ID: 960616279

View in Genome Browser
Species Human (GRCh38)
Location 3:119598949-119598971
Sequence TAGGGACAACTAATTGAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 73}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960616279_960616284 -5 Left 960616279 3:119598949-119598971 CCTACCTCAATTAGTTGTCCCTA 0: 1
1: 0
2: 0
3: 6
4: 73
Right 960616284 3:119598967-119598989 CCCTAAAAGGTGAGGATTTGAGG 0: 1
1: 0
2: 1
3: 20
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960616279 Original CRISPR TAGGGACAACTAATTGAGGT AGG (reversed) Intronic
906874045 1:49516308-49516330 GAGGGACAACTAATTCAGCCTGG + Intronic
910050089 1:82963251-82963273 AAGTCACCACTAATTGAGGTTGG + Intergenic
912865621 1:113253636-113253658 TAGGAACGACTAAATGAGGATGG - Intergenic
914702067 1:150143643-150143665 TAAGAATAACTACTTGAGGTAGG + Intronic
917339877 1:173965046-173965068 TTGGGTCAACTTAATGAGGTGGG - Exonic
921740298 1:218677103-218677125 AAGAAACAACTAATTGTGGTTGG + Intergenic
922866996 1:228868775-228868797 TAGGGACCACTGCTTGAGGCTGG + Intergenic
1064200226 10:13278064-13278086 TAAGGAAAACTAATTTAGGGTGG - Exonic
1065163926 10:22954732-22954754 TAGAGAAAACAAATTGAGGAGGG - Intronic
1066405486 10:35114290-35114312 TAGGGAGAATCACTTGAGGTCGG - Intergenic
1070618218 10:77985898-77985920 TAGGGACAAGTACATGAGGTAGG - Exonic
1071554312 10:86590676-86590698 TAGGGAAAAAAAATTGAGATGGG - Intergenic
1075934082 10:126324718-126324740 TAGGGACAATTAAATTAAGTGGG + Intronic
1079466202 11:20733309-20733331 AAGTGACATCTAATTGATGTAGG + Intronic
1081914881 11:46724317-46724339 TAGGGTCAACTGACGGAGGTTGG + Intronic
1083303481 11:61750987-61751009 TAGGGAGAACTGCTTTAGGTAGG + Intergenic
1087424252 11:97968744-97968766 TAGGGACTACTAAATGAATTGGG + Intergenic
1091520709 12:1238881-1238903 TAGGGAAAACTAATTTAGAGTGG + Intronic
1093390725 12:18617177-18617199 TAAGGACAAATAACTGAGATAGG - Intronic
1094713810 12:32991434-32991456 TAGGGAAGAGTATTTGAGGTGGG + Intergenic
1100722271 12:97371540-97371562 AAGGCACAACTAATCTAGGTTGG + Intergenic
1104223221 12:126806408-126806430 TTAAGACAACTAATTGGGGTTGG + Intergenic
1105563280 13:21516266-21516288 TAAGGGAAACTAATTTAGGTGGG - Intronic
1106469411 13:30040973-30040995 CAGGGAAAACTAAGTGAGGGAGG - Intergenic
1107699683 13:43035206-43035228 TAGGGACTGCTAATGGAGGGAGG + Intronic
1109945056 13:69421924-69421946 TAGGGAGAAGAATTTGAGGTAGG + Intergenic
1126898561 15:53286697-53286719 TATGGACAGCTAAAGGAGGTGGG - Intergenic
1127104801 15:55601929-55601951 TATTGATAACTAATTCAGGTAGG - Intergenic
1127989991 15:64106967-64106989 TAGGGAGAAATGAGTGAGGTGGG - Intronic
1134895251 16:17880583-17880605 TAGGGACAAAGAATGTAGGTAGG - Intergenic
1139158373 16:64472460-64472482 TGGGGACAAGAAATTGAAGTGGG + Intergenic
1139287841 16:65831503-65831525 GGGGGACAACTAACTCAGGTTGG + Intergenic
1140830591 16:78747031-78747053 TGGGCACAGCTACTTGAGGTAGG - Intronic
1144806092 17:17968813-17968835 TAGGGACAGCTGAATGAGGCAGG - Intronic
1149576758 17:57719164-57719186 GAGGGACAACTAAGAGAGGAGGG + Intergenic
1153392695 18:4580241-4580263 TAAGAACAACAAAATGAGGTAGG + Intergenic
1156259373 18:35430439-35430461 TATGGATAAATAATTGAGGAGGG - Intergenic
1156992090 18:43421178-43421200 TAGAGACAGCTGATTGAGGGAGG - Intergenic
1161622527 19:5306015-5306037 TAGGTACAAATACTTGAGGAAGG + Intronic
925747672 2:7057366-7057388 TAGGGACAGCTTAATGAGGAAGG + Intronic
938104836 2:128522875-128522897 TAGGGACTCCTCATTGAGCTGGG + Intergenic
939521194 2:143232651-143232673 AAGGGACAACTGATAGGGGTTGG - Intronic
941936904 2:170989039-170989061 TAGTAACAACTGATTGAGGTAGG - Intergenic
1172868651 20:38120646-38120668 TAGGGGCAACCAATGGGGGTGGG - Intronic
1181965727 22:26655589-26655611 TATGGACAAGTAACTGAGGAAGG + Intergenic
951509206 3:23482800-23482822 TAGTGACAACTAAGTGAGATAGG - Intronic
955664449 3:61335539-61335561 TAGGGACATCTAATAGAGGCAGG + Intergenic
956130153 3:66045697-66045719 TAGGGAAACCTCATCGAGGTGGG + Intergenic
959342840 3:105152397-105152419 TAGGGAGTAGTAATTGAGCTTGG - Intergenic
960616279 3:119598949-119598971 TAGGGACAACTAATTGAGGTAGG - Intronic
962478700 3:135780027-135780049 CAGGGACAGCTTTTTGAGGTAGG - Intergenic
966733519 3:183169964-183169986 TAGGTTAAACTAATTGATGTAGG + Intergenic
969495830 4:7525693-7525715 AAGGGACAAGTGACTGAGGTGGG - Intronic
970202143 4:13620837-13620859 GAGGGACAACTACTTGAACTAGG + Intronic
970298639 4:14658732-14658754 TAGGGAGAACTTTATGAGGTGGG + Intergenic
970352518 4:15217294-15217316 TAGGAAGAATTAATTGGGGTTGG + Intergenic
972570031 4:40302009-40302031 TATGGAGAACCAGTTGAGGTTGG + Intergenic
973770489 4:54201906-54201928 TAGGGAAAACTAGGGGAGGTGGG + Intronic
979684354 4:123495288-123495310 TAGGTAGAACTAATTGGGTTTGG + Intergenic
983054843 4:163089702-163089724 AAGGGACAAATGATTGTGGTGGG + Intergenic
987300031 5:16589092-16589114 TAGGCACAACTACTGGATGTGGG - Intronic
988938752 5:36119235-36119257 TAGCAACAAGTAATTGAGGTAGG - Intronic
993083085 5:83326825-83326847 TGGGGACAAGCAATTGAGGAAGG - Intronic
993495289 5:88601955-88601977 TAAAGACAACTAAAAGAGGTGGG - Intergenic
995170463 5:109105069-109105091 TTGGGAAAACTAATTTAGGAAGG + Intronic
995566286 5:113435288-113435310 AAGGGACAATTAATAAAGGTGGG + Intronic
997748382 5:136320116-136320138 TAGGGAATACTAAATAAGGTAGG - Intronic
997893186 5:137693449-137693471 TAGGGAAAATTGATAGAGGTTGG - Intronic
1013813546 6:114070927-114070949 TAGGGAGAATAAATTGAGGAAGG - Intronic
1021012257 7:15484961-15484983 TAGGAAGAAGTAAATGAGGTAGG + Intronic
1032786197 7:135201968-135201990 TAGGGACAAACAGTTGAGGTGGG + Intronic
1040682685 8:49832586-49832608 TAGAGTTACCTAATTGAGGTAGG + Intergenic
1045902619 8:107302263-107302285 AAGAGACAAGTAATTTAGGTGGG + Intronic
1046094559 8:109541472-109541494 TAAGGACAACCAAAAGAGGTAGG - Intronic
1046531258 8:115448573-115448595 TAGAGACACCTATTTGAGGATGG - Intronic
1046566482 8:115907650-115907672 GAGGTTCAACTAATTGAAGTAGG + Intergenic
1047382197 8:124373452-124373474 TAGGGACAGCTTAATGAAGTAGG - Intergenic
1047881129 8:129194822-129194844 TAGGTACATCTATTTGAGATTGG + Intergenic
1195852364 X:109296679-109296701 TAGGGACAAATAATTTGGTTGGG - Intergenic
1197632033 X:128872417-128872439 TAGGGGCAATTACTTGAAGTGGG - Intergenic