ID: 960616274

View in Genome Browser
Species Human (GRCh38)
Location 3:119598884-119598906
Sequence GCATGCTCTCCTTGCACTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 150}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960616266_960616274 10 Left 960616266 3:119598851-119598873 CCCCTCCCTGCTACAAAGTTCCA 0: 1
1: 0
2: 3
3: 178
4: 2174
Right 960616274 3:119598884-119598906 GCATGCTCTCCTTGCACTCATGG 0: 1
1: 0
2: 2
3: 11
4: 150
960616273_960616274 -10 Left 960616273 3:119598871-119598893 CCACTGGGTGACTGCATGCTCTC 0: 1
1: 0
2: 0
3: 13
4: 194
Right 960616274 3:119598884-119598906 GCATGCTCTCCTTGCACTCATGG 0: 1
1: 0
2: 2
3: 11
4: 150
960616267_960616274 9 Left 960616267 3:119598852-119598874 CCCTCCCTGCTACAAAGTTCCAC 0: 1
1: 0
2: 0
3: 16
4: 212
Right 960616274 3:119598884-119598906 GCATGCTCTCCTTGCACTCATGG 0: 1
1: 0
2: 2
3: 11
4: 150
960616272_960616274 4 Left 960616272 3:119598857-119598879 CCTGCTACAAAGTTCCACTGGGT 0: 1
1: 0
2: 1
3: 9
4: 103
Right 960616274 3:119598884-119598906 GCATGCTCTCCTTGCACTCATGG 0: 1
1: 0
2: 2
3: 11
4: 150
960616270_960616274 5 Left 960616270 3:119598856-119598878 CCCTGCTACAAAGTTCCACTGGG 0: 1
1: 0
2: 1
3: 8
4: 127
Right 960616274 3:119598884-119598906 GCATGCTCTCCTTGCACTCATGG 0: 1
1: 0
2: 2
3: 11
4: 150
960616268_960616274 8 Left 960616268 3:119598853-119598875 CCTCCCTGCTACAAAGTTCCACT 0: 1
1: 0
2: 0
3: 20
4: 133
Right 960616274 3:119598884-119598906 GCATGCTCTCCTTGCACTCATGG 0: 1
1: 0
2: 2
3: 11
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960616274 Original CRISPR GCATGCTCTCCTTGCACTCA TGG Intronic
903189322 1:21647983-21648005 TCATGATCTCCTGGCATTCAAGG - Intronic
903427467 1:23264959-23264981 CCATGCCCTCCTTCCCCTCAAGG + Intergenic
904591663 1:31618373-31618395 GGATGCTCCCCTTGCTCGCAAGG + Intronic
905254501 1:36671437-36671459 GCTGCCTCTCCTTGCACTCTAGG + Intergenic
905577169 1:39054536-39054558 CCATGCTATCCTTGAACTCCTGG + Intergenic
908923932 1:69230428-69230450 TCATGCTGTCCCTGCACTAAGGG + Intergenic
910232449 1:84999941-84999963 CCATGCTATTCTTGCACTCCTGG - Intronic
910584757 1:88866824-88866846 GCGTGTTCTCCTTGCATACAGGG - Intronic
914196837 1:145452076-145452098 GCCTCCTCTCCTGGCCCTCAAGG + Intergenic
915028046 1:152851558-152851580 ACATGCTCTCTTGGCATTCATGG + Intergenic
917706758 1:177642473-177642495 CCATGATCTCCTTGAAGTCAGGG + Intergenic
918432953 1:184481346-184481368 GCATGATCTCCTTTCACAGAAGG + Intronic
919399243 1:197088854-197088876 GCAAGCTCTTCTTCCTCTCAAGG - Intronic
920689449 1:208134732-208134754 GCATGCTCTGCCTGCACCCTGGG + Intronic
921333687 1:214065187-214065209 GCATCCTCCTCTTGCAATCAGGG + Intergenic
923773370 1:236957213-236957235 GCATGAGCTCCCTGCACTCATGG - Intergenic
923967270 1:239155890-239155912 GCACTCTCTCCTGGCAGTCAGGG - Intergenic
1065050345 10:21785646-21785668 GAATGCTCTCCCTGCCCTCCTGG + Intronic
1068565969 10:58575630-58575652 GTAGGCTCTCCTTGGACTCCTGG + Intronic
1072728943 10:97831871-97831893 GCATGCATTCCCTGCCCTCAGGG + Intergenic
1077447866 11:2608671-2608693 GCATGCTATTCTTGAACTCCTGG + Intronic
1078133158 11:8630144-8630166 GCCTGCTTTCCTTGCTCTGAAGG - Intronic
1079466532 11:20736244-20736266 ACATGCTCTCCAAACACTCACGG + Intronic
1083031847 11:59599777-59599799 GCATCCTGTCCTTTCCCTCAGGG - Intronic
1086913974 11:92506126-92506148 GAATGGTCTCCTTGAACTCTAGG + Intronic
1087962313 11:104366723-104366745 GCTCGCTCTCCTCGCTCTCAGGG - Intergenic
1091854436 12:3728004-3728026 CCATACCCTCCTTGCCCTCAAGG - Intronic
1093285402 12:17253651-17253673 GCATGCTCCCCTTGGAATTAGGG - Intergenic
1093981178 12:25477442-25477464 CCATCCTCTCCTTTCTCTCAGGG - Intronic
1095317892 12:40788466-40788488 CCATGCTCTCCTTTGCCTCATGG + Intronic
1096321586 12:50618848-50618870 CCATTCTCTCCTTGCTCCCATGG + Intronic
1098346280 12:69507232-69507254 GCATACTCCTCCTGCACTCAAGG - Intronic
1098357958 12:69628943-69628965 GCCTGCCCTCCTTGCTCACAGGG - Intergenic
1099258195 12:80342755-80342777 GGGCGCTCTCCTTGCCCTCAAGG + Intronic
1101522330 12:105495446-105495468 GGATGCTCTTCTTGCAATGATGG + Intergenic
1102693625 12:114781100-114781122 GGATGCTCTCCTTTCAGTCAAGG - Intergenic
1105335378 13:19462752-19462774 CCATGCTCGCCTTGAACTCCTGG + Intronic
1106024395 13:25943078-25943100 GCATGCTCTCGTTCCTCTAATGG - Intronic
1108026689 13:46185341-46185363 ACTTCCTCTCCATGCACTCATGG + Intronic
1110000216 13:70187881-70187903 GCAGGCTCTCATTTCTCTCATGG - Intergenic
1111862396 13:93724908-93724930 GTTTGCTCTTGTTGCACTCATGG + Intronic
1113053030 13:106236051-106236073 GCATGCTCTCACTCCACTGAGGG + Intergenic
1113874778 13:113587302-113587324 GGGGGCTCACCTTGCACTCAGGG + Intronic
1116199531 14:41773166-41773188 TCATGCCCTTCTTGCATTCAAGG + Intronic
1119748399 14:77060604-77060626 CCATGCTCTCCTAGTGCTCAGGG + Intergenic
1119895627 14:78217443-78217465 GCAGGCTCTCCTTGCATTGCTGG - Intergenic
1122814512 14:104305911-104305933 GCATGCACACCCTGCACACAGGG - Intergenic
1124573719 15:30889368-30889390 TCATTTTCTCCTTGTACTCATGG + Intergenic
1127220343 15:56873856-56873878 GCCTGCACTCCCTGCATTCAAGG - Intronic
1127843215 15:62847730-62847752 GCCTGCACTCCTTGGAATCAGGG + Intergenic
1129048105 15:72755072-72755094 GCATGCCAGCCTTGCACTCACGG - Intronic
1129263567 15:74382237-74382259 TCCTGCTCTCCCTGCCCTCAAGG - Intergenic
1129974083 15:79806793-79806815 GAATGTTCTCATTGCAGTCAAGG + Intergenic
1130719604 15:86373562-86373584 GCCTGCTCTCCCTGGACTCCTGG - Intronic
1135957795 16:26970781-26970803 GCATGCTGTTCTTGACCTCACGG + Intergenic
1137253619 16:46757899-46757921 GCAGGGACTCCTTGCATTCAGGG + Intronic
1137744467 16:50810561-50810583 GCATGCTCTCTTGGCACTCTGGG - Intergenic
1138921098 16:61530217-61530239 GAAGGTTCTCCTTGTACTCATGG - Intergenic
1142315184 16:89339467-89339489 ACATGCGCTGCGTGCACTCAGGG - Intronic
1142368013 16:89660523-89660545 GCACGCTCTCCATGCAGTGACGG + Intronic
1143880740 17:10027808-10027830 CCAGGCTCTCCTTGAACTCCTGG - Intronic
1146911038 17:36648721-36648743 GCTTTGTCTCCTGGCACTCAAGG + Intergenic
1151549664 17:74814811-74814833 GGATGCAGTCCTTGCCCTCAAGG + Intronic
1155088190 18:22477653-22477675 CCATGCTCTCCTGGCATTTAAGG + Intergenic
1155686136 18:28553757-28553779 GCATGCCCTCCTGGCAATGATGG - Intergenic
1157465277 18:47938672-47938694 GCATGCTCTGCTTGCAGGCAGGG + Intergenic
1157552707 18:48592554-48592576 GCATCCACTCCTTGCCCACATGG - Intronic
1158390053 18:57037628-57037650 GCCCGCTCTCCTTGCCTTCATGG + Intergenic
1167454384 19:49590885-49590907 GCAGGCTCGCATTGCACCCAGGG + Exonic
1168564757 19:57413740-57413762 ACAGGCTCTCCTTGGACCCAAGG - Intronic
925191421 2:1887501-1887523 TTTTGCTCTCCTTGCACTGAGGG + Exonic
927640916 2:24844749-24844771 GCATGCTCACCTTGTCCTAATGG - Intronic
928197045 2:29223454-29223476 GCTTGCTCAGCTTGTACTCAGGG + Exonic
930659158 2:54036681-54036703 GCATTTTCTCCTTGAAGTCAAGG - Intronic
932993457 2:76817181-76817203 GCATGCACTCCTGGCACTCATGG - Intronic
933740725 2:85531870-85531892 GCCTGCTTTCCTTGCACTGGGGG + Intergenic
936019059 2:108981028-108981050 TCATGCTCTGTATGCACTCACGG - Intronic
936283031 2:111159338-111159360 GAATGCTACCCTGGCACTCAGGG + Intronic
936729505 2:115363393-115363415 GCCTGCTCTCCTCAGACTCATGG + Intronic
937315854 2:120931783-120931805 GCCTGGTCTCCTTGCCCTCACGG - Intronic
937887834 2:126912150-126912172 ACATGCTCTCCCTGCACCCTGGG - Intergenic
940900580 2:159123134-159123156 GAATCCTCTACCTGCACTCATGG - Intronic
941398529 2:165001873-165001895 GAATGCTCTCTATGCACTCAGGG + Intergenic
943667587 2:190626317-190626339 GGATGTTATCCTTGCACTAAAGG - Intergenic
946239641 2:218345722-218345744 ACATGCTCTCCTTGCACATCTGG + Exonic
946463395 2:219890111-219890133 GCATGCTCTTCTCTGACTCAGGG + Intergenic
947882389 2:233529091-233529113 GCAGGCTCTCTTTGGACCCAAGG + Intronic
948701463 2:239763216-239763238 GGAGGCACTCCTTCCACTCACGG - Intronic
949052057 2:241902749-241902771 GCATCCTGGCCCTGCACTCACGG + Intergenic
1168902840 20:1379719-1379741 AAATCCTCTCCTTGGACTCAAGG - Intronic
1169978170 20:11353714-11353736 GCATGCTCCCCTGTCCCTCAAGG + Intergenic
1174595417 20:51679587-51679609 GCAGCCCCTCCTTGCTCTCAAGG + Intronic
1175686475 20:61031911-61031933 AAATGCTCTGGTTGCACTCAAGG - Intergenic
1176303531 21:5111369-5111391 CCCTGCTCTCCTGGCGCTCAGGG + Intergenic
1176738195 21:10572238-10572260 CCATGCTCGCCTTGAACTCCTGG - Intronic
1179853499 21:44150581-44150603 CCCTGCTCTCCTGGCGCTCAGGG - Intergenic
1181164787 22:20977452-20977474 GCATGCTGTCCCTCCACTTAAGG + Intronic
1182746976 22:32613563-32613585 GAATGCTATCCTTGCCCTCACGG - Intronic
1183090425 22:35518639-35518661 GCGGGCTCTCCTTGTAGTCAGGG - Intergenic
1183093164 22:35537242-35537264 ACAAGCTCTCCTTGGACACAGGG - Intergenic
954196799 3:49001889-49001911 GCCTGCATTCCTTGCTCTCATGG + Intronic
954322119 3:49839410-49839432 GCACGCACTCCTGGCACTAAGGG + Intronic
954764798 3:52905001-52905023 GCTTGCTCTCTTTGCACTTTCGG - Exonic
955107347 3:55910967-55910989 GGATGCAATCCCTGCACTCATGG + Intronic
955498801 3:59563784-59563806 CCAAACTCTCCTGGCACTCACGG - Intergenic
955778143 3:62455477-62455499 GCATGGTTTCCTTGGACTCCAGG + Intronic
956321359 3:68000259-68000281 GCTTGTCCTCCTTGCCCTCATGG + Intergenic
957162011 3:76622388-76622410 TCATGCTATCCTTGAACTCCTGG - Intronic
959606847 3:108250375-108250397 GCAGGCTTTCCTGGAACTCAGGG - Intergenic
960616274 3:119598884-119598906 GCATGCTCTCCTTGCACTCATGG + Intronic
967105345 3:186251065-186251087 GAGTGCTGTCCTTGCACTGAGGG + Intronic
967319828 3:188184357-188184379 GCATGCTCTCCCTTCCCTCCTGG - Intronic
972892321 4:43574161-43574183 ACAGGCTCTGCTTGCACTCAAGG - Intergenic
977113957 4:92997246-92997268 ACATGAACTCCTTTCACTCAAGG - Intronic
977745168 4:100538426-100538448 GCAAAATCTCATTGCACTCAAGG + Intronic
984870230 4:184318612-184318634 CCTTGCTCTGCTTCCACTCAGGG - Intergenic
988868966 5:35367060-35367082 GCCTGCCTTCCTTGGACTCAGGG - Intergenic
991031262 5:62084818-62084840 CCAAGCCCTCCTTTCACTCATGG - Intergenic
996281454 5:121734393-121734415 GCATTCTTTCCCTGCCCTCATGG - Intergenic
997221512 5:132170149-132170171 TCAAGCTCTCCTATCACTCAGGG + Intergenic
1000178222 5:158779657-158779679 ACCTGCTCTCCTTGTTCTCAGGG + Intronic
1001588576 5:172850251-172850273 TCATGCCCTCCTTTGACTCAGGG - Intronic
1006985868 6:38175206-38175228 GCATGCTGACCCTTCACTCATGG - Intronic
1010024342 6:71198316-71198338 TCCAGCTCTCCTTTCACTCATGG + Intergenic
1012803360 6:103863933-103863955 CCATGCTCTCATTCCACTCCTGG - Intergenic
1015896215 6:138019569-138019591 TAATGATCTCCTTCCACTCAAGG - Intergenic
1017567925 6:155708771-155708793 GCCTCCTCACCTTGTACTCAAGG + Intergenic
1019675245 7:2307689-2307711 CCAGGCTCTCCATGCACTCTCGG + Intronic
1019884963 7:3895822-3895844 GCATTTTCTCCTTTCACCCATGG + Intronic
1021338117 7:19429366-19429388 GCATTCTCTCCTTGCTTACATGG - Intergenic
1022802024 7:33785971-33785993 GCATGCTGTCCATGCACAAATGG - Intergenic
1029193942 7:98791287-98791309 GCAGGCTCTCCAGGCACTCCTGG - Intergenic
1029720686 7:102362528-102362550 GCAGGCTGTCCTTGAACTCCTGG + Intergenic
1032913532 7:136461372-136461394 GCATGCTCCCCTTGCACACAGGG - Intergenic
1034029831 7:147748667-147748689 GCATGCCTCCCTTGAACTCAGGG + Intronic
1034192370 7:149222240-149222262 ACAGGCCCTCCTTGCACTCGTGG - Intronic
1034219376 7:149432252-149432274 GGAAGCTCTTCTTGCACTCGGGG + Exonic
1036427568 8:8659774-8659796 ACATGCTCTTCTTGCTCTCCTGG + Intergenic
1036844388 8:12153965-12153987 GCATGCTGTTCTTGAACTCCTGG - Intergenic
1036865760 8:12396287-12396309 GCATGCTGTTCTTGAACTCCTGG - Intergenic
1037624056 8:20592509-20592531 ACATGCTCTCCTTCCCCTCAGGG - Intergenic
1038951796 8:32423307-32423329 GCATTTTCTCCTTTCACTGATGG + Intronic
1039852223 8:41379028-41379050 GCAGGCTCCCCTTGCACACCAGG + Intergenic
1047163255 8:122405860-122405882 TTAAGCTCTCCTTGCACTCCTGG - Intergenic
1047454572 8:124997914-124997936 TCAGGCTCTCCACGCACTCATGG + Intergenic
1049601961 8:143512129-143512151 GCTCGCTCTCCTTGCATGCAGGG - Intronic
1050394715 9:5183721-5183743 GAAGGCTCTCCTTGCACTCCTGG + Intronic
1053333754 9:37243681-37243703 GCATGCTTTCTTTGCAGACATGG + Intronic
1053396300 9:37777434-37777456 ACAGGCTCTGCTTGCTCTCAAGG - Intronic
1056207837 9:84337230-84337252 ATATGCTCTTCTTGCCCTCAAGG - Intronic
1056939854 9:90945843-90945865 CCTTTCTCTCCATGCACTCAGGG + Intergenic
1058456272 9:105140947-105140969 CCCTGCTCTCCTTCCTCTCAAGG + Intergenic
1061617992 9:131792718-131792740 GCACCCTCTCCTTTCCCTCAAGG - Intergenic
1062697896 9:137884766-137884788 GCCTCCTCTCCTGGCCCTCAAGG - Intronic
1185722812 X:2395595-2395617 CCATGCCTTCCTTGCAGTCACGG - Intronic
1185842532 X:3405896-3405918 GCTTACTTTCCTTGCTCTCAAGG + Intergenic
1187584365 X:20643577-20643599 GCAGGCTTTTCTTGCACTAAGGG + Intergenic
1188117527 X:26263563-26263585 GCATGTTCTCCCTCCCCTCAGGG - Intergenic
1192909940 X:75592707-75592729 GCAGGCTCTCCTTGCATTGCTGG + Intergenic
1195615111 X:106905890-106905912 GCATGCTCTCCTGGAGCCCAGGG + Intronic
1196978323 X:121184547-121184569 GCATCATCTGCTTGCAATCATGG + Intergenic
1198660541 X:138963582-138963604 TTATGTTCTCCTTGCTCTCATGG - Intronic
1199784430 X:151091648-151091670 TCATGGTCTCATTGCACTGATGG - Intergenic
1202596449 Y:26545533-26545555 CCATGCTCACCTTGAACTCCTGG - Intergenic