ID: 960615978

View in Genome Browser
Species Human (GRCh38)
Location 3:119596403-119596425
Sequence AGCCAGGAAGCGCCTTTAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 95}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960615978_960615980 4 Left 960615978 3:119596403-119596425 CCATCTAAAGGCGCTTCCTGGCT 0: 1
1: 0
2: 2
3: 8
4: 95
Right 960615980 3:119596430-119596452 TAGTACCTCTTATTCTTTACAGG 0: 1
1: 0
2: 0
3: 9
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960615978 Original CRISPR AGCCAGGAAGCGCCTTTAGA TGG (reversed) Intergenic
900603252 1:3512163-3512185 TGCCAGGAAGGGCCTTTGCATGG + Intronic
911510139 1:98801275-98801297 AGCCAGGAAGAGCCAGGAGAAGG + Intergenic
913596094 1:120378638-120378660 AGACAGGCAGGGCCTTTAGTAGG + Intergenic
914091185 1:144500338-144500360 AGACAGGCAGGGCCTTTAGTAGG - Intergenic
914307419 1:146433857-146433879 AGACAGGCAGGGCCTTTAGTAGG + Intergenic
914594688 1:149139274-149139296 AGACAGGCAGGGCCTTTAGTAGG - Intergenic
918914816 1:190621617-190621639 AGCCAGGAAGAGCCTTTACCAGG - Intergenic
921554656 1:216583539-216583561 AGCCATGAAGCCCCTGTAGAGGG - Intronic
923003803 1:230029122-230029144 AGCCCTGAAGCGGCCTTAGAAGG - Intergenic
1065351085 10:24796361-24796383 AACCTGGAAGCTCATTTAGAAGG - Intergenic
1066361671 10:34737596-34737618 AGAGAGGAGGTGCCTTTAGAAGG + Intronic
1070575494 10:77674153-77674175 AGCCAGTAACCCTCTTTAGAAGG - Intergenic
1074493867 10:113961656-113961678 AGACAGGAAGCTCCTTTCCAGGG - Intergenic
1074583552 10:114744795-114744817 AGCTAGGAAGAGCATGTAGATGG - Intergenic
1080372828 11:31672140-31672162 AGCCAGGGAGTGTCTTTACAGGG - Intronic
1081620852 11:44618533-44618555 AGCCCGGAAGCCCCTACAGAGGG - Intronic
1082757431 11:57091982-57092004 AGCCTGGATGCTCCTGTAGAAGG + Intergenic
1083031750 11:59598886-59598908 AGCCAGGATGCACCCTTAAATGG + Intronic
1083159926 11:60848553-60848575 AGCCAGGAAGCCCCTGTAAAGGG + Intronic
1087168953 11:95031080-95031102 AGCCAGGAGGTGCCTCTTGATGG + Intergenic
1089472434 11:118731675-118731697 AGCCAGGAAGAGCCAGGAGAAGG + Intergenic
1089990263 11:122852883-122852905 AGCTAAGAAGTGCCTTTATAAGG + Intronic
1090808141 11:130215657-130215679 AGCCAGGAGGTGCCTGCAGAGGG + Intergenic
1098152325 12:67559650-67559672 AGAAAGGAAGCCCCTTAAGAAGG + Intergenic
1103713090 12:122927705-122927727 GGCCAGGAAGCCCCTTGCGAGGG + Intronic
1104722114 12:131050276-131050298 AGCCAGGAAGTGCTGTTAGTTGG + Intronic
1104976278 12:132553340-132553362 AGCCCAGAAGGGCCTTGAGAGGG + Intronic
1105010040 12:132749547-132749569 ATCCAGGAAGCACCTGTATAAGG + Intronic
1106377645 13:29204518-29204540 AGCCAGGAGGAGCCTTGGGAAGG + Intronic
1106721001 13:32434521-32434543 AGTCAGGAGGAGCCTTAAGATGG + Intronic
1108346692 13:49553338-49553360 AGGCAGGAAGAACCTTTAGGAGG + Intronic
1109352728 13:61205840-61205862 AGCCAGGACGAGCCAGTAGAAGG - Intergenic
1114570114 14:23660918-23660940 AGCCAGGACGCGCCATCACAGGG - Intergenic
1121461779 14:94085233-94085255 AGCCAGGTAGGGCATCTAGAAGG + Intronic
1121522535 14:94596092-94596114 ACCCAGGAATAGCCTTTGGATGG - Intronic
1128514440 15:68333665-68333687 AGGCTGGAAGGCCCTTTAGAAGG - Intronic
1129246653 15:74283087-74283109 AGCCTGAAAGTGCCTTTACAAGG + Intronic
1130048263 15:80462656-80462678 GGCCAGGAAGCCCCTTGATAAGG - Intronic
1131447344 15:92511516-92511538 AGCCAGGATGAGCCTGGAGAAGG - Intergenic
1131823449 15:96295970-96295992 AGCGAGGAAGAGCCATTAGCAGG - Intergenic
1133421009 16:5646929-5646951 AGCCAGGAAGACCCTCTTGATGG + Intergenic
1136370601 16:29833774-29833796 AATCAAGCAGCGCCTTTAGATGG - Exonic
1136588521 16:31202832-31202854 AGTAAGGAAGCGCCTTTTGCTGG - Exonic
1137614945 16:49840902-49840924 GGCCAGGAAGCCCCTTGAGAAGG + Intronic
1139281652 16:65775705-65775727 ATCCAGGAGGCGCCTTTTGCAGG + Intergenic
1140144258 16:72290182-72290204 AGGCAGGAAGGCCCTTTAGCAGG - Intergenic
1144253917 17:13446748-13446770 ATCGAGGAAGCTCCTTCAGAAGG - Intergenic
1146470366 17:33119567-33119589 AGCAAGGAAGCTGCTGTAGATGG + Intronic
1148643493 17:49205602-49205624 AGACAGGAAAGGCCTTTAGAAGG - Intronic
1152521376 17:80858690-80858712 CGCCAGGAAGGGCCTTGAGGGGG + Intronic
1152931583 17:83112930-83112952 AACCAGGAAGGGCCTTTGCACGG - Intergenic
1153685521 18:7541039-7541061 AGCCAGCAAGCCCCTTAGGAAGG - Intergenic
1155239439 18:23851495-23851517 ATCCTGGAGGCACCTTTAGAGGG + Intronic
1156471751 18:37381467-37381489 AGGCAGGAAGCTCCTTGAGGTGG + Intronic
1157489631 18:48113712-48113734 AGCCGGAAAGCTCCTTGAGATGG - Intronic
1167077703 19:47259319-47259341 AGCCAGGGAGAGCCTTGAGCAGG + Intronic
1168527465 19:57100270-57100292 GGCCAGGGAGCCCCTTTAGATGG - Intergenic
925604776 2:5647983-5648005 AGACAGGCAGGGCCTTTAGTTGG + Intergenic
927292433 2:21417919-21417941 AGTCAGCAAGCTCCATTAGAAGG + Intergenic
927940282 2:27099297-27099319 AGCCAGGAAGGGGCTTTAGAAGG + Intronic
929028270 2:37626392-37626414 TGCCAGGAAGTGCCTTTGAAAGG - Intergenic
932306187 2:70705593-70705615 AGGCAGGTAGTGCCTTGAGAAGG - Intronic
937594438 2:123656961-123656983 ACCCAGTAAGGGCTTTTAGATGG - Intergenic
948999867 2:241607116-241607138 GGCCAGGAGACCCCTTTAGAAGG + Intronic
1174186659 20:48711035-48711057 AGCCAGGGAGGTCCTTTAAAGGG - Intronic
1174215098 20:48910522-48910544 AGCCAGGAAGTTACTTTATATGG - Intergenic
1178067512 21:28922041-28922063 AGTCAGGAAGCCCTTTTAAAGGG + Intergenic
958750675 3:98191211-98191233 AGCCAGGATGAGCCATGAGAAGG - Intronic
960615978 3:119596403-119596425 AGCCAGGAAGCGCCTTTAGATGG - Intergenic
965335932 3:167430929-167430951 AGCCAGGAAGAGCCAGGAGAAGG - Intergenic
968283574 3:197495084-197495106 AGCCAGGAAGAGTCTTTAGATGG + Intergenic
970041770 4:11806493-11806515 AGCCAGGATGAGCCTGGAGAAGG - Intergenic
971713730 4:30149730-30149752 AGCCAGGAAGAGCCAAGAGAAGG - Intergenic
976198205 4:82553514-82553536 AGCCAGAAAATGCCTTTGGAAGG - Intronic
981436932 4:144735271-144735293 AGCCAGGGAGGGCATTTACAGGG - Intronic
983479454 4:168255125-168255147 AGCCAGGAAGTTACTTAAGATGG + Intronic
986830414 5:11571362-11571384 AGCTAGGAAGAGCCTTTTCAGGG - Intronic
993420152 5:87691624-87691646 AGCCACTATGCGCCTTTTGATGG + Intergenic
997313144 5:132907191-132907213 AGCTAGGAAGATCCATTAGAAGG - Intronic
1000828125 5:166071372-166071394 ATCATGGAAGCTCCTTTAGAAGG + Intergenic
1003795157 6:9593547-9593569 AGCCAGGAAGGGGATTTAAAGGG - Intergenic
1010826114 6:80477861-80477883 AGTCAGGAAGCTCCTTTAACAGG + Intergenic
1019791037 7:3014135-3014157 AGCCAGGCAGGGCCTGGAGAGGG + Intronic
1021430365 7:20551446-20551468 AGCCAGGAAGAGCCAGGAGAAGG - Intergenic
1021668822 7:23014270-23014292 AGCCATGAGGCGCCTTGAGTGGG + Intergenic
1024143456 7:46485499-46485521 ACCCAGGAAGCTCCTTTCTAAGG + Intergenic
1030273044 7:107690575-107690597 AGCCAGGAAGCGCTTTTACCAGG - Intronic
1032436428 7:131904775-131904797 AGACAGAAAGAGCCTTTAGGAGG + Intergenic
1034128556 7:148696034-148696056 AACCAGGAAAAGCATTTAGAAGG + Intergenic
1037330118 8:17736011-17736033 AACCAGTAAGCTCCTTAAGAGGG + Intronic
1044344875 8:91093654-91093676 AGCCAGTAAGTGACTCTAGAAGG + Intergenic
1048917104 8:139195662-139195684 AGCTAGGAAGAGCCTTAAAAGGG + Intergenic
1049070226 8:140350061-140350083 AGTCAAGAAGCACCTTTTGAGGG + Intronic
1052556460 9:30024415-30024437 AGCAAGGAAGCAGCTATAGATGG - Intergenic
1053058494 9:35009080-35009102 AGCCAGGAAGAGCCAGGAGAAGG - Intergenic
1053367298 9:37532235-37532257 AGCCAGGTAGGGCCTGGAGATGG - Intronic
1055129793 9:72762050-72762072 AGACAGGAAGAGCTTTTAGATGG + Intronic
1055360659 9:75486863-75486885 AGCCAAGAAGGCCCGTTAGATGG - Intergenic
1056582321 9:87899550-87899572 AGTCAGGAAGCATCTTTAGTTGG - Intergenic
1056789580 9:89616902-89616924 TGCTAGGAAAAGCCTTTAGAGGG + Intergenic
1188553152 X:31383120-31383142 AGCCAGGAAGAGCCAGGAGAAGG - Intronic
1191839309 X:65499759-65499781 AGGCAGGAAGGGCAATTAGAAGG + Intronic
1194667303 X:96689411-96689433 AGGCAGGAAGACCATTTAGAAGG + Intronic
1197824798 X:130577480-130577502 AGACAGGAACCTACTTTAGATGG + Intergenic
1199709412 X:150458270-150458292 AGACAGGATGCCCCTCTAGAAGG + Intronic
1201581809 Y:15517831-15517853 AGCCAGGAAGAGCCAGGAGAAGG - Intergenic