ID: 960619707

View in Genome Browser
Species Human (GRCh38)
Location 3:119626249-119626271
Sequence CACCTGAGCATGCTTCCACT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 136}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960619696_960619707 8 Left 960619696 3:119626218-119626240 CCCTCTGGAACCCCTGCCCAAAG 0: 1
1: 0
2: 0
3: 34
4: 218
Right 960619707 3:119626249-119626271 CACCTGAGCATGCTTCCACTGGG 0: 1
1: 0
2: 0
3: 8
4: 136
960619697_960619707 7 Left 960619697 3:119626219-119626241 CCTCTGGAACCCCTGCCCAAAGC 0: 1
1: 0
2: 2
3: 55
4: 847
Right 960619707 3:119626249-119626271 CACCTGAGCATGCTTCCACTGGG 0: 1
1: 0
2: 0
3: 8
4: 136
960619693_960619707 24 Left 960619693 3:119626202-119626224 CCATGGGAAGTGCGGCCCCTCTG 0: 1
1: 0
2: 0
3: 12
4: 231
Right 960619707 3:119626249-119626271 CACCTGAGCATGCTTCCACTGGG 0: 1
1: 0
2: 0
3: 8
4: 136
960619692_960619707 25 Left 960619692 3:119626201-119626223 CCCATGGGAAGTGCGGCCCCTCT 0: 1
1: 0
2: 0
3: 4
4: 97
Right 960619707 3:119626249-119626271 CACCTGAGCATGCTTCCACTGGG 0: 1
1: 0
2: 0
3: 8
4: 136
960619700_960619707 -4 Left 960619700 3:119626230-119626252 CCTGCCCAAAGCAGCCACCCACC 0: 1
1: 0
2: 4
3: 59
4: 465
Right 960619707 3:119626249-119626271 CACCTGAGCATGCTTCCACTGGG 0: 1
1: 0
2: 0
3: 8
4: 136
960619695_960619707 9 Left 960619695 3:119626217-119626239 CCCCTCTGGAACCCCTGCCCAAA 0: 1
1: 0
2: 1
3: 21
4: 217
Right 960619707 3:119626249-119626271 CACCTGAGCATGCTTCCACTGGG 0: 1
1: 0
2: 0
3: 8
4: 136
960619701_960619707 -8 Left 960619701 3:119626234-119626256 CCCAAAGCAGCCACCCACCTGAG 0: 1
1: 1
2: 2
3: 19
4: 248
Right 960619707 3:119626249-119626271 CACCTGAGCATGCTTCCACTGGG 0: 1
1: 0
2: 0
3: 8
4: 136
960619702_960619707 -9 Left 960619702 3:119626235-119626257 CCAAAGCAGCCACCCACCTGAGC 0: 1
1: 0
2: 1
3: 26
4: 334
Right 960619707 3:119626249-119626271 CACCTGAGCATGCTTCCACTGGG 0: 1
1: 0
2: 0
3: 8
4: 136
960619699_960619707 -3 Left 960619699 3:119626229-119626251 CCCTGCCCAAAGCAGCCACCCAC 0: 1
1: 2
2: 4
3: 40
4: 368
Right 960619707 3:119626249-119626271 CACCTGAGCATGCTTCCACTGGG 0: 1
1: 0
2: 0
3: 8
4: 136
960619698_960619707 -2 Left 960619698 3:119626228-119626250 CCCCTGCCCAAAGCAGCCACCCA 0: 1
1: 0
2: 7
3: 43
4: 431
Right 960619707 3:119626249-119626271 CACCTGAGCATGCTTCCACTGGG 0: 1
1: 0
2: 0
3: 8
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960619707 Original CRISPR CACCTGAGCATGCTTCCACT GGG Intronic