGGTTGG + Intergenic
1011850479 6:91621590-91621612 CAGCCACATTCAGCTGTGGTTGG - Intergenic
1014867803 6:126553232-126553254 AATACACATCAAGCTGTTGTAGG - Intergenic
1015871167 6:137778028-137778050 GAGACACATGAACCCTTAGTTGG + Intergenic
1016463184 6:144300199-144300221 GCTACTCATGAAGCTGAGGTGGG - Intronic
1016579915 6:145617828-145617850 GATACTCAAGAAGCTGAGGTGGG + Intronic
1017434500 6:154403665-154403687 AAGAAAGATGAAGCTGTGGAGGG + Exonic
1017457106 6:154611285-154611307 TAGACATATGCAGCTGAGGTTGG - Intergenic
1019497686 7:1348034-1348056 GGGACACAGGAAGGTGGGGTGGG + Intergenic
1019624400 7:2008695-2008717 GACACACAGGAAGCTCAGGTGGG + Intronic
1019955645 7:4412167-4412189 GCTACTCAAGAAGCTGTGGTGGG + Intergenic
1020408366 7:7863728-7863750 AAGATACATAAAGCTGTGGGTGG + Intronic
1021653440 7:22853354-22853376 GAGACACACGAAAATGTGGCGGG - Intergenic
1022348364 7:29539844-29539866 GAGCCACCTGAAGCTGGGGGTGG - Intergenic
1022511591 7:30938315-30938337 GAGACTCAGGAAGCTGAGGTGGG - Intergenic
1023052911 7:36268518-36268540 GAGGGACGGGAAGCTGTGGTTGG - Intronic
1023585534 7:41725879-41725901 CAGACACATGACACTGTAGTTGG - Intergenic
1025200778 7:56960111-56960133 GAGCCTCAGGAAGCTGAGGTGGG + Intergenic
1025671165 7:63616821-63616843 GAGCCTCAGGAAGCTGAGGTGGG - Intergenic
1027538149 7:79432964-79432986 GAGACAGAAGAAGGTGAGGTTGG + Intronic
1027793005 7:82656980-82657002 GAGACGCCGGAAGCTCTGGTTGG - Intergenic
1027913215 7:84280007-84280029 GATACTCAGGAAGCTGAGGTGGG - Intronic
1028001494 7:85502754-85502776 GAGCCACCTGAAACTGGGGTTGG - Intergenic
1029426218 7:100495601-100495623 GATACTCAGGAAGCTGAGGTGGG + Intergenic
1029600559 7:101560940-101560962 AAGACAGATGAAGCTCTGGCAGG - Intergenic
1030127907 7:106171850-106171872 CAGACAGATGAGGCAGTGGTAGG + Intergenic
1030206888 7:106959899-106959921 GAGACTCAGGAGGCTGTGGGTGG - Intergenic
1031150133 7:118044701-118044723 GACACCCATGAAGTTGTAGTTGG + Intergenic
1032025123 7:128435231-128435253 GAGAACCCTGAAGCTGTGGCTGG + Intergenic
1032556064 7:132836096-132836118 CAGACACATGAATTTGTGATTGG - Intronic
1032590179 7:133184795-133184817 TAGACACAAGAAGCTGTCTTAGG + Intergenic
1033867673 7:145712990-145713012 GAAACACATGAAGCTGGGGATGG + Intergenic
1034262890 7:149767796-149767818 GCGACTCAGGAAGCTGGGGTGGG - Intronic
1034391705 7:150792284-150792306 GAAACACAGTCAGCTGTGGTGGG - Intronic
1034446542 7:151116718-151116740 GTGACACAGGCAGCAGTGGTTGG + Intronic
1034491472 7:151395337-151395359 GCGACACGTGAATCTGGGGTGGG - Intronic
1034974195 7:155438449-155438471 GAGACAACTGGAGCTGTGGGTGG - Intergenic
1034987993 7:155529331-155529353 GAGGCATCTGAAGCTGTGATGGG - Intronic
1035547533 8:495119-495141 GATACTCAGGAAGCTGAGGTGGG + Intronic
1038394903 8:27239408-27239430 GAGAAACATGAGGCCGGGGTTGG - Intronic
1040881137 8:52205895-52205917 GAGAATTATGAAGATGTGGTAGG + Intronic
1041290308 8:56302301-56302323 CAGAGACTTGAAGCTGTGGGAGG - Intronic
1047690746 8:127351975-127351997 GTGACAGCTGAAGCTGGGGTTGG + Intergenic
1048423145 8:134297046-134297068 GAGACACATCTACCTGTGTTTGG - Intergenic
1048989020 8:139750523-139750545 AAGACCCATGGAGCTGTGCTGGG + Intronic
1049561542 8:143314244-143314266 GGGACACATGGAGCCGTGGGAGG - Intronic
1049644182 8:143728711-143728733 GGACCACATGAAGCTGTGGGGGG + Exonic
1049794340 8:144489581-144489603 CAGCCACATGAAGCTCTGGGAGG - Intronic
1050052071 9:1613042-1613064 GAAACTCAGGAAGCTGAGGTGGG - Intergenic
1052254382 9:26437122-26437144 AAGACACAAGCAGCTGTGGATGG + Intergenic
1052428105 9:28330922-28330944 AAGAGACATGAAGATCTGGTAGG + Intronic
1052747456 9:32454301-32454323 GAGAAACATTGAGCTATGGTTGG + Exonic
1053412505 9:37924909-37924931 GAGGAAGATGAGGCTGTGGTGGG - Intronic
1053750803 9:41252289-41252311 GAGACATGTGGAGCTGGGGTTGG - Intergenic
1054256318 9:62816632-62816654 GAGACATGTGGAGCTGGGGTTGG - Intergenic
1054334989 9:63798981-63799003 GAGACATGTGGAGCTGGGGTTGG + Intergenic
1055007270 9:71522553-71522575 TATATACATGAAGCTGTTGTTGG - Intergenic
1056957458 9:91093492-91093514 GAGCCACCTGAAGCTGGGGCAGG - Intergenic
1057131625 9:92657991-92658013 GGGACACATGCAGCTGAGCTGGG - Intronic
1058354532 9:104067733-104067755 GAAACATATGAATCTGTAGTAGG - Intergenic
1058935985 9:109769964-109769986 GAGTCAGAGGAAGCTTTGGTTGG + Intronic
1059556887 9:115290386-115290408 GATACAAATGATGATGTGGTGGG - Intronic
1059571850 9:115446337-115446359 GAGACTCAGGAGGCTGAGGTGGG - Intergenic
1060776235 9:126376812-126376834 GATACACCTGAAACTGGGGTGGG + Intronic
1061132572 9:128716184-128716206 GCTACTCGTGAAGCTGTGGTGGG + Intronic
1061275505 9:129567817-129567839 GAGATGCATGAGGCTGTGGCTGG + Intergenic
1061383933 9:130277050-130277072 GGGACACATGAAGCTGGGCGAGG + Intergenic
1203371264 Un_KI270442v1:307956-307978 GAGACATGTGAAGCTGGGGTTGG + Intergenic
1185465636 X:352904-352926 GGGTCACATGAACCAGTGGTGGG + Intronic
1185761553 X:2692629-2692651 GAGAAACAGGAAGCTCTGCTTGG - Intronic
1185937558 X:4275814-4275836 GATACTCAGGAAGCTGAGGTGGG + Intergenic
1187339567 X:18409192-18409214 GATACTCGTGAGGCTGTGGTGGG - Intergenic
1187440067 X:19310314-19310336 GTTACTCATGAAGCTGAGGTGGG + Intergenic
1187651947 X:21419767-21419789 GAGCCACCTGAAGCTGTGGGTGG + Intronic
1189069446 X:37847968-37847990 GAGAAAACTGAAGCTGTGGGAGG - Intronic
1189426963 X:40910330-40910352 GGAACAAATGAAGGTGTGGTAGG + Intergenic
1190919453 X:54838654-54838676 GAGCCACCTGAAGCTGGGGGTGG + Intergenic
1191596379 X:62948555-62948577 GACACATATAAAGCAGTGGTTGG + Intergenic
1191671455 X:63752201-63752223 TAGACACTTGAAGTTGTGGGGGG - Intronic
1193078771 X:77383421-77383443 GAGCCACCTGAAGCTGGGGGTGG - Intergenic
1193555683 X:82951269-82951291 GAGTCACCTGGAGCTGGGGTTGG + Intergenic
1193585179 X:83312036-83312058 GAGCCATCTGAAGCTGGGGTTGG - Intergenic
1193697156 X:84723448-84723470 GAGACACCTGAAGCTGCAGTTGG + Intergenic
1195594401 X:106672505-106672527 GAGCCACTTGAAGCTGAGGCTGG + Intronic
1195971395 X:110477658-110477680 GAGCCACCTGAAGCTGGGGGTGG + Intergenic
1196837694 X:119828558-119828580 GCTACTCAAGAAGCTGTGGTGGG + Intergenic
1198472157 X:136957233-136957255 GACACCCAGGAAGCTGAGGTGGG - Intergenic
1198853725 X:140993832-140993854 GAGACACATCAAGTTGTGAGGGG - Intergenic
1199274738 X:145927257-145927279 GAGACACCTGATGCTGGGGGTGG - Intergenic
1199280996 X:145999097-145999119 GCTACACAGGAGGCTGTGGTGGG + Intergenic
1199441083 X:147867980-147868002 GAGCCACTTGAAGCTGGGGGTGG - Intergenic
1200370646 X:155720571-155720593 GAGCCACCTGAAGCTGGGGGTGG - Intergenic
1200532997 Y:4359893-4359915 GAGACACAGGAAGAGGTGGGGGG + Intergenic
1201067081 Y:10107128-10107150 GAGACATGTGAAGCTGGGGCTGG - Intergenic
1201705662 Y:16933924-16933946 GAAACACAGGAGGCTGAGGTGGG - Intergenic
1201861320 Y:18600527-18600549 AAGACATATGAAGCTGTAGTTGG - Intergenic
1201872003 Y:18719853-18719875 AAGACATATGAAGCTGTAGTTGG + Intergenic
1202164814 Y:21976216-21976238 AAGACACATGAAGCTGTAGCTGG + Intergenic
1202226542 Y:22610158-22610180 AAGACACATGAAGCTGTAGCTGG - Intergenic
1202316575 Y:23585504-23585526 AAGACACATGAAGCTGTAGCTGG + Intergenic
1202554189 Y:26084554-26084576 AAGACACATGAAGCTGTAGCTGG - Intergenic