ID: 960614397

View in Genome Browser
Species Human (GRCh38)
Location 3:119583666-119583688
Sequence CTGTGAAAGGCCAAGGTGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 39142
Summary {0: 2, 1: 5, 2: 283, 3: 4156, 4: 34696}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960614391_960614397 11 Left 960614391 3:119583632-119583654 CCAAGTGCTGTGGCTTACACCTG 0: 1
1: 62
2: 1524
3: 14929
4: 54909
Right 960614397 3:119583666-119583688 CTGTGAAAGGCCAAGGTGAGAGG 0: 2
1: 5
2: 283
3: 4156
4: 34696
960614392_960614397 -8 Left 960614392 3:119583651-119583673 CCTGTAATCCCAACACTGTGAAA 0: 3
1: 119
2: 3544
3: 51975
4: 351913
Right 960614397 3:119583666-119583688 CTGTGAAAGGCCAAGGTGAGAGG 0: 2
1: 5
2: 283
3: 4156
4: 34696

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960614397 Original CRISPR CTGTGAAAGGCCAAGGTGAG AGG Intronic
Too many off-targets to display for this crispr