ID: 960616272

View in Genome Browser
Species Human (GRCh38)
Location 3:119598857-119598879
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 103}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960616272_960616276 8 Left 960616272 3:119598857-119598879 CCTGCTACAAAGTTCCACTGGGT 0: 1
1: 0
2: 1
3: 9
4: 103
Right 960616276 3:119598888-119598910 GCTCTCCTTGCACTCATGGGTGG 0: 1
1: 0
2: 1
3: 5
4: 112
960616272_960616278 19 Left 960616272 3:119598857-119598879 CCTGCTACAAAGTTCCACTGGGT 0: 1
1: 0
2: 1
3: 9
4: 103
Right 960616278 3:119598899-119598921 ACTCATGGGTGGTTTTTCAGAGG 0: 1
1: 0
2: 2
3: 6
4: 115
960616272_960616274 4 Left 960616272 3:119598857-119598879 CCTGCTACAAAGTTCCACTGGGT 0: 1
1: 0
2: 1
3: 9
4: 103
Right 960616274 3:119598884-119598906 GCATGCTCTCCTTGCACTCATGG 0: 1
1: 0
2: 2
3: 11
4: 150
960616272_960616275 5 Left 960616272 3:119598857-119598879 CCTGCTACAAAGTTCCACTGGGT 0: 1
1: 0
2: 1
3: 9
4: 103
Right 960616275 3:119598885-119598907 CATGCTCTCCTTGCACTCATGGG 0: 1
1: 0
2: 0
3: 15
4: 231

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960616272 Original CRISPR ACCCAGTGGAACTTTGTAGC AGG (reversed) Intronic