ID: 960620904

View in Genome Browser
Species Human (GRCh38)
Location 3:119635857-119635879
Sequence GTTGATGTGCATAACGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 93}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960620900_960620904 3 Left 960620900 3:119635831-119635853 CCTGTCAGCCCAGCACAGGACGT 0: 1
1: 0
2: 0
3: 13
4: 173
Right 960620904 3:119635857-119635879 GTTGATGTGCATAACGTGGAAGG 0: 1
1: 0
2: 0
3: 10
4: 93
960620902_960620904 -6 Left 960620902 3:119635840-119635862 CCAGCACAGGACGTCTTGTTGAT 0: 1
1: 0
2: 0
3: 3
4: 56
Right 960620904 3:119635857-119635879 GTTGATGTGCATAACGTGGAAGG 0: 1
1: 0
2: 0
3: 10
4: 93
960620897_960620904 23 Left 960620897 3:119635811-119635833 CCTCATATACCTGTTTGGAGCCT 0: 1
1: 0
2: 5
3: 19
4: 121
Right 960620904 3:119635857-119635879 GTTGATGTGCATAACGTGGAAGG 0: 1
1: 0
2: 0
3: 10
4: 93
960620898_960620904 14 Left 960620898 3:119635820-119635842 CCTGTTTGGAGCCTGTCAGCCCA 0: 1
1: 2
2: 2
3: 6
4: 136
Right 960620904 3:119635857-119635879 GTTGATGTGCATAACGTGGAAGG 0: 1
1: 0
2: 0
3: 10
4: 93
960620901_960620904 -5 Left 960620901 3:119635839-119635861 CCCAGCACAGGACGTCTTGTTGA 0: 1
1: 0
2: 0
3: 4
4: 72
Right 960620904 3:119635857-119635879 GTTGATGTGCATAACGTGGAAGG 0: 1
1: 0
2: 0
3: 10
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960620904 Original CRISPR GTTGATGTGCATAACGTGGA AGG Intergenic
900227054 1:1537923-1537945 GTTGACGTGGAGAACGTGTATGG - Intronic
902202496 1:14844428-14844450 GTTGCTGTTCATAATGAGGAGGG - Intronic
907750114 1:57254968-57254990 CTTTATGTCCATAACGTAGAAGG + Intronic
913036753 1:114974301-114974323 GTTGATATGCATAAGTTGAATGG + Intronic
914338936 1:146741806-146741828 ATTGAGGTGCATAACTTGAATGG - Intergenic
916830236 1:168483458-168483480 GTTGATATGCAAACCCTGGAAGG + Intergenic
917680709 1:177363957-177363979 ACTGATGTGCATATAGTGGAAGG - Intergenic
917985643 1:180315536-180315558 GTTAATCTGAATAACTTGGAAGG + Intronic
918445536 1:184613563-184613585 TATGATGTGCAAAACGTTGATGG + Intronic
918928174 1:190814702-190814724 GTACATGTGCACAACGTGCAAGG - Intergenic
920429249 1:205905565-205905587 GTACATGTGCACAACGTGCAGGG - Intergenic
923979277 1:239302508-239302530 GTACATGTGCACAACGTGCAGGG - Intergenic
1065865453 10:29911154-29911176 GGTGAGGTGCAGAGCGTGGAAGG - Intergenic
1068710796 10:60131727-60131749 GTTGATGTGCAGAAGGTGGGTGG + Intronic
1069294030 10:66821437-66821459 GTTGATGTGAAAAAAGTGGTAGG + Intronic
1084374395 11:68766171-68766193 GTTATTGTGCATAACCTTGAAGG + Intronic
1084449428 11:69227029-69227051 GTTGATAAGCAGAATGTGGAAGG + Intergenic
1085313849 11:75531554-75531576 GGTGATGTGCATAGGGTGGGAGG + Intergenic
1101939573 12:109090011-109090033 GTTGATGAGCACAAAGTTGAAGG + Exonic
1111350195 13:87018460-87018482 GTTGACCTGGATAAAGTGGATGG + Intergenic
1112244909 13:97723980-97724002 GTTGATGTGTTTAATGTGAAAGG - Intergenic
1112843323 13:103606674-103606696 GTACATGTGCACAACGTGCAGGG + Intergenic
1114974170 14:28073649-28073671 GTACATGTGCACAACGTGCAGGG + Intergenic
1115211209 14:30968848-30968870 GTTTATGTGCAAAGCGTGTAAGG + Intronic
1116581753 14:46651437-46651459 GTTGATGCGGATGACATGGAAGG + Exonic
1119619413 14:76120590-76120612 ATTGCTGTCCATAATGTGGATGG + Intergenic
1119897624 14:78233176-78233198 TTTGATGTGCACATCCTGGAAGG + Intergenic
1123822950 15:24049293-24049315 GTACATGTGCACAACGTGCAGGG - Intergenic
1127818370 15:62632790-62632812 GTGGTTGTGCAGAATGTGGAGGG + Intronic
1127909874 15:63407701-63407723 GTTGATGTGCATAAAGCGTCTGG + Intergenic
1136164700 16:28445613-28445635 GTTGCTGTGCATTCCGTGAAAGG - Intergenic
1136198266 16:28669368-28669390 GTTGCTGTGCATTCCGTGAAAGG + Intergenic
1136214612 16:28783544-28783566 GTTGCTGTGCATTCCGTGAAAGG + Intergenic
1136259333 16:29063389-29063411 GTTGCTGTGCATTCCGTGAAAGG + Intergenic
1139995345 16:70975546-70975568 ATTGAGGTGCATAACTTGAATGG + Intronic
1140633273 16:76880596-76880618 GTGCATGTGCACAACGTGCAGGG - Intergenic
1141079432 16:81037035-81037057 CCTGTTTTGCATAACGTGGAGGG - Intronic
1141383212 16:83594802-83594824 GTAGCTGTGCAAAACGTCGAGGG + Intronic
1144389748 17:14783002-14783024 TTTAATGTGCATAGCGTGGAGGG + Intergenic
1146649638 17:34598636-34598658 TTTGATGTGCAGAAGGTGGAAGG + Intronic
1146972162 17:37082085-37082107 GTTGATGTGAATCAAGTGCAGGG - Intergenic
1148348636 17:46922440-46922462 GTACATGTGCACAACGTGCAGGG - Intergenic
1162717583 19:12643620-12643642 GTTGATGCGGATGACGTGGAAGG + Intergenic
1163823017 19:19507108-19507130 TTTTTTGTGCATAACTTGGATGG + Exonic
1164155457 19:22593890-22593912 GCTGAAGTGCATGATGTGGATGG + Intergenic
1166162343 19:40964243-40964265 GTATATGTGCACAACGTGCAGGG + Intergenic
943205551 2:184889047-184889069 GTTGGAGTGAATAATGTGGAGGG - Intronic
1170285274 20:14701357-14701379 GTTGATGTGGAAAACATGCAAGG - Intronic
1171275051 20:23849540-23849562 GTACATGTGCACAACGTGCAGGG - Intergenic
1172745571 20:37205288-37205310 GTTGCTGAGCATAAGGGGGAAGG - Intronic
1177941767 21:27420724-27420746 GTTGATGCGGATGACGTGGAAGG + Intergenic
949188997 3:1228655-1228677 GTTGATGTGGATAAAGTAGAAGG + Intronic
949287491 3:2424099-2424121 GTACATGTGCACAACGTGCAGGG + Intronic
949814031 3:8039563-8039585 GTTGAGGTGCACAACGGTGAGGG + Intergenic
954014922 3:47679965-47679987 GTTGATGTGCATATAGTTCAAGG + Intronic
954854981 3:53636087-53636109 GTGGATGTGTATATGGTGGAGGG + Intronic
954931951 3:54291015-54291037 GTACATGTGCACAACGTGCAGGG - Intronic
956618641 3:71198459-71198481 GTTGTTGTGCATAAGGAGAAGGG + Intronic
960017752 3:112912217-112912239 GTTGATCTGCCTAATGTTGACGG - Intergenic
960620904 3:119635857-119635879 GTTGATGTGCATAACGTGGAAGG + Intergenic
961714408 3:128848812-128848834 CTTGATGTGCATAGAGTAGAAGG + Intergenic
961997288 3:131259459-131259481 GTTGAAGTGGATAAGGTTGAGGG - Intronic
964185225 3:153934363-153934385 GTACATGTGCACAACGTGCAGGG - Intergenic
964664544 3:159157741-159157763 TTGTATGTGCATAAAGTGGAAGG - Intronic
965075719 3:163973109-163973131 GATCATGTGCATAACGTGATAGG + Intergenic
976762948 4:88569713-88569735 GCTGATATGCATGACCTGGAGGG - Intronic
977718125 4:100207150-100207172 GCTGAAGTGCATAATGTGGATGG + Intergenic
977877887 4:102170022-102170044 GTTAGTGAGGATAACGTGGATGG - Intergenic
980334804 4:131457708-131457730 CTTGGTGTGCATAAAGTTGATGG - Intergenic
982686795 4:158500371-158500393 GTACATGTGCATAATGTGCAGGG + Intronic
982764908 4:159335198-159335220 GGTGATGTGCATAGAGAGGAAGG + Intronic
1001074643 5:168616629-168616651 GTTGATGCGGATGACGTGGAAGG - Intergenic
1005578451 6:27211517-27211539 GTTGATGCAGATGACGTGGAAGG - Intergenic
1008024884 6:46624156-46624178 GATGATGGGGATAACGTGGGGGG - Intronic
1011526139 6:88267109-88267131 GTGCATGTGCACAACGTGCAGGG + Intergenic
1014218828 6:118779774-118779796 GTTGGTGTGCAGCACCTGGATGG + Intergenic
1014326184 6:119997780-119997802 GTTGAGTGGCATAACATGGAAGG - Intergenic
1016621716 6:146118471-146118493 GTACATGTGCACAACGTGCAGGG + Intronic
1016736136 6:147482358-147482380 GTACATGTGCACAACGTGCAGGG + Intergenic
1027568754 7:79834419-79834441 GTACATGTGCACAACGTGCAGGG + Intergenic
1030497069 7:110313858-110313880 GATGATGCACACAACGTGGATGG - Intergenic
1031949882 7:127881303-127881325 TTTAATGTGCATAGCATGGAGGG - Intronic
1035467371 7:159088574-159088596 TGTGATGTGAATAACGTGGTGGG - Intronic
1038716602 8:29996843-29996865 GTGGATGTGAATTACATGGATGG - Intergenic
1042475344 8:69242713-69242735 GCTGATGTGCATGTCGGGGAGGG + Intergenic
1043870060 8:85422418-85422440 GTTGATCTGTCTAATGTGGATGG + Intronic
1046086982 8:109449973-109449995 GTTAATGTACATAAAGTGGATGG + Intronic
1047810818 8:128406959-128406981 GTTGATTTGCATAAAGTCCACGG + Intergenic
1059002063 9:110358847-110358869 GTACATGTGCACAACGTGCAGGG + Intergenic
1059853850 9:118373386-118373408 GTACATGTGCACAACGTGCAGGG - Intergenic
1186233762 X:7484738-7484760 ATTGATGTGCTTACCGAGGAAGG - Intergenic
1188716457 X:33464776-33464798 GTACATGTGCACAACGTGGTGGG + Intergenic
1190191717 X:48282128-48282150 TTTGATGTGCAGAACATGGCTGG + Intergenic
1191643112 X:63449931-63449953 GTTGATGTGTCTAATGTTGATGG + Intergenic
1193374181 X:80738605-80738627 GTTGCTGTGCACACAGTGGAGGG + Intronic
1194098350 X:89671916-89671938 ATACATGTGCAGAACGTGGAGGG + Intergenic
1194222963 X:91218986-91219008 GTACATGTGCACAACGTGTAAGG + Intergenic
1196428935 X:115601590-115601612 GTACATGTGCACAACGTGCAGGG - Intronic
1198440804 X:136661195-136661217 GTTGATGAGCATAGGCTGGAGGG - Intergenic
1199387069 X:147235479-147235501 GTTCATGTGCATATTGTGGTTGG - Intergenic
1200222796 X:154399890-154399912 GTTGATGCGGATGACGTGGAAGG - Exonic
1200451373 Y:3333294-3333316 ATACATGTGCAGAACGTGGAGGG + Intergenic
1200559440 Y:4682441-4682463 GTACATGTGCACAACGTGTAAGG + Intergenic
1200957003 Y:8959299-8959321 GTATATGTGCACAACGTGCAGGG - Intergenic