ID: 960616274

View in Genome Browser
Species Human (GRCh38)
Location 3:119598884-119598906
Sequence GCATGCTCTCCTTGCACTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 150}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960616272_960616274 4 Left 960616272 3:119598857-119598879 CCTGCTACAAAGTTCCACTGGGT 0: 1
1: 0
2: 1
3: 9
4: 103
Right 960616274 3:119598884-119598906 GCATGCTCTCCTTGCACTCATGG 0: 1
1: 0
2: 2
3: 11
4: 150
960616267_960616274 9 Left 960616267 3:119598852-119598874 CCCTCCCTGCTACAAAGTTCCAC 0: 1
1: 0
2: 0
3: 16
4: 212
Right 960616274 3:119598884-119598906 GCATGCTCTCCTTGCACTCATGG 0: 1
1: 0
2: 2
3: 11
4: 150
960616273_960616274 -10 Left 960616273 3:119598871-119598893 CCACTGGGTGACTGCATGCTCTC 0: 1
1: 0
2: 0
3: 13
4: 194
Right 960616274 3:119598884-119598906 GCATGCTCTCCTTGCACTCATGG 0: 1
1: 0
2: 2
3: 11
4: 150
960616268_960616274 8 Left 960616268 3:119598853-119598875 CCTCCCTGCTACAAAGTTCCACT 0: 1
1: 0
2: 0
3: 20
4: 133
Right 960616274 3:119598884-119598906 GCATGCTCTCCTTGCACTCATGG 0: 1
1: 0
2: 2
3: 11
4: 150
960616266_960616274 10 Left 960616266 3:119598851-119598873 CCCCTCCCTGCTACAAAGTTCCA 0: 1
1: 0
2: 3
3: 178
4: 2174
Right 960616274 3:119598884-119598906 GCATGCTCTCCTTGCACTCATGG 0: 1
1: 0
2: 2
3: 11
4: 150
960616270_960616274 5 Left 960616270 3:119598856-119598878 CCCTGCTACAAAGTTCCACTGGG 0: 1
1: 0
2: 1
3: 8
4: 127
Right 960616274 3:119598884-119598906 GCATGCTCTCCTTGCACTCATGG 0: 1
1: 0
2: 2
3: 11
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960616274 Original CRISPR GCATGCTCTCCTTGCACTCA TGG Intronic