ID: 960619693

View in Genome Browser
Species Human (GRCh38)
Location 3:119626202-119626224
Sequence CAGAGGGGCCGCACTTCCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 231}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960619693_960619707 24 Left 960619693 3:119626202-119626224 CCATGGGAAGTGCGGCCCCTCTG 0: 1
1: 0
2: 0
3: 12
4: 231
Right 960619707 3:119626249-119626271 CACCTGAGCATGCTTCCACTGGG 0: 1
1: 0
2: 0
3: 8
4: 136
960619693_960619706 23 Left 960619693 3:119626202-119626224 CCATGGGAAGTGCGGCCCCTCTG 0: 1
1: 0
2: 0
3: 12
4: 231
Right 960619706 3:119626248-119626270 CCACCTGAGCATGCTTCCACTGG 0: 1
1: 0
2: 0
3: 14
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960619693 Original CRISPR CAGAGGGGCCGCACTTCCCA TGG (reversed) Intronic