ID: 960616266

View in Genome Browser
Species Human (GRCh38)
Location 3:119598851-119598873
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2356
Summary {0: 1, 1: 0, 2: 3, 3: 178, 4: 2174}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960616266_960616275 11 Left 960616266 3:119598851-119598873 CCCCTCCCTGCTACAAAGTTCCA 0: 1
1: 0
2: 3
3: 178
4: 2174
Right 960616275 3:119598885-119598907 CATGCTCTCCTTGCACTCATGGG 0: 1
1: 0
2: 0
3: 15
4: 231
960616266_960616274 10 Left 960616266 3:119598851-119598873 CCCCTCCCTGCTACAAAGTTCCA 0: 1
1: 0
2: 3
3: 178
4: 2174
Right 960616274 3:119598884-119598906 GCATGCTCTCCTTGCACTCATGG 0: 1
1: 0
2: 2
3: 11
4: 150
960616266_960616278 25 Left 960616266 3:119598851-119598873 CCCCTCCCTGCTACAAAGTTCCA 0: 1
1: 0
2: 3
3: 178
4: 2174
Right 960616278 3:119598899-119598921 ACTCATGGGTGGTTTTTCAGAGG 0: 1
1: 0
2: 2
3: 6
4: 115
960616266_960616276 14 Left 960616266 3:119598851-119598873 CCCCTCCCTGCTACAAAGTTCCA 0: 1
1: 0
2: 3
3: 178
4: 2174
Right 960616276 3:119598888-119598910 GCTCTCCTTGCACTCATGGGTGG 0: 1
1: 0
2: 1
3: 5
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960616266 Original CRISPR TGGAACTTTGTAGCAGGGAG GGG (reversed) Intronic