ID: 960621817

View in Genome Browser
Species Human (GRCh38)
Location 3:119644441-119644463
Sequence GGGATGATTTGGGGTCTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 246}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960621807_960621817 26 Left 960621807 3:119644392-119644414 CCTGTGGAGAGTGGCCATCGAAT 0: 1
1: 0
2: 0
3: 2
4: 51
Right 960621817 3:119644441-119644463 GGGATGATTTGGGGTCTGGCTGG 0: 1
1: 0
2: 0
3: 22
4: 246
960621808_960621817 12 Left 960621808 3:119644406-119644428 CCATCGAATTAAACAGAAAAATT 0: 1
1: 0
2: 1
3: 30
4: 457
Right 960621817 3:119644441-119644463 GGGATGATTTGGGGTCTGGCTGG 0: 1
1: 0
2: 0
3: 22
4: 246
960621806_960621817 27 Left 960621806 3:119644391-119644413 CCCTGTGGAGAGTGGCCATCGAA 0: 1
1: 0
2: 1
3: 6
4: 83
Right 960621817 3:119644441-119644463 GGGATGATTTGGGGTCTGGCTGG 0: 1
1: 0
2: 0
3: 22
4: 246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960621817 Original CRISPR GGGATGATTTGGGGTCTGGC TGG Intronic
904305688 1:29587522-29587544 GGGGTGATTTGGGGCAGGGCAGG - Intergenic
904350503 1:29902242-29902264 GGGAAGAATTGGGGACAGGCAGG + Intergenic
905652904 1:39668426-39668448 GGGATGGATTGGGGTCTGTCTGG - Intronic
905773513 1:40653584-40653606 GGGAGGGTTTGGGCTGTGGCGGG + Intronic
906522948 1:46477986-46478008 GGGATTCTTTGGGGGCTGGGAGG - Intergenic
906917027 1:50023353-50023375 GGCATGATTTGGGCTCGGGGTGG - Intronic
907808569 1:57845300-57845322 GGGCTGGTTTGGGGGTTGGCAGG + Intronic
911636351 1:100239896-100239918 AGGCTGACTTGGGGTCTGCCTGG + Intronic
913338667 1:117734319-117734341 GGACCAATTTGGGGTCTGGCTGG - Intergenic
915040917 1:152967609-152967631 GGGTTGATTTGAGGGGTGGCAGG + Intergenic
915949312 1:160177518-160177540 GGGATGATCCAGGCTCTGGCTGG + Exonic
917254882 1:173103687-173103709 GGAATGATGTGGAGTTTGGCGGG - Intergenic
917294221 1:173502309-173502331 GGGATGACTTGGCACCTGGCTGG + Intronic
917531655 1:175841507-175841529 GGGATAATATCGGGGCTGGCAGG - Intergenic
918527990 1:185486016-185486038 GGGATGAGTTGGAGTGAGGCAGG + Intergenic
920017938 1:202928324-202928346 TGGATGTTGTGGGGTCCGGCAGG + Intronic
920219680 1:204387723-204387745 GGGAAGATTTGGGGTATATCTGG - Intergenic
920448244 1:206036755-206036777 TGGATGATTTGGGGTGGGGCAGG - Intergenic
921381818 1:214532377-214532399 GGGATGGCTGGGGGCCTGGCAGG + Intronic
922452856 1:225750808-225750830 GGGAGGACTTGGGGGCTGGGAGG - Intergenic
922732554 1:227958708-227958730 GGGCTGCTTTGGGGTTTGGAGGG - Intergenic
922808262 1:228401670-228401692 GGGTAGATTTGGGGTCTGGGAGG - Intronic
923914920 1:238491549-238491571 GGGATGGCTGGGGATCTGGCAGG + Intergenic
924741232 1:246795234-246795256 GGGAGGACTCGGGGCCTGGCAGG - Intergenic
1063340084 10:5254364-5254386 GGGCAGATTCAGGGTCTGGCGGG - Intergenic
1066049413 10:31620374-31620396 GGGGTGATTTGGGGCCAGGAGGG - Intergenic
1067744139 10:48922256-48922278 GGGATGATTCAAGGTCTGGGTGG - Intronic
1068041145 10:51825784-51825806 GAGATGGTTTGGGGTGTGGAGGG + Intronic
1068690104 10:59906031-59906053 GGGAAGACTTGGGGGGTGGCTGG + Intronic
1070832154 10:79424742-79424764 GGGAGGAGTGGGGGTGTGGCTGG - Intronic
1071451172 10:85792493-85792515 GGAATGATTTGTTCTCTGGCAGG + Intronic
1073254653 10:102142963-102142985 GAGATGATTTGGGGGCTTCCTGG + Intronic
1074828098 10:117229025-117229047 GGGATTATTTTGCTTCTGGCTGG + Intergenic
1077241452 11:1512757-1512779 GGGGTGATTAGGGGTGGGGCTGG + Intergenic
1077241505 11:1512877-1512899 GGGGTGATTAGGGGTGGGGCTGG + Intergenic
1077553417 11:3214322-3214344 GGGATGATTTGAGGTCCAACTGG + Intergenic
1077842989 11:5994943-5994965 GGGATGGCCGGGGGTCTGGCAGG - Intergenic
1079017711 11:16883560-16883582 AGGATGACTTGGGGACTGGTGGG - Intronic
1080827617 11:35861318-35861340 GGGATGGCTGGGGGTCTGGCAGG - Intergenic
1081109824 11:39121142-39121164 GTGCTGCTTTGGGCTCTGGCAGG + Intergenic
1081732536 11:45381659-45381681 AGGATGAGTGGGGGTCTGCCTGG + Intergenic
1083642683 11:64153891-64153913 GGGATTATTTGAGGGCAGGCAGG - Intronic
1084508614 11:69587365-69587387 GGGATGCTTTGGGTTTTAGCAGG - Intergenic
1084733709 11:71091250-71091272 GGGATGAGTAGGGGTCTGTGGGG - Intronic
1085253996 11:75162060-75162082 GGTGTGATTTGGGGATTGGCTGG + Intronic
1089367327 11:117929059-117929081 GCTGGGATTTGGGGTCTGGCTGG - Intronic
1089885211 11:121814832-121814854 GGGATGATCTGGGCACTGGTTGG + Intergenic
1092548414 12:9471507-9471529 GGGATGATATGGAGGGTGGCAGG - Intergenic
1093698545 12:22191265-22191287 TGGAGGATTCAGGGTCTGGCTGG - Intronic
1094504589 12:31050942-31050964 GGGATGATATGGAGGGTGGCAGG + Intergenic
1095713283 12:45313560-45313582 GGAATGATACGGGGTATGGCAGG - Intronic
1097950286 12:65419802-65419824 GGGATGGCTAGGGGTCTGGCAGG - Intronic
1101154931 12:101918386-101918408 GGGATGATACGGGATGTGGCAGG + Intronic
1101455169 12:104824387-104824409 AGAATGATGTGGAGTCTGGCTGG + Intronic
1101469032 12:104977811-104977833 GGGATGGCTGGGGGTCTGGCAGG - Intergenic
1102229999 12:111256026-111256048 GGGGTGCTTTGGGGTCTGGGTGG - Intronic
1102495388 12:113315790-113315812 GGAATGATGTGGGGCCTGGAAGG - Intronic
1103160262 12:118723067-118723089 GGTATGGTCTGTGGTCTGGCTGG + Intergenic
1104136500 12:125944632-125944654 GGGCTGAGGTGGGGCCTGGCAGG + Intergenic
1104530166 12:129562715-129562737 TGGGTGATTTGGGGAGTGGCAGG - Intronic
1106584323 13:31044034-31044056 GGGATGATCTGGGAACTGCCCGG + Intergenic
1113263458 13:108592103-108592125 GGGAGGATTTGGGGTATGTATGG + Intergenic
1113619030 13:111700683-111700705 GGCATGAGTTGGGGACAGGCAGG - Intergenic
1113624559 13:111785944-111785966 GGCATGAGTTGGGGACAGGCAGG - Intergenic
1114216235 14:20659733-20659755 GGCACGAATTGGGGTCTGGCTGG + Intergenic
1114622120 14:24102504-24102526 GAGAGGAATTGGGGTTTGGCAGG - Intronic
1115304665 14:31921903-31921925 TGGTTGATTTGGGGTGTGGGGGG + Intergenic
1115531681 14:34333720-34333742 GTGATGCTTTGGGGTGTGGGTGG - Intronic
1115662731 14:35512869-35512891 GGGATGGCCAGGGGTCTGGCAGG - Intergenic
1116898810 14:50342384-50342406 GGGATGATTCAGGCTCTGACAGG - Intronic
1118905050 14:70017744-70017766 GGGATCATTTCTGGTCTGGAAGG + Intronic
1119117173 14:72035013-72035035 GGGATGATTTAAGTTCTGGGTGG - Intronic
1119547118 14:75479975-75479997 GGAAGGATTTGGGGGCTGGCGGG - Intergenic
1122785173 14:104160198-104160220 GGGTTGAGTAGGAGTCTGGCAGG + Intronic
1125825731 15:42674670-42674692 GGGAGGATTTCAGGTCTGGGTGG + Intronic
1126139344 15:45424575-45424597 GGGCTGCTTTGGGGGCTGCCAGG + Intergenic
1129237557 15:74232928-74232950 GGGATGATATCTGGTCTGGGTGG - Intergenic
1130048817 15:80466553-80466575 GAGACAATTTGGGGTCTGCCTGG - Intronic
1134196519 16:12163305-12163327 AGGCTGATTAGGGGTTTGGCAGG + Intronic
1134536215 16:15028796-15028818 GGAATGATGTGGGGTTTGGAGGG + Intronic
1137362511 16:47831791-47831813 TGGATGATTTGGGGACAGGTTGG + Intergenic
1137731790 16:50695104-50695126 GCTTTGACTTGGGGTCTGGCAGG + Intronic
1137929581 16:52574154-52574176 GGGATTATTGGGGGTCGGGGTGG + Intergenic
1138215833 16:55204569-55204591 TGGCAGATTTGGTGTCTGGCAGG - Intergenic
1139859849 16:70011991-70012013 GGAATGATGTGGGGTTTGGAGGG - Intergenic
1141158433 16:81612762-81612784 CGGGGGACTTGGGGTCTGGCTGG + Intronic
1141173850 16:81706692-81706714 GGCCTGATCTGGGGTGTGGCAGG + Intronic
1142266831 16:89067812-89067834 GGGATCCCTGGGGGTCTGGCTGG + Intergenic
1143223718 17:5282578-5282600 GGGAGGATTTCGGGGCGGGCAGG + Intronic
1143399840 17:6637078-6637100 GGGAATATTTTGGGACTGGCCGG - Intronic
1143400137 17:6638235-6638257 GGGAGGAGCTGTGGTCTGGCGGG - Intronic
1144595932 17:16570061-16570083 GGGATGATTTGATGGCTGGGAGG + Intergenic
1145168194 17:20632867-20632889 GCGCTGAGTGGGGGTCTGGCCGG + Intergenic
1145206681 17:20988157-20988179 GGGGTGAGGTGGGGTCTGGCAGG - Intergenic
1146341688 17:32024883-32024905 AGGCTGATTTGGGGTATGGAGGG - Intronic
1146842177 17:36163772-36163794 GGGATGACCTGAGGTCTGGATGG - Intergenic
1146854485 17:36251731-36251753 GGGATGACCTGAGGTCTGGATGG - Intronic
1146870387 17:36375623-36375645 GGGATGACCTGAGGTCTGGATGG - Intronic
1146877744 17:36426704-36426726 GGGATGACCTGAGGTCTGGATGG - Intronic
1147057312 17:37844460-37844482 GGGCTGATGTGGGGACTGTCAGG + Intergenic
1147069003 17:37937257-37937279 GGGATGACCTGAGGTCTGGATGG + Intergenic
1147073269 17:37976247-37976269 GGGATGACCTGAGGTCTGGATGG - Intergenic
1147080528 17:38016794-38016816 GGGATGACCTGAGGTCTGGATGG + Intronic
1147084790 17:38055785-38055807 GGGATGACCTGAGGTCTGGATGG - Intronic
1147096474 17:38140754-38140776 GGGATGACCTGAGGTCTGGATGG + Intergenic
1147100738 17:38179751-38179773 GGGATGACCTGAGGTCTGGATGG - Intergenic
1147996469 17:44362771-44362793 GGGGTGATATGGGGGCGGGCAGG + Intronic
1148799843 17:50216986-50217008 GGGATGATGTAGGATCTGTCAGG - Intergenic
1149936290 17:60810361-60810383 GGGATGGCGGGGGGTCTGGCAGG + Intronic
1149960650 17:61105959-61105981 GGGATGATTCACGGTCTGGGAGG - Intronic
1150083672 17:62262798-62262820 GGGATGACCTGAGGTCTGGATGG - Intergenic
1152092073 17:78252593-78252615 GGGATGAGTGGGGGGCTGGACGG + Intergenic
1152677809 17:81650731-81650753 GGGACGATCTGGGGTCCAGCAGG + Exonic
1152700446 17:81815790-81815812 GGGTGGAGTTGGGGACTGGCAGG + Intergenic
1152805863 17:82355989-82356011 TGGAGGCTTTGGGGGCTGGCTGG + Intergenic
1154111993 18:11578082-11578104 GGGATGATTTTGGTTCTCTCTGG - Intergenic
1154429278 18:14296042-14296064 GTGATGATTTAGGGTATGTCTGG + Intergenic
1154959889 18:21297567-21297589 GGGGTGATCTGGGGTCTGGGAGG + Intronic
1157434591 18:47657740-47657762 GGGATGACTTTGGTTCTGGATGG + Intergenic
1159893101 18:73971749-73971771 GGGCTCATATGGGGTGTGGCTGG - Intergenic
1160536873 18:79599212-79599234 GGGCTGCTCTGGGCTCTGGCTGG - Intergenic
1161080278 19:2307103-2307125 GGGACGATCTGGGGCTTGGCTGG - Intronic
1162675280 19:12294263-12294285 GGGGTGTTTAGGGGTCTGGACGG - Intronic
1163769210 19:19180545-19180567 GGGATGATTTCGGAGGTGGCAGG - Intronic
1163808649 19:19416348-19416370 GAGATGATTTGGGGTGGGGGTGG + Intronic
1164844752 19:31422381-31422403 GGGGCGATTTGGGGAGTGGCCGG + Intergenic
1165897922 19:39154717-39154739 GGGCAGGTTTGGGCTCTGGCGGG - Intronic
1165925114 19:39321475-39321497 GGTATGATTTGGGGTCCGTGAGG - Intergenic
1166372282 19:42308874-42308896 GAGATGTTTTGGGGTGTGGTGGG - Exonic
1167474195 19:49690758-49690780 GGGATGTTTGGGGGTCAGGACGG - Intergenic
1167798474 19:51726068-51726090 GTGAGGACTTGGTGTCTGGCAGG - Intergenic
1168006911 19:53497477-53497499 GGTATGATGTGTGCTCTGGCAGG + Intergenic
929259318 2:39847059-39847081 AGGATGATTTGGAGTTTGTCAGG + Intergenic
929553858 2:42911712-42911734 CTGATTATTTGGGCTCTGGCTGG - Intergenic
931650480 2:64464001-64464023 GGGATGATGTGGGGTTTTGGGGG + Intergenic
934674097 2:96237361-96237383 GGGTTGATCAGGGGTCTGGAAGG + Intergenic
934744999 2:96753542-96753564 GGGTTGATCAGGGGTCTGACTGG - Intergenic
938390000 2:130897480-130897502 GGGGTAATGTGGGGCCTGGCGGG + Intronic
939615945 2:144362292-144362314 TGGATGCTTTGGGGTCTGATGGG - Intergenic
939881734 2:147639294-147639316 GGGATAATTTGGGGTTGGGGTGG + Intergenic
942971424 2:181962261-181962283 GGGATGGCCGGGGGTCTGGCAGG - Intronic
944680477 2:202072717-202072739 GCAATGATTGGGGGTCTTGCTGG - Intergenic
946559143 2:220892801-220892823 GTGAAGAATTGGGGGCTGGCTGG - Intergenic
946682082 2:222227960-222227982 GACATGATTTGGGGTTTGGGGGG + Intronic
1168982640 20:2021099-2021121 GGAAGGATTTGGTGTCTGGAAGG - Intergenic
1169113909 20:3050336-3050358 TGGTAGATTTGGGGTCTAGCTGG + Intergenic
1171077767 20:22146728-22146750 GGGATGAATTGGGTTCTGTCAGG + Intergenic
1171384225 20:24756836-24756858 GGGATGAAGTGGAGTTTGGCTGG - Intergenic
1171390318 20:24797519-24797541 AGGATGATTTGGGGGTTTGCAGG - Intergenic
1172795383 20:37533389-37533411 GGGTTCATTTTGGGTCTGGTAGG + Intergenic
1172935442 20:38616809-38616831 GGGATGCTTTGGCGTCTAGTGGG + Intronic
1174349533 20:49956938-49956960 GGGATGGCTGGGGATCTGGCAGG + Intergenic
1178631286 21:34263609-34263631 GGAATGATTTGGGGACTGGTGGG - Intergenic
1178823576 21:35996822-35996844 GGGATGATTTTAGATCTTGCTGG + Intronic
1179110903 21:38444285-38444307 GTGGTGATTTGGGGTCAGACTGG + Intronic
1179943372 21:44654188-44654210 GGGAGGATGTGGGGACTGCCTGG + Intronic
1180629811 22:17220696-17220718 GGGTAGATTTGGGGTCTTGGGGG - Intronic
1180887532 22:19257718-19257740 GGGATGGCCAGGGGTCTGGCAGG + Intronic
1181092525 22:20483888-20483910 GGGATGGCTGGGGATCTGGCAGG - Intronic
1182147952 22:28008754-28008776 GGGGTGATTTGGGATCTGAGTGG + Intronic
1182876943 22:33700484-33700506 GGGATGACATGAGGGCTGGCGGG + Intronic
1184908977 22:47513254-47513276 GGGTTCATTTGGGGCTTGGCAGG - Intergenic
1185122700 22:48982034-48982056 GATATGATTTGGGGTCAAGCTGG + Intergenic
949186703 3:1200502-1200524 TGGACCTTTTGGGGTCTGGCAGG + Intronic
950142811 3:10627127-10627149 GGGAAGCTTTGGCATCTGGCAGG - Intronic
950403384 3:12788455-12788477 GGGATGGCTGGGGGTCTGGCAGG - Intergenic
953376543 3:42433027-42433049 GGAATGATGTAGGGTCTTGCTGG + Intergenic
954169587 3:48790163-48790185 GTGATGATTTGCGTTCTGGGTGG + Intronic
959712501 3:109398983-109399005 GGGAGGATTTGGGTTGTAGCTGG + Intergenic
960621817 3:119644441-119644463 GGGATGATTTGGGGTCTGGCTGG + Intronic
961678387 3:128582435-128582457 GGGATGAGTTGTGGTTTGGAAGG - Intergenic
961865322 3:129949580-129949602 GGGATGTTTTGGAGTCAGTCAGG - Intergenic
962143503 3:132815982-132816004 TGGATGTTTTGGGGACTGGTTGG - Intergenic
965544758 3:169904039-169904061 GGGATGGGCGGGGGTCTGGCAGG - Intergenic
965712974 3:171575120-171575142 GGTATGATGTGAGCTCTGGCTGG - Intergenic
966938964 3:184733309-184733331 GCGATGACGTGGGGTCTGTCTGG + Intergenic
968506544 4:973625-973647 GGGCGGATCTGGGGGCTGGCGGG + Intronic
968613424 4:1567189-1567211 GGGAGGGTCTGGGCTCTGGCAGG - Intergenic
968741878 4:2335244-2335266 TGAATAATTTGGGGGCTGGCAGG - Intronic
970628055 4:17911869-17911891 GGGATGGCCGGGGGTCTGGCAGG + Intronic
972352129 4:38245556-38245578 TGGAAGATTTGGTGTCTGGTGGG - Intergenic
972538669 4:40020435-40020457 GGGATGGCCGGGGGTCTGGCAGG + Intergenic
973604016 4:52569185-52569207 GGGAGGATTTAGGGGCAGGCTGG + Intergenic
975991544 4:80264311-80264333 GGGAGGATTGGGGGTTGGGCGGG - Intergenic
977362911 4:96029143-96029165 AGGAAGATTTGGGGTCAGGGTGG + Intergenic
979050202 4:115920884-115920906 GGGATGGCCGGGGGTCTGGCAGG + Intergenic
979059894 4:116044217-116044239 GAGATGATTTAGGGTATGGTGGG - Intergenic
982549761 4:156783232-156783254 GGAATGAATTGGGGTCTGATTGG + Intronic
984210418 4:176840416-176840438 GGGATGATTCTGGTTCTGGGTGG - Intergenic
985021591 4:185697147-185697169 GGGATGCTTTGCTGTCTAGCGGG - Intronic
985082000 4:186275671-186275693 TGGATGCTTCGGGGTCTCGCAGG + Intronic
985427505 4:189845015-189845037 GGGATGTTTTGGGGGTTGGGGGG - Intergenic
985645978 5:1084969-1084991 GGGCTGGTGAGGGGTCTGGCAGG - Intronic
986291240 5:6400748-6400770 GGGTGGATGTGGGGTCTGCCTGG - Intergenic
986706776 5:10459481-10459503 GGGAGGACTTGGGCTTTGGCTGG - Intronic
990370061 5:55108860-55108882 AGGAAGCTATGGGGTCTGGCTGG - Intronic
990502425 5:56409928-56409950 TGGCTGAGTTGGGATCTGGCTGG - Intergenic
990569837 5:57067103-57067125 GGGATGATTTATGGCCTGGGTGG - Intergenic
991661745 5:68957763-68957785 GGGCTGAGTTGGAGTCTGACTGG - Intergenic
992205989 5:74430612-74430634 TGGATGCTTTGGGTGCTGGCAGG - Intergenic
992301556 5:75387196-75387218 GAGATGATTAGGGGTGAGGCAGG + Intronic
993167610 5:84377494-84377516 GGGATTATTTGAGGTCAGCCAGG - Intronic
995400213 5:111732720-111732742 GGGGTGAGGTGGGGTCGGGCTGG - Intronic
996452005 5:123636305-123636327 GGGATGGCCGGGGGTCTGGCAGG + Intergenic
996513334 5:124342229-124342251 GGATTGATTTGGGGCTTGGCTGG + Intergenic
997356704 5:133267172-133267194 GGGAGGAGATGGGGTCTGGGAGG + Intronic
999304683 5:150511921-150511943 GGGAAGCTGTGGGGTGTGGCTGG + Intronic
1000131946 5:158308785-158308807 AGGATGCTTTGGGTTCTGGTGGG + Intergenic
1002163891 5:177332861-177332883 TGGAGGAGCTGGGGTCTGGCTGG + Intronic
1002186741 5:177458145-177458167 GGGCAGAGTTGGGGTCTGGGGGG + Exonic
1002792574 6:446901-446923 AGAATGATCTGGGCTCTGGCTGG + Intergenic
1003267686 6:4580734-4580756 AGGATGGTTTGGGATCTGCCAGG - Intergenic
1005761269 6:28970200-28970222 GGGATGGCTGGGGTTCTGGCAGG - Intergenic
1006413800 6:33891834-33891856 GGAATGATTTGGGGTGGGGTAGG + Intergenic
1008526221 6:52409817-52409839 GGGAGGATTTGAGATTTGGCAGG - Intergenic
1011242551 6:85287915-85287937 GGGATGGCCGGGGGTCTGGCAGG + Intergenic
1013667384 6:112362509-112362531 GGGATGGCCGGGGGTCTGGCAGG - Intergenic
1014009298 6:116458388-116458410 GGGATGGCCAGGGGTCTGGCAGG - Intergenic
1014036608 6:116773931-116773953 GGCATGGTTGGGGGTCTGCCAGG - Intergenic
1015140678 6:129928108-129928130 GGTATGAGTTGGGGTAGGGCAGG + Intergenic
1015820596 6:137256490-137256512 AGGATAATTTGGTGTCTGCCAGG - Intergenic
1016680454 6:146823400-146823422 AGGATGATTTGGTGTTTGGGGGG - Intergenic
1017541503 6:155407784-155407806 GGGAGGATGTGGAGCCTGGCAGG + Intronic
1018035408 6:159877285-159877307 GGGCTGGTTTGGGGTCTGGGAGG + Intergenic
1018260066 6:161961344-161961366 GGGATGGCTTGGGGTTAGGCAGG + Intronic
1018275094 6:162121957-162121979 GTGATCATTAGGGGTCTGGTTGG + Intronic
1019215249 6:170438989-170439011 GGAATGATCTGGGGGCTGGGGGG + Intergenic
1019608777 7:1924627-1924649 GGGATCATTTCTGGTTTGGCAGG - Intronic
1020141537 7:5614651-5614673 GGGAGGAGATGGGGCCTGGCGGG + Intergenic
1020397579 7:7734238-7734260 GGTATGATTTTGGGTGTGCCAGG + Intronic
1024314886 7:48006639-48006661 AGGATGAAATGGGGTCTGGAGGG + Intronic
1029261347 7:99304783-99304805 GGGAGGAATGGGGATCTGGCGGG + Intergenic
1029284476 7:99456331-99456353 TGGATGATTTGGGATTTGGTGGG + Intronic
1029919696 7:104249933-104249955 GGGATGATTAGAAGTCTTGCAGG + Intergenic
1032765285 7:134986330-134986352 GAGAGGCTTTGGGGTCTGTCGGG - Intergenic
1033930709 7:146517110-146517132 GGGATGATTTATGGTCTGTATGG - Intronic
1034265824 7:149780187-149780209 GGGATTGACTGGGGTCTGGCGGG + Intergenic
1035085595 7:156254860-156254882 TGGCAGATTTGGTGTCTGGCAGG - Intergenic
1035553120 8:544955-544977 GGGATGGTTTGGGGGCGGGCCGG - Intronic
1036807995 8:11848282-11848304 TGGAGGGTTTGGGGTCTGGGAGG - Intronic
1036921540 8:12860176-12860198 GGGGTGATTTGTGCTCTGGCAGG - Intergenic
1038729382 8:30113539-30113561 GGGAGGACTTGGGGTGTGGCAGG + Intronic
1041372390 8:57175924-57175946 GGGATGTTTTGTTGTTTGGCAGG - Intergenic
1046462613 8:114560952-114560974 AGAATGTTTTGTGGTCTGGCTGG - Intergenic
1047157542 8:122337607-122337629 GGGAAGATGGGGGGTGTGGCAGG + Intergenic
1048283041 8:133119473-133119495 GGGAAGATTTGGTGTCTAGTAGG + Intronic
1048995254 8:139790007-139790029 GGGGTTATTTGGGGCCTGGCCGG + Intronic
1050633111 9:7581449-7581471 GACATAGTTTGGGGTCTGGCTGG + Intergenic
1052212054 9:25916309-25916331 TGGATGATTTGGTGGCGGGCAGG + Intergenic
1052613049 9:30800535-30800557 GGGATGGCCAGGGGTCTGGCAGG - Intergenic
1053279070 9:36805746-36805768 CGGATGAGCTGGGGTCTGGAGGG + Intergenic
1055609035 9:78002481-78002503 GGGCTGGTTTGGTGTCTGGAGGG - Intronic
1055708901 9:79037481-79037503 GGGATGGCCGGGGGTCTGGCAGG - Intergenic
1057739490 9:97699116-97699138 GGGATGGCCAGGGGTCTGGCAGG + Intergenic
1057957486 9:99423268-99423290 GGGATGATTTGTGCCCTGGGTGG - Intergenic
1061422199 9:130478478-130478500 GTCATGATTTGGGGACTGTCTGG + Intronic
1188994515 X:36866815-36866837 GGCATGAGCTGGGATCTGGCTGG - Intergenic
1189496600 X:41514401-41514423 GGTTTGATTTGGTCTCTGGCTGG - Intergenic
1189928585 X:45983557-45983579 GGGATGGCCGGGGGTCTGGCAGG + Intergenic
1190010014 X:46776323-46776345 GTGATCATTTGGGGATTGGCTGG + Intergenic
1192604671 X:72503422-72503444 GGGATGATTTGGGTTTTGTTTGG + Intronic
1193898229 X:87141058-87141080 GGGAGGATGTGGAGTTTGGCTGG + Intergenic
1194321938 X:92459862-92459884 GGGATGGCTGGGGGTCTGGCAGG + Intronic
1194966306 X:100292606-100292628 GGGATGTTTGGGGGTGGGGCTGG - Exonic
1197828068 X:130612133-130612155 TGGCAGATTTGGTGTCTGGCGGG + Intergenic
1197873480 X:131081982-131082004 GGGCGGATTAGGGGTCTGGCAGG + Intronic
1198807486 X:140505497-140505519 GGGAAGCTTTGCGGGCTGGCCGG - Exonic
1200085930 X:153605132-153605154 GGGATGGCCGGGGGTCTGGCAGG - Intergenic
1200630106 Y:5573339-5573361 GGGATGGCTGGGGGTCTGGCAGG + Intronic