ID: 960616270

View in Genome Browser
Species Human (GRCh38)
Location 3:119598856-119598878
Sequence CCCAGTGGAACTTTGTAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 127}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960616270_960616276 9 Left 960616270 3:119598856-119598878 CCCTGCTACAAAGTTCCACTGGG 0: 1
1: 0
2: 1
3: 8
4: 127
Right 960616276 3:119598888-119598910 GCTCTCCTTGCACTCATGGGTGG 0: 1
1: 0
2: 1
3: 5
4: 112
960616270_960616275 6 Left 960616270 3:119598856-119598878 CCCTGCTACAAAGTTCCACTGGG 0: 1
1: 0
2: 1
3: 8
4: 127
Right 960616275 3:119598885-119598907 CATGCTCTCCTTGCACTCATGGG 0: 1
1: 0
2: 0
3: 15
4: 231
960616270_960616274 5 Left 960616270 3:119598856-119598878 CCCTGCTACAAAGTTCCACTGGG 0: 1
1: 0
2: 1
3: 8
4: 127
Right 960616274 3:119598884-119598906 GCATGCTCTCCTTGCACTCATGG 0: 1
1: 0
2: 2
3: 11
4: 150
960616270_960616278 20 Left 960616270 3:119598856-119598878 CCCTGCTACAAAGTTCCACTGGG 0: 1
1: 0
2: 1
3: 8
4: 127
Right 960616278 3:119598899-119598921 ACTCATGGGTGGTTTTTCAGAGG 0: 1
1: 0
2: 2
3: 6
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960616270 Original CRISPR CCCAGTGGAACTTTGTAGCA GGG (reversed) Intronic